ID: 1032463017

View in Genome Browser
Species Human (GRCh38)
Location 7:132125838-132125860
Sequence CAGCTCTTCAAGGCCTTCAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 176}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032463017_1032463030 22 Left 1032463017 7:132125838-132125860 CCCTTGAAGGCCTTGAAGAGCTG 0: 1
1: 0
2: 1
3: 8
4: 176
Right 1032463030 7:132125883-132125905 ACTGTTCCTGGAAGGAGCAGGGG 0: 1
1: 0
2: 3
3: 29
4: 326
1032463017_1032463027 14 Left 1032463017 7:132125838-132125860 CCCTTGAAGGCCTTGAAGAGCTG 0: 1
1: 0
2: 1
3: 8
4: 176
Right 1032463027 7:132125875-132125897 CTGGGCTCACTGTTCCTGGAAGG 0: 1
1: 0
2: 3
3: 38
4: 215
1032463017_1032463025 -4 Left 1032463017 7:132125838-132125860 CCCTTGAAGGCCTTGAAGAGCTG 0: 1
1: 0
2: 1
3: 8
4: 176
Right 1032463025 7:132125857-132125879 GCTGGCTGGGGCTGCTCACTGGG 0: 1
1: 0
2: 2
3: 34
4: 334
1032463017_1032463026 10 Left 1032463017 7:132125838-132125860 CCCTTGAAGGCCTTGAAGAGCTG 0: 1
1: 0
2: 1
3: 8
4: 176
Right 1032463026 7:132125871-132125893 CTCACTGGGCTCACTGTTCCTGG 0: 1
1: 0
2: 5
3: 37
4: 245
1032463017_1032463028 20 Left 1032463017 7:132125838-132125860 CCCTTGAAGGCCTTGAAGAGCTG 0: 1
1: 0
2: 1
3: 8
4: 176
Right 1032463028 7:132125881-132125903 TCACTGTTCCTGGAAGGAGCAGG 0: 1
1: 0
2: 2
3: 18
4: 246
1032463017_1032463029 21 Left 1032463017 7:132125838-132125860 CCCTTGAAGGCCTTGAAGAGCTG 0: 1
1: 0
2: 1
3: 8
4: 176
Right 1032463029 7:132125882-132125904 CACTGTTCCTGGAAGGAGCAGGG 0: 1
1: 0
2: 0
3: 32
4: 272
1032463017_1032463024 -5 Left 1032463017 7:132125838-132125860 CCCTTGAAGGCCTTGAAGAGCTG 0: 1
1: 0
2: 1
3: 8
4: 176
Right 1032463024 7:132125856-132125878 AGCTGGCTGGGGCTGCTCACTGG 0: 1
1: 0
2: 4
3: 32
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032463017 Original CRISPR CAGCTCTTCAAGGCCTTCAA GGG (reversed) Exonic
900597787 1:3490393-3490415 CAGCCCTCCACGGCCCTCAAAGG + Exonic
902650067 1:17831279-17831301 CAGCTCTTGAAGGACATCAGGGG + Intergenic
905484867 1:38288348-38288370 CAGATCCTCAAGGCCATGAAGGG + Intergenic
906885450 1:49640697-49640719 CATCTCTCCAAGGCCTTCTATGG - Intronic
911341620 1:96645586-96645608 CATCTCTAGAAGGCCATCAAAGG + Intergenic
912096078 1:106145865-106145887 AAGGACTTCAAGTCCTTCAAGGG - Intergenic
912554821 1:110508343-110508365 CAGCTCTTCTGGACATTCAATGG - Intergenic
913314011 1:117534897-117534919 TAGCTCTTAAAGGCCTTGAGTGG + Intergenic
913798652 1:122663165-122663187 CACCTCTTTGAGGCCTTCATTGG + Intergenic
913848965 1:123566627-123566649 CACCTCTTTGAGGCCTTCATTGG + Intergenic
913932132 1:124984921-124984943 GAGCTCTTTGAGGCCTTCTATGG - Intergenic
913932941 1:125001723-125001745 GAGCTCTTTGAGGCCTTCATTGG + Intergenic
913933268 1:125007675-125007697 GAGCTCTTTGAGGCCTTCATTGG + Intergenic
913934786 1:125026108-125026130 GAGCTCTTTGAGGCCTTCATTGG + Intergenic
914956316 1:152165792-152165814 ATGCTATTCAAGGCCTTCCATGG + Intergenic
915126019 1:153665496-153665518 CAGGTGTTCAAGGTGTTCAAGGG - Intronic
915750383 1:158203956-158203978 CAGCTCTTTAACGGTTTCAAGGG - Intergenic
923335737 1:232968567-232968589 CAGATCCTAAAGGCCTTCGAAGG - Intronic
923398321 1:233589817-233589839 CAGCTTTTCCAGGCCATCCATGG + Intergenic
924370365 1:243341398-243341420 AAGCTCTTCAAGGCCATGACTGG - Intronic
924451484 1:244182698-244182720 CAGCTTTTCAAGGCCCACAGAGG + Intergenic
1063614574 10:7590842-7590864 CCTCTCTTCAAAGCCTTCCATGG + Intronic
1065708079 10:28489458-28489480 CAGCTCTGGAAGGCCTTCCTGGG + Intergenic
1066552442 10:36574323-36574345 TAGCTCTTCAAGGACTAAAAGGG + Intergenic
1067568250 10:47353332-47353354 CAGCTCTTCAAATACTTCAGGGG - Exonic
1068648317 10:59493537-59493559 CAGCTCGTCAATGCCATCACTGG + Intergenic
1069935581 10:71913515-71913537 CTGTTCTCCAATGCCTTCAAAGG + Intergenic
1069936763 10:71922785-71922807 CATCTCTTCATGGCCTTCTCTGG - Intergenic
1070281348 10:75051097-75051119 CTGCTCTCCTAGGCCTTCCAGGG - Intronic
1072937997 10:99732006-99732028 CTCCCCTTCAAGGCCCTCAACGG + Exonic
1073115209 10:101087908-101087930 CAGCCTTTCAAGGCCCTCAAGGG - Intergenic
1073204394 10:101761283-101761305 CAGTTCTCCCAGGCCTTCAGGGG + Intergenic
1073492010 10:103858951-103858973 ATGGTCCTCAAGGCCTTCAAAGG - Intergenic
1074155353 10:110793930-110793952 AAGCCCTTAAAGGTCTTCAAAGG - Intronic
1075607192 10:123820496-123820518 CAGCTCTCAGAGGCCTTCATAGG - Intronic
1075618589 10:123909269-123909291 CAGGTCTTCAGGGCCTGCAGGGG + Intronic
1079830608 11:25262993-25263015 CAGCCTTTCAGGGTCTTCAAGGG + Intergenic
1082157154 11:48837028-48837050 GAGCTCTTTGAGGCCTTCAGTGG + Intergenic
1089079447 11:115763622-115763644 AAGCTCATCAGGGCCTTAAATGG + Intergenic
1090830058 11:130414886-130414908 CAGCTCTTCATGGCCTGTGATGG + Intronic
1093436275 12:19138649-19138671 CACCTCTTCAAGTCGTTCCAGGG - Intronic
1094878442 12:34680908-34680930 CACCTCTTTGAGGCCTTCATTGG + Intergenic
1094883014 12:34817286-34817308 GAGCTCTTTGAGGCCTTCATTGG + Intergenic
1095969523 12:47892091-47892113 CAGCTCTTGAAGGCCTGGGAAGG + Intronic
1096124138 12:49107291-49107313 CAGCCCTACAAGGACTTCATTGG + Intronic
1096912677 12:54999938-54999960 CAGCTGTTCAAGGCCATCTCTGG - Intergenic
1097128585 12:56793015-56793037 CTTCTCTTCATGGCCTTCTATGG + Intergenic
1097408105 12:59216151-59216173 CTGCTATTCAAATCCTTCAATGG - Intergenic
1098028093 12:66226874-66226896 CAGCTCTCCCAGGGATTCAAGGG - Intronic
1100827365 12:98487616-98487638 CAGCTCAACAAGGCCATCATAGG - Intronic
1105203998 13:18204251-18204273 AAGGTCTTCAGGGACTTCAAGGG + Intergenic
1105439400 13:20402879-20402901 CACCTCCTCAAGACCTTCCAGGG + Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1108727533 13:53199673-53199695 CAGCTCTTCAGGCCCTTCTGTGG + Intergenic
1110897199 13:80769159-80769181 AGGATCTTCCAGGCCTTCAATGG + Intergenic
1114735254 14:25037102-25037124 GAGCTCTTCAGGGCCTTTCAGGG - Intronic
1119095336 14:71824730-71824752 CTGCTCTTCAAGACCATCGAGGG - Intergenic
1126799820 15:52288768-52288790 CAGCTCGCCAAGCCCTTCAGCGG + Intronic
1130935797 15:88469288-88469310 CAGCTCCTCACTGCCTTCAGTGG - Intronic
1138487739 16:57357676-57357698 CAGGACTTCAAAGCCTTCTAGGG - Intergenic
1138906117 16:61336079-61336101 TTGATCTTCAAGGACTTCAATGG - Intergenic
1139612632 16:68069890-68069912 CAGCTCTTGGAGGCCTGCAGGGG - Intronic
1140834453 16:78780397-78780419 CAGCTCTGCAAGACATCCAAAGG - Intronic
1142621589 17:1168896-1168918 CAGCTCATCCAGGCCTCCCAAGG + Intronic
1143733189 17:8892866-8892888 CAACTCTTCAAGGCCTGCAGAGG + Intronic
1145973077 17:28968337-28968359 CAGCTCTTCCAGCCCTTCCTTGG + Intronic
1147489500 17:40851799-40851821 CATTGCTTAAAGGCCTTCAAAGG - Intergenic
1148112166 17:45151191-45151213 CAGCTCTTTAAGACGTTCAGAGG + Exonic
1148622586 17:49045539-49045561 CAGCATTTCAAGGCCCTGAATGG - Intronic
1150649696 17:67001718-67001740 CTGCTCTTCCAGGACTTCAGGGG + Intronic
1150953445 17:69827785-69827807 CCTCTCTTCATGGCCTTCACTGG + Intergenic
1151247162 17:72803786-72803808 CTTCTCTTCAAGGCCATCCAGGG - Intronic
1152690196 17:81714465-81714487 CTGCCTTTCAAGGCCTTCTATGG + Intronic
1153342796 18:3992840-3992862 CAGGTCTTAAAGGTCTTCCAGGG - Intronic
1156957825 18:42990267-42990289 CAGCTTTTTAAGGTCTTCAATGG + Intronic
1158330799 18:56359855-56359877 AAGCTCTACAGGACCTTCAAAGG - Intergenic
1161812046 19:6476706-6476728 CAACTCTCCAAGACCTTCGAAGG + Intronic
1166977692 19:46614317-46614339 CAGCTCTTCAGGGTCTTCCGTGG - Intergenic
1167469342 19:49666691-49666713 CAGCTCTTCAGAGCCTGCCATGG - Exonic
1168564345 19:57411098-57411120 CCGCTCTGCTAGGCCTTCATTGG - Intronic
928371766 2:30745024-30745046 CAGCACCTCCAGGCCTTCCAGGG - Intronic
932177067 2:69612807-69612829 CAGTTAGTCAAAGCCTTCAAAGG + Intronic
933972004 2:87477408-87477430 TAGCTCTTCAGGGCATTCTATGG - Intergenic
936321723 2:111472789-111472811 TAGCTCTTCAGGGCATTCTATGG + Intergenic
937021628 2:118662306-118662328 CAGCCCTTAAAAGCCTTCATTGG + Intergenic
937361877 2:121235224-121235246 CGGCTCTTCAACGCCATCAAAGG - Exonic
937663915 2:124462951-124462973 CAGCTCTGATAGTCCTTCAAGGG - Intronic
945325962 2:208482732-208482754 CAGCTCTTCAAGGCCTCTTTAGG - Intronic
945614503 2:212051148-212051170 CAGCTCTTCTAAGCTTTGAAAGG + Intronic
947332389 2:229043936-229043958 CATCTTTTAAAGGACTTCAAAGG - Intronic
947562616 2:231170600-231170622 CAGCTCCTCAATGTCTTCACTGG - Exonic
947837707 2:233187697-233187719 CAGCTCTTCTGGGGCTTCAGTGG - Intronic
948236660 2:236396171-236396193 AAGCTATTCATGGCCCTCAAAGG + Intronic
1175977135 20:62716721-62716743 CAGCCCTTCATGGCCGTCCAGGG - Intronic
1176713974 21:10333829-10333851 AAGGTCTTCAGGGTCTTCAAGGG - Intergenic
1178508165 21:33180090-33180112 CAGCAATTCACCGCCTTCAAAGG - Intergenic
1178670374 21:34585195-34585217 CAGCTCTAAGAGGCCTTTAAGGG + Intronic
1179517797 21:41921001-41921023 CACCTCTTCAATTCCCTCAAAGG + Intronic
1179890012 21:44330685-44330707 CAGCTCTTCAAGGCCCTGTGAGG + Exonic
1181275396 22:21684827-21684849 GAGCTCTACAAGGAGTTCAAAGG + Exonic
1181436144 22:22912076-22912098 GAGCCTGTCAAGGCCTTCAAGGG - Intergenic
1183764165 22:39855231-39855253 CTGTTCTCCAAGGCCTACAATGG + Intronic
950585071 3:13886580-13886602 CAGCTCTTCAGAGCCTTCTCTGG - Intergenic
952399984 3:32954371-32954393 CAGCTCTTCAAAACCTGCAGGGG + Exonic
952608062 3:35173419-35173441 CAGCTCTTCTAGGCCTCTATAGG + Intergenic
952966348 3:38623435-38623457 CACCTCTGCAAGGCCTGCAGAGG + Intronic
954396279 3:50295088-50295110 CAGCTCTACAAGGCCTATACTGG - Exonic
955200823 3:56850740-56850762 CATCCATTCCAGGCCTTCAAGGG + Intronic
956121220 3:65967805-65967827 CAGCTCTTGAAGACCTCCCAGGG + Intronic
957787062 3:84896916-84896938 CAGCTCTTCTAGGCCTCCTTAGG - Intergenic
958273151 3:91534326-91534348 GACCTCTTTAAGGCCTTCATTGG - Intergenic
958643170 3:96835313-96835335 CAGCTTATCAAAGGCTTCAAAGG + Intronic
959589570 3:108063006-108063028 CAGCTCTTCTAAGCCTTAAGAGG - Intronic
961352479 3:126312807-126312829 CAGACCTTCAGGGCCTTAAAGGG - Intergenic
961650466 3:128414355-128414377 CAGCTCTTCAGCTCCTTCTAGGG + Intergenic
962023710 3:131526538-131526560 CAGCTCTTCAGAGCCTGCCATGG - Intergenic
962947712 3:140187085-140187107 CACCTCTTTAGGGACTTCAAGGG - Intronic
963246074 3:143064452-143064474 AAGCTTTGCAAGGCCCTCAAGGG - Intergenic
968061671 3:195730686-195730708 CAGGTCTCCATGGCCTGCAAGGG + Intronic
971475618 4:27069094-27069116 CACCTCTTCCAGGCCTTCCCAGG - Intergenic
974506286 4:62777329-62777351 CAGCTCTTCATGGCCATTGAGGG - Intergenic
977890105 4:102299822-102299844 CAGCTCTTCAAGGCCACTAGAGG - Intronic
985015110 4:185625756-185625778 CAGCTTTACAAGGCCTTAAAAGG + Intronic
988698717 5:33650655-33650677 AAGCTTTTCAAGGCCCTTAAAGG - Intronic
989793455 5:45436697-45436719 TATCTCTCCAAGTCCTTCAAAGG - Intronic
989909983 5:49622294-49622316 GACCTCTTTGAGGCCTTCAATGG - Intergenic
993292195 5:86087972-86087994 CTGCTCTTCAAAGACTCCAAAGG + Intergenic
994094609 5:95837874-95837896 CAACTCTTTGAGGCCTTCATAGG + Intergenic
994215098 5:97128969-97128991 CACATCTTCAAGTCCTTCTATGG + Intronic
997117389 5:131139679-131139701 CATCTCTTCATGGCCTTCCTTGG - Intergenic
1001255355 5:170178952-170178974 AACCTCTTGAAGGCCTTCTATGG - Intergenic
1001573371 5:172745412-172745434 CAGCTCTTAAAAGCATGCAACGG - Intergenic
1004080329 6:12386237-12386259 CAGCTCTCCATGTGCTTCAAAGG + Intergenic
1004264760 6:14139669-14139691 CAGCTCTGCAAGGCCTCCTAAGG - Intergenic
1005918803 6:30379966-30379988 CAGGTATTCAATGACTTCAAAGG - Intergenic
1006924734 6:37648148-37648170 CAGCTCTTCGAGGCATTCTCAGG - Intronic
1011455090 6:87540138-87540160 CAGTTCTTAAAGACCTTTAAAGG - Intronic
1011728370 6:90234009-90234031 CATCTCTTCTAGGCTTTCACTGG + Intronic
1014345004 6:120258243-120258265 CAGCTCTTCTGTGACTTCAAAGG - Intergenic
1022443598 7:30452550-30452572 CAGCTCGTCCAGGCCATCGAAGG + Exonic
1025315687 7:58024383-58024405 CAGCCCTTTGAGGCCTTCATTGG + Intergenic
1025315697 7:58024554-58024576 GAGCTCTTTGAGGCCTTCGAAGG + Intergenic
1025315834 7:58026940-58026962 GAGCTCTTTGAGGCCTTCATTGG + Intergenic
1025315945 7:58029153-58029175 TAGCTCTTTGAGGCCTTCATTGG + Intergenic
1025568511 7:62522691-62522713 GACCTCTTCAAGGCCTTCGTTGG + Intergenic
1026350169 7:69508668-69508690 CAGCTCTCCTAGGGCTTCATAGG + Intergenic
1026964730 7:74431896-74431918 AAGGTCTTCAAGGCTGTCAATGG - Intergenic
1027497002 7:78900359-78900381 CAGCTCTAAAAGGCCTTGTAGGG - Intronic
1028107441 7:86896511-86896533 AAGCTCTTCAAGACCTTCCTGGG + Intronic
1030411608 7:109188305-109188327 CGGCTCTTAAAGGACTTTAAGGG + Intergenic
1031563847 7:123270157-123270179 CAGCTGTCCAAGGCCTTCTGTGG + Intergenic
1032463017 7:132125838-132125860 CAGCTCTTCAAGGCCTTCAAGGG - Exonic
1033296761 7:140145383-140145405 CAGTTGCTCAAGGCCTTCCACGG - Intronic
1035548979 8:505598-505620 GAGATCTTCATGGCCTTCATGGG - Intronic
1039442326 8:37603570-37603592 CAGATGCTCAAGCCCTTCAAAGG - Intergenic
1040141181 8:43916087-43916109 GAGCACTTTGAGGCCTTCAATGG + Intergenic
1040142135 8:43933126-43933148 GAGTGCTTCAAGGCCTTCAATGG + Intergenic
1040142734 8:43943994-43944016 AAGCTCTTTGAGGCCTTCATTGG + Intergenic
1040271399 8:45950194-45950216 AAGCTCTTTGAGGCCTTCATTGG + Intergenic
1040476466 8:47782456-47782478 CAGCTCTTCCAGGTCATGAATGG - Exonic
1040924781 8:52668090-52668112 CCGATCTTCAAGTCCTTTAATGG + Exonic
1047496721 8:125414014-125414036 CACCTCTTCATTGCCTTCAGTGG - Intergenic
1050766595 9:9142196-9142218 CTGCTCTTCTAGGGCTTCTATGG - Intronic
1052304574 9:26992071-26992093 AAACTCTTTAAGGCCTTCAGGGG - Intronic
1055000910 9:71447619-71447641 CAGCAATTAAGGGCCTTCAAGGG + Intergenic
1055200755 9:73657913-73657935 AAGCTCTTCAGGGCTTTGAAGGG - Intergenic
1058579087 9:106435428-106435450 CTGCTCTTCCAGGTCTTCACTGG + Intergenic
1059965989 9:119614326-119614348 ATTCTCTTCAAGGCCTTCAGTGG - Intergenic
1060113321 9:120921936-120921958 CAGCTCTGCAAGGCCTTTCCAGG - Intronic
1203355816 Un_KI270442v1:141666-141688 GAGCTCTTTGAGGCCTACAATGG - Intergenic
1203372984 Un_KI270442v1:329641-329663 GAGCTCTTTAAGGCCTTCTGTGG + Intergenic
1185513757 X:682915-682937 CAGGTCATCAATGCATTCAATGG - Intergenic
1186802993 X:13112173-13112195 CAGCTATAAAAGGTCTTCAAAGG - Intergenic
1188076261 X:25779117-25779139 TAGCTGTTCAATGCCTTTAAAGG + Intergenic
1188194593 X:27217262-27217284 CCCCTCTGCAAGGCCCTCAATGG - Intergenic
1189245754 X:39561982-39562004 CAGGACATCAAGGCCTTCAGAGG + Intergenic
1190899874 X:54660906-54660928 GAGCTTTTCAAAGCCTTCCATGG + Intergenic
1192103090 X:68286580-68286602 CAGCTCTTCAAAGCTCTCCAAGG + Intronic
1192180165 X:68911269-68911291 CAGTCCTTCAAGGCCTTCCTTGG - Intergenic
1193394411 X:80967523-80967545 CAGCTCCTCAAGGCTTTCCTTGG - Intergenic
1195161055 X:102172170-102172192 AAGTTCTTAAAGACCTTCAAAGG - Intergenic
1195431828 X:104797640-104797662 TACCTCTTAAAGGCCTTAAAGGG - Intronic
1197686501 X:129444785-129444807 CAGCTCCCCAAGGCCTTCAATGG - Intergenic
1198552209 X:137756934-137756956 CAGCTGTACAAGGCCTTACATGG - Intergenic
1199296937 X:146170178-146170200 CAGCTCCTAAAGGCCATCTACGG - Intergenic
1200049477 X:153421263-153421285 CAGTGCGCCAAGGCCTTCAAGGG + Exonic