ID: 1032460801

View in Genome Browser
Species Human (GRCh38)
Location 7:132108889-132108911
Sequence TGGCATTTCGGCTCCTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032460795_1032460801 12 Left 1032460795 7:132108854-132108876 CCTTAGCTGCAAAGAAAGCCAGG No data
Right 1032460801 7:132108889-132108911 TGGCATTTCGGCTCCTAGGTAGG No data
1032460798_1032460801 -6 Left 1032460798 7:132108872-132108894 CCAGGAAAATAAGAATCTGGCAT No data
Right 1032460801 7:132108889-132108911 TGGCATTTCGGCTCCTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032460801 Original CRISPR TGGCATTTCGGCTCCTAGGT AGG Intergenic
No off target data available for this crispr