ID: 1032462570

View in Genome Browser
Species Human (GRCh38)
Location 7:132122726-132122748
Sequence CACCCACGCCGCTCAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032462570_1032462577 5 Left 1032462570 7:132122726-132122748 CCCACCTCTGAGCGGCGTGGGTG No data
Right 1032462577 7:132122754-132122776 TGGGTGTGCAAGGCAGGCAGTGG No data
1032462570_1032462578 10 Left 1032462570 7:132122726-132122748 CCCACCTCTGAGCGGCGTGGGTG No data
Right 1032462578 7:132122759-132122781 GTGCAAGGCAGGCAGTGGCATGG No data
1032462570_1032462575 -5 Left 1032462570 7:132122726-132122748 CCCACCTCTGAGCGGCGTGGGTG No data
Right 1032462575 7:132122744-132122766 GGGTGTTAGATGGGTGTGCAAGG No data
1032462570_1032462579 11 Left 1032462570 7:132122726-132122748 CCCACCTCTGAGCGGCGTGGGTG No data
Right 1032462579 7:132122760-132122782 TGCAAGGCAGGCAGTGGCATGGG No data
1032462570_1032462576 -1 Left 1032462570 7:132122726-132122748 CCCACCTCTGAGCGGCGTGGGTG No data
Right 1032462576 7:132122748-132122770 GTTAGATGGGTGTGCAAGGCAGG No data
1032462570_1032462580 25 Left 1032462570 7:132122726-132122748 CCCACCTCTGAGCGGCGTGGGTG No data
Right 1032462580 7:132122774-132122796 TGGCATGGGCTCCTTCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032462570 Original CRISPR CACCCACGCCGCTCAGAGGT GGG (reversed) Intergenic
No off target data available for this crispr