ID: 1032463221

View in Genome Browser
Species Human (GRCh38)
Location 7:132126957-132126979
Sequence GGAGAGACCCTGACATTTCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 205}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032463221_1032463232 20 Left 1032463221 7:132126957-132126979 CCAAGAAATGTCAGGGTCTCTCC 0: 1
1: 1
2: 2
3: 21
4: 205
Right 1032463232 7:132127000-132127022 TGGGTAAAAGCTGCATCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 148
1032463221_1032463233 21 Left 1032463221 7:132126957-132126979 CCAAGAAATGTCAGGGTCTCTCC 0: 1
1: 1
2: 2
3: 21
4: 205
Right 1032463233 7:132127001-132127023 GGGTAAAAGCTGCATCTGGGGGG 0: 1
1: 0
2: 0
3: 11
4: 144
1032463221_1032463234 29 Left 1032463221 7:132126957-132126979 CCAAGAAATGTCAGGGTCTCTCC 0: 1
1: 1
2: 2
3: 21
4: 205
Right 1032463234 7:132127009-132127031 GCTGCATCTGGGGGGACTTGTGG 0: 1
1: 0
2: 1
3: 15
4: 212
1032463221_1032463228 1 Left 1032463221 7:132126957-132126979 CCAAGAAATGTCAGGGTCTCTCC 0: 1
1: 1
2: 2
3: 21
4: 205
Right 1032463228 7:132126981-132127003 TATGGGGAAGGACAAAGAATGGG 0: 1
1: 0
2: 0
3: 32
4: 350
1032463221_1032463231 19 Left 1032463221 7:132126957-132126979 CCAAGAAATGTCAGGGTCTCTCC 0: 1
1: 1
2: 2
3: 21
4: 205
Right 1032463231 7:132126999-132127021 ATGGGTAAAAGCTGCATCTGGGG 0: 1
1: 0
2: 5
3: 16
4: 159
1032463221_1032463227 0 Left 1032463221 7:132126957-132126979 CCAAGAAATGTCAGGGTCTCTCC 0: 1
1: 1
2: 2
3: 21
4: 205
Right 1032463227 7:132126980-132127002 TTATGGGGAAGGACAAAGAATGG 0: 1
1: 0
2: 7
3: 48
4: 465
1032463221_1032463230 18 Left 1032463221 7:132126957-132126979 CCAAGAAATGTCAGGGTCTCTCC 0: 1
1: 1
2: 2
3: 21
4: 205
Right 1032463230 7:132126998-132127020 AATGGGTAAAAGCTGCATCTGGG 0: 1
1: 0
2: 0
3: 11
4: 165
1032463221_1032463229 17 Left 1032463221 7:132126957-132126979 CCAAGAAATGTCAGGGTCTCTCC 0: 1
1: 1
2: 2
3: 21
4: 205
Right 1032463229 7:132126997-132127019 GAATGGGTAAAAGCTGCATCTGG 0: 1
1: 0
2: 1
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032463221 Original CRISPR GGAGAGACCCTGACATTTCT TGG (reversed) Exonic
900129785 1:1082522-1082544 GCAGAGCCCCTGGCTTTTCTAGG + Exonic
901759536 1:11461784-11461806 GGACACACACTGACATTTCTGGG - Intergenic
902709039 1:18226323-18226345 GCAGAGACCCAGGCATTGCTCGG - Intronic
906140718 1:43531946-43531968 GGAGAGACCCTGGGATTGCAGGG - Intronic
907709508 1:56865686-56865708 GCAGAGACCCTATCATTTCAAGG + Intronic
909038472 1:70622473-70622495 GGAGAGAAAATGACATTTCAGGG + Intergenic
910632114 1:89366297-89366319 GCAGAGAACCTGACCCTTCTAGG + Intronic
911096651 1:94060621-94060643 GGAGACACCCTGATTTTTCAAGG + Exonic
913529997 1:119727025-119727047 GGAAAGACCCTGGGAATTCTTGG + Exonic
914356423 1:146888324-146888346 TGAGAGACCCTGTGATGTCTTGG - Intergenic
914781443 1:150789444-150789466 GGGGAAACCCTGACACTCCTGGG + Intergenic
915109860 1:153556513-153556535 GGTCAGACCCTGGCATATCTGGG + Intergenic
916360566 1:163962793-163962815 AGAGAGACTCAGAGATTTCTTGG + Intergenic
916678653 1:167085204-167085226 TGAGGGACTCTGACATTTCATGG + Intronic
916739764 1:167637841-167637863 GGAGAAACGCTGACTTTTCAGGG - Intronic
917058311 1:171007860-171007882 AGAGAGACCGGGTCATTTCTGGG + Intronic
918776778 1:188642481-188642503 AGTGAGCACCTGACATTTCTGGG - Intergenic
920055972 1:203192087-203192109 GGAGAGACCCACACATTTGGTGG - Intergenic
921583057 1:216917072-216917094 GGAGAGACCCTGAGATTCTAGGG - Intronic
921882927 1:220274645-220274667 GGAGAGACACTGTCAATGCTGGG - Intergenic
922019381 1:221688314-221688336 GGAAAGCACCTGACATTTATGGG + Intergenic
923881322 1:238107210-238107232 GGAAAGCCTCTGACACTTCTAGG - Intergenic
923908581 1:238413873-238413895 GGAGAGAGTCTCACATTTTTTGG - Intergenic
924571866 1:245244335-245244357 GAAGAGACTCTGACGTATCTTGG - Intronic
1062979725 10:1711825-1711847 GAAGAGGCTCTGACATTTCCAGG + Intronic
1063269328 10:4488808-4488830 GCAGAGACCCTGCAATTTCTGGG + Intergenic
1064227320 10:13498831-13498853 GAAGACACCCATACATTTCTGGG + Intronic
1065237275 10:23666086-23666108 GGAGAGACCATGACCTCTGTAGG + Intergenic
1068129182 10:52876156-52876178 AGAGAGGCCCTGAAATTTCATGG - Intergenic
1068398257 10:56492922-56492944 GTAGAGGCCATGACATTTCATGG - Intergenic
1070845003 10:79514454-79514476 GGAAACACCCTGACTTTTGTAGG + Exonic
1070928801 10:80245855-80245877 GGAAACACCCTGACTTTTGTAGG - Intergenic
1073125174 10:101144923-101144945 GTAGAGCCCCTGAGATTTGTAGG - Intergenic
1073578859 10:104645657-104645679 GGGGAGATGCTGATATTTCTAGG + Intronic
1073948833 10:108784021-108784043 GGAGAGCACATGGCATTTCTAGG + Intergenic
1074873906 10:117599600-117599622 GGAGAGGCCCTGCCATTTGATGG + Intergenic
1075234331 10:120712711-120712733 GCAGAGGCCCCGACATTTCTGGG - Intergenic
1075703112 10:124482033-124482055 AGAAAGCCCTTGACATTTCTGGG + Intronic
1076961612 10:133766678-133766700 GGAGAGACTCTCACACATCTGGG + Intergenic
1077135041 11:994269-994291 GGTGAGGCCCTGACAGGTCTGGG - Intronic
1077661219 11:4070227-4070249 GGTGAGGCCCTGCCAGTTCTTGG + Intronic
1078048524 11:7940584-7940606 GGGGAGACTCTGAAGTTTCTCGG - Intergenic
1078436018 11:11326691-11326713 GAAGGGACTCTGACATTTCAGGG + Intronic
1079237267 11:18699503-18699525 GGAGAGACCCTGACAGTTATAGG - Intronic
1079387845 11:19996837-19996859 AGAGAGACCCTGACATTTTGAGG + Intronic
1080314088 11:30928576-30928598 TGATAGACCTTGACATTTCGGGG + Intronic
1082218218 11:49600646-49600668 GGAAAGACCCTGGTATGTCTGGG + Intergenic
1082834180 11:57639791-57639813 GGAGAGACCTGGAAACTTCTTGG + Intergenic
1083465466 11:62842645-62842667 GGAGAGGCCCTGTGGTTTCTCGG - Intergenic
1084749717 11:71196630-71196652 AGAGAGCCTTTGACATTTCTAGG - Intronic
1086631352 11:89023471-89023493 GGAAAGACCCTGGTATGTCTGGG - Intronic
1092333275 12:7605246-7605268 GCTGAGAACCTGACGTTTCTAGG - Intergenic
1092770360 12:11891158-11891180 GAAGTGTCCCTGCCATTTCTGGG - Exonic
1094408860 12:30148409-30148431 GGAGAGACCATTACACTGCTAGG + Intergenic
1095640012 12:44476813-44476835 GGAGAGAACATGGCATTTCCAGG + Intergenic
1096028390 12:48388154-48388176 GGAGTGACCCTAATATTTCTTGG + Intergenic
1096260331 12:50086121-50086143 GGTGAAACCATGACATCTCTGGG + Intronic
1096843529 12:54392825-54392847 GGAAAGAGACTGACATTCCTGGG + Intergenic
1100598657 12:96093206-96093228 TGAGAGCCCGTGACATGTCTAGG - Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101429725 12:104616924-104616946 GAAGAGGCCCTGACCTCTCTTGG + Intronic
1101968849 12:109298683-109298705 GCAAAGACCCCGACATTTGTGGG + Intronic
1103957263 12:124584156-124584178 GGAGAGACCCTGATTTTGTTGGG - Intergenic
1104280566 12:127372787-127372809 GAAGAGAACCTGACATCTCATGG - Intergenic
1104363282 12:128153725-128153747 GGAGAAACCCTAACGTTTGTGGG - Intergenic
1105418634 13:20233406-20233428 GGAGAGACACAGAAATCTCTAGG + Intergenic
1108422702 13:50266928-50266950 GAAGAGACCCAGAGATTCCTGGG - Intronic
1108530044 13:51320259-51320281 GGAGGGACCCAGGCATTTTTAGG + Intergenic
1109699080 13:66002142-66002164 GGAGATACCCCAACATGTCTAGG + Intergenic
1110530372 13:76590467-76590489 GGAAATACCCAGACATTTCAAGG - Intergenic
1112175358 13:97017960-97017982 CTAGAGGACCTGACATTTCTAGG - Intergenic
1113037278 13:106063871-106063893 GGAGAGGCCCTGACATCACAGGG - Intergenic
1117799319 14:59427125-59427147 GGAGAGACCCTGACAGACCAGGG - Intergenic
1118555797 14:67019733-67019755 GGAGAGCCCCTGACATCGCAGGG + Intronic
1119612137 14:76072414-76072436 GGTGTGACCCAGACATTTCAGGG - Intronic
1119990762 14:79194638-79194660 GGAGAGACACTGAGACCTCTTGG - Intronic
1120930546 14:89843978-89844000 GGAGTGAGCCTGTCATTTCAAGG - Intronic
1122057651 14:99115622-99115644 GGAGAGACAGTGACTTTTCCAGG - Intergenic
1127367813 15:58308158-58308180 GGAAAAAACCTGACAATTCTGGG + Intronic
1127834613 15:62780772-62780794 GGAGCCAGCCTGACACTTCTAGG - Intronic
1129220432 15:74128943-74128965 GGTGAGTCCCTGAGGTTTCTAGG - Exonic
1129662866 15:77562815-77562837 GGAGAGAGCCCTAAATTTCTGGG + Intergenic
1130320762 15:82838708-82838730 GGAGAGTCCTTTACAGTTCTGGG - Intronic
1130385125 15:83404367-83404389 GGTGAGGCCCTGACACTTGTTGG - Intergenic
1131383638 15:91984865-91984887 TGAGAGGCCCTGCCATTTTTTGG + Intronic
1134447253 16:14340176-14340198 GAACAGAGCCTGAGATTTCTAGG + Intergenic
1136099655 16:27984444-27984466 GCAGTGATCCTGACATTTCTGGG - Intronic
1136417717 16:30113758-30113780 GGAGAGGTCCTGACAGTCCTGGG - Exonic
1139357734 16:66377328-66377350 GGAGAGGCCCTGACCCCTCTGGG - Intronic
1139977593 16:70827139-70827161 TGAGAGACCCTGTGATGTCTTGG + Intronic
1140258595 16:73357941-73357963 GGAGAGATCCAGACGTTGCTGGG - Intergenic
1140366703 16:74387139-74387161 GGAAATACCCTGGCCTTTCTAGG - Intronic
1140640643 16:76968020-76968042 GGCGAGACTCTTAAATTTCTTGG - Intergenic
1140811531 16:78583571-78583593 TGGGGGACCCTGACATTTCAAGG - Intronic
1142124010 16:88401267-88401289 AGAGAGGCCCTGACATTGTTAGG - Intergenic
1143337887 17:6187152-6187174 GTAGAGAGCCTGATGTTTCTTGG - Intergenic
1144270852 17:13614111-13614133 GGAGAGACCCTGAGATTACCCGG + Intergenic
1145882629 17:28363598-28363620 GGAGACAACCTGACAGATCTGGG - Exonic
1146792350 17:35759295-35759317 GCAGAGGCCCTGACTTTTCAAGG + Intronic
1146957641 17:36946144-36946166 GAACAGGCCCTGACATTTCCAGG - Intergenic
1149233148 17:54559526-54559548 AGATAGAGCATGACATTTCTCGG - Intergenic
1150932211 17:69597099-69597121 GGATTGCCACTGACATTTCTGGG + Intergenic
1152964687 18:104176-104198 GGAGAGACTCTCACACATCTGGG - Intergenic
1158044071 18:53133951-53133973 GGAGAGACCATGAATTTTATTGG + Intronic
1158834786 18:61319570-61319592 GTAGAGAGCATGACATTTTTAGG + Intergenic
1162796542 19:13090254-13090276 GGAGAGACCCTGTCAGGCCTTGG - Intronic
1164444944 19:28308966-28308988 GGAGAGAGCCTGGCCTTTCTTGG - Intergenic
1164465282 19:28482468-28482490 GGAGAGCCCCTGTCTTTGCTGGG + Intergenic
1167658137 19:50779748-50779770 GGGGAGAAACTGACATTTCAGGG + Intergenic
1168176013 19:54628542-54628564 AGAGAGACACTGACGTTTCCTGG + Intronic
925598716 2:5586599-5586621 GGATATACCCTGACATCGCTGGG + Intergenic
926699686 2:15795514-15795536 GGAGAAACCCTGACATTGAGCGG + Intergenic
927191118 2:20517529-20517551 GGAGAGACCCAAATGTTTCTGGG - Intergenic
927604990 2:24478952-24478974 AGAGAGAAACTGACAGTTCTGGG - Intergenic
927840871 2:26442700-26442722 GGAGAGGCCCTGTCATTTCCAGG + Intronic
927880546 2:26687261-26687283 GGACAGACCCAGCCATTACTGGG - Intergenic
929389622 2:41454873-41454895 TGGGAGACAGTGACATTTCTAGG - Intergenic
930816824 2:55607191-55607213 GGAGAAATCCTCACACTTCTTGG - Intronic
931148474 2:59545946-59545968 GGAGAGACCCTAAAATTACATGG + Intergenic
933490413 2:82978846-82978868 GGAGAGCAGCTGGCATTTCTGGG + Intergenic
933702047 2:85262684-85262706 GGAGAGACCCTGTGAGTTCCTGG - Intronic
935264650 2:101384021-101384043 GGAGGGACAATGACATTTATGGG + Intronic
936463176 2:112726289-112726311 AGTGAGACCCTGGCCTTTCTGGG + Exonic
937786195 2:125901898-125901920 TGAGAGACCCAGATTTTTCTAGG - Intergenic
938665704 2:133533811-133533833 GGAGAGACTTTCAAATTTCTGGG - Intronic
942738242 2:179140965-179140987 TGAGAAACTCTGACATTTCATGG - Intronic
943992921 2:194720592-194720614 AGTGAGTGCCTGACATTTCTGGG - Intergenic
944795978 2:203185716-203185738 GGAGATATCCTGACATTACATGG - Intronic
946066898 2:216995741-216995763 AGAGAGACCCTGCCCTTTCGAGG - Intergenic
946281876 2:218671792-218671814 GCAGAGATGCTGACATCTCTGGG - Intronic
948828998 2:240588383-240588405 TGAGGAACCCTAACATTTCTTGG + Intronic
1171492629 20:25532119-25532141 GGAAAGACCCTGCCATGGCTGGG + Intronic
1173803727 20:45911071-45911093 CCCGAGACCCTGAGATTTCTCGG + Intronic
1174681885 20:52416422-52416444 GTTGAGACCCTACCATTTCTCGG - Intergenic
1175577106 20:60068387-60068409 GGAGAGAATTTGACATGTCTTGG + Intronic
1175894542 20:62330288-62330310 GGCGAGACCCAGGCTTTTCTGGG + Intronic
1179570377 21:42275076-42275098 GGAGAGACCCTGACTTGGGTTGG + Intronic
1182243032 22:28932391-28932413 GGAGAGAACCTGACTTTTCCTGG + Intronic
1182675030 22:32032433-32032455 GGGGAGCCCCTGACAATTTTGGG - Intergenic
1184080075 22:42213132-42213154 GGAAAGCCACTGACATTTCGTGG + Exonic
1184942826 22:47781492-47781514 GGAGAGACCTGGACATTAGTGGG + Intergenic
1184954278 22:47873318-47873340 GGAGGGAACCTGAGATTTCAGGG - Intergenic
1185033254 22:48456948-48456970 GGGTAGACCCAGACAGTTCTAGG - Intergenic
1185117888 22:48948469-48948491 AGAGAGAACCTTACATGTCTTGG + Intergenic
951892298 3:27578707-27578729 GCATAGACCCTGACAGTTCTTGG - Intergenic
953472197 3:43177084-43177106 TGTGACACCCTAACATTTCTTGG + Intergenic
956508062 3:69963836-69963858 GGAGATAGCCTAACATTTCAAGG - Intronic
956596259 3:70970927-70970949 GGAGAAAGCCTGACTTTTCTTGG - Intronic
957442101 3:80262381-80262403 CGGGAGACCCTTACTTTTCTGGG + Intergenic
961010945 3:123435483-123435505 GGAGAGGCTGTGACATCTCTTGG - Intronic
961494031 3:127277655-127277677 AGACAGACCCTGATATTACTTGG + Intergenic
962171121 3:133102331-133102353 GGAGAGACCACGACATATTTAGG - Intronic
964871467 3:161318038-161318060 GGAAAGACCCTGAAATTCCAGGG + Intergenic
966868476 3:184275736-184275758 GGAGAGAGCCTGAAATTTGGGGG + Intronic
968942010 4:3643785-3643807 GGAGAGACTCTGACATTTCTGGG + Intergenic
969514248 4:7637777-7637799 GGGGTGAACCTGCCATTTCTGGG + Intronic
970743685 4:19268432-19268454 GGAGAGACCCTGAAGATTTTGGG + Intergenic
970932102 4:21524104-21524126 GGAGAGACATAGACATATCTGGG + Intronic
971233184 4:24817380-24817402 AGAGAGACCCTGACTTTAATTGG - Intronic
971914540 4:32850969-32850991 GGAGAGACTCTGACACTTGCTGG - Intergenic
972099346 4:35392959-35392981 GCACACACCCTAACATTTCTAGG - Intergenic
977288877 4:95142107-95142129 TAAGATACCCTGAGATTTCTTGG + Intronic
980990200 4:139733022-139733044 GGGAAGACCCTGAAATATCTAGG - Intronic
983187293 4:164714774-164714796 GGAGAGAGACTGTAATTTCTAGG + Intergenic
983434481 4:167694769-167694791 GTAGAGACACTGTGATTTCTGGG + Intergenic
985464842 4:190184160-190184182 GGAGAGACTCTCACACATCTGGG + Intronic
986677821 5:10202333-10202355 GGAGAGCACCTGGCATTTCTGGG + Intergenic
988338432 5:29936902-29936924 AGACAAACACTGACATTTCTGGG + Intergenic
990393632 5:55354619-55354641 GGTGAGGCAGTGACATTTCTGGG + Intronic
993097443 5:83496035-83496057 GCAGAGGCCCTGAAATTTCTGGG - Intronic
994773830 5:104018625-104018647 TGAGAGACTGTTACATTTCTTGG + Intergenic
994787053 5:104179132-104179154 GGAGAGCACCTGGCATTTCTAGG + Intergenic
995072657 5:107942294-107942316 GGAGAGACCATGACATTTCAAGG + Intronic
998248337 5:140530530-140530552 GAAGAGACCCAGTCATTTATAGG + Intronic
1001434328 5:171687449-171687471 GGAAAGACCTTGACGTTTCAGGG - Intergenic
1006205681 6:32340375-32340397 GGGTAGATCCTGTCATTTCTGGG - Intronic
1007914574 6:45549207-45549229 GAAGGGACCCTGACTTTTCGGGG - Exonic
1010355221 6:74924700-74924722 GGATAGACCCTGGCATATCCTGG + Intergenic
1010558864 6:77322994-77323016 GGAAAAATCCTGATATTTCTTGG + Intergenic
1010956442 6:82095760-82095782 GGAGAAACCCTGAGCTTTCAAGG - Intergenic
1013707623 6:112857239-112857261 GGACAGAACCTGACAGTGCTTGG + Intergenic
1014440537 6:121468815-121468837 TGACAGAGCCTGACATTTCCAGG - Intergenic
1014774768 6:125495568-125495590 GGAGAGACCAAGGAATTTCTTGG - Intergenic
1015795698 6:137008768-137008790 GGTTAGAGCCAGACATTTCTGGG + Intronic
1020545148 7:9518787-9518809 GCAGAGACTCTGACTTTTCTAGG - Intergenic
1027638893 7:80709393-80709415 GCAGTGACCCTGTCTTTTCTGGG + Intergenic
1030983339 7:116211095-116211117 GGCGAGACCGTGACACTTCCTGG + Intronic
1031124732 7:117760393-117760415 GGAGAGAAAGTGAAATTTCTGGG - Intronic
1032463221 7:132126957-132126979 GGAGAGACCCTGACATTTCTTGG - Exonic
1033492264 7:141855028-141855050 GCAGAGACTCTGAGATTTCTTGG + Intergenic
1034312090 7:150097716-150097738 GAAGCGACACTGACATTTCCAGG + Intergenic
1034794767 7:154002942-154002964 GAAGCGACACTGACATTTCCAGG - Intronic
1034903977 7:154927941-154927963 AGAGAAACCCAGACATTTCTGGG + Intergenic
1035272742 7:157730114-157730136 GGACAGAGCCTGGCAATTCTGGG + Intronic
1036583053 8:10095046-10095068 GGATAAAGCATGACATTTCTGGG + Intronic
1036620869 8:10423967-10423989 GGAGAGACACAGACAGTCCTGGG + Intronic
1037458161 8:19083873-19083895 GGAGGTACCCAGACATTTATTGG - Intronic
1037802392 8:22042827-22042849 GGAGAGACCTTGGCTTCTCTGGG + Exonic
1038220183 8:25599819-25599841 TGAGAAACGCTGGCATTTCTCGG - Intergenic
1039726878 8:40227788-40227810 GGAGAGATCCTGAGACTTCAGGG - Intergenic
1041016896 8:53600129-53600151 GGACAGAAGCTGACATTTCCTGG - Intergenic
1041979572 8:63841631-63841653 GGAGAGAGAATGACTTTTCTGGG - Intergenic
1043090552 8:75896680-75896702 GGAGAGACCCTGACACCACATGG - Intergenic
1043813011 8:84766161-84766183 TGAGATACCCTGACATGTTTAGG - Intronic
1045695491 8:104804950-104804972 GGAGAGTCCTTGACCTTTTTTGG + Intronic
1045880097 8:107028712-107028734 GGAGACACCAGGAGATTTCTTGG + Intergenic
1047655862 8:126976248-126976270 GAAGAGACCTGGACAATTCTTGG - Intergenic
1051550949 9:18328847-18328869 GGGGACATCCTGTCATTTCTGGG - Intergenic
1053346905 9:37384808-37384830 GGAGAGAGCCTGACCTGTCTTGG - Intergenic
1053604405 9:39642132-39642154 GAAGAGACACTGGCATTTCGAGG + Intergenic
1054249136 9:62700282-62700304 GAAGAGACACTGGCATTTCAAGG - Intergenic
1054563249 9:66734815-66734837 GAAGAGACACTGGCATTTCGAGG - Intergenic
1055219945 9:73917310-73917332 AGAAAGACCTTGATATTTCTTGG - Intergenic
1057481922 9:95451423-95451445 AGAGGAACCCTGATATTTCTGGG + Intronic
1059301476 9:113317140-113317162 GGTGAGACCCCGACACTTCTTGG - Intronic
1059590540 9:115655280-115655302 GGAGAGAGTCTGTCTTTTCTAGG + Intergenic
1060759718 9:126237000-126237022 GGAGAGGCCCTGAGATCTCAAGG + Intergenic
1061079372 9:128360976-128360998 GGAGAGGACCTGACATCTGTAGG + Exonic
1062134591 9:134918291-134918313 GGACAAACCCTGAATTTTCTGGG - Intergenic
1187272041 X:17788297-17788319 GCAGTGACCTCGACATTTCTGGG - Intergenic
1187319310 X:18226185-18226207 GCAGAGGCCTTGACGTTTCTGGG + Intergenic
1187532840 X:20112261-20112283 GGACAGACCCTGTCATTCCAAGG + Intronic
1188236417 X:27737340-27737362 GGAGAGAGCATGACATATTTTGG - Intronic
1189870016 X:45371592-45371614 GGTGAGACTCTGAGACTTCTTGG + Intergenic
1190187016 X:48244083-48244105 GGAGAGACCATGTTATCTCTGGG - Intronic
1190908435 X:54750545-54750567 GGAGAGACACAGTCATATCTGGG - Intronic
1193901783 X:87188643-87188665 GAAGAGATCTTGAGATTTCTAGG + Intergenic
1194604796 X:95965227-95965249 GTAGAGTCCTTAACATTTCTGGG + Intergenic
1195466459 X:105184013-105184035 GGAGAGACCCTGAATCTTCCTGG - Intronic
1199922707 X:152426105-152426127 GGAGAGAATCTGACCTTTCTTGG - Intronic