ID: 1032456075

View in Genome Browser
Species Human (GRCh38)
Location 7:132074557-132074579
Sequence CAGGACATGGAGGAGTAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032456071_1032456075 13 Left 1032456071 7:132074521-132074543 CCTTTGTGCTTGCATAGCTTGCG No data
Right 1032456075 7:132074557-132074579 CAGGACATGGAGGAGTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032456075 Original CRISPR CAGGACATGGAGGAGTAAAC TGG Intergenic
No off target data available for this crispr