ID: 1032465892

View in Genome Browser
Species Human (GRCh38)
Location 7:132144778-132144800
Sequence CACCCAGGAGGTACTTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032465887_1032465892 -1 Left 1032465887 7:132144756-132144778 CCGTGTCTAGCATAATCACAGGC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1032465892 7:132144778-132144800 CACCCAGGAGGTACTTGGATGGG 0: 1
1: 0
2: 0
3: 10
4: 114
1032465883_1032465892 15 Left 1032465883 7:132144740-132144762 CCATGTCTGATTAGCCCCGTGTC 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1032465892 7:132144778-132144800 CACCCAGGAGGTACTTGGATGGG 0: 1
1: 0
2: 0
3: 10
4: 114
1032465885_1032465892 0 Left 1032465885 7:132144755-132144777 CCCGTGTCTAGCATAATCACAGG 0: 1
1: 0
2: 1
3: 10
4: 169
Right 1032465892 7:132144778-132144800 CACCCAGGAGGTACTTGGATGGG 0: 1
1: 0
2: 0
3: 10
4: 114
1032465884_1032465892 1 Left 1032465884 7:132144754-132144776 CCCCGTGTCTAGCATAATCACAG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1032465892 7:132144778-132144800 CACCCAGGAGGTACTTGGATGGG 0: 1
1: 0
2: 0
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032465892 Original CRISPR CACCCAGGAGGTACTTGGAT GGG Intronic
900959699 1:5910949-5910971 TGCCCAGGAGGTAGTTGGACTGG - Intronic
901860051 1:12068510-12068532 CACCCAGGGGATACTGGGGTGGG + Intronic
904772640 1:32888871-32888893 GACCCAGGTGGGACTTGGCTCGG + Exonic
908645932 1:66277806-66277828 TAACCAGGAGGTACATGGAAGGG - Intronic
912827933 1:112923537-112923559 CACCCAGGATGGTCTTGGACTGG - Intronic
914456785 1:147843869-147843891 GACCCAGGAGGAAGTTGGAAGGG + Intergenic
924156273 1:241179854-241179876 CACACATGAGGCACTTTGATAGG + Intronic
1062946611 10:1466425-1466447 CATCCTGGAGATACTTGGATGGG - Intronic
1063067257 10:2622900-2622922 AACCCAGGAGTTACCAGGATTGG - Intergenic
1063408569 10:5818921-5818943 CACCCAGGTGGTAATTGCCTGGG + Intronic
1063888848 10:10608236-10608258 TACCCAGAAGATACTTGGTTTGG + Intergenic
1068770689 10:60817584-60817606 CACCCAGGAGGTCAGTGGATAGG - Intergenic
1071297497 10:84232793-84232815 CTCCCAGGAAGTTCTTGGCTTGG + Exonic
1076062919 10:127427615-127427637 GACCCTGGAGGTACATGGATAGG - Intronic
1078376819 11:10802337-10802359 CACCCAGGATGAAAATGGATAGG - Exonic
1079096751 11:17516004-17516026 CTGCCAGATGGTACTTGGATAGG + Intronic
1082665489 11:55971062-55971084 CCCCCAGGAGGTACCTGGCTGGG - Intergenic
1087239178 11:95756330-95756352 CACCTAGCAGGTCCTTGGCTGGG + Intergenic
1091671917 12:2457985-2458007 CACCCTGGAGGCCCTGGGATGGG + Intronic
1091793335 12:3283813-3283835 CACCCAGGAGGCTCTCGGATGGG + Exonic
1092398869 12:8154175-8154197 CACCCAGGAAGCACAGGGATCGG - Intronic
1096525245 12:52206616-52206638 CACAGAGAAGATACTTGGATGGG - Intergenic
1102228415 12:111245763-111245785 CAAACAGGAGGCACTTGGGTGGG - Intronic
1104770088 12:131356129-131356151 CACCCAGGAGTGACTTGGTCTGG - Intergenic
1113545009 13:111141720-111141742 CAACCAGGATGTACTTCAATAGG - Intronic
1114891082 14:26924377-26924399 CACCCATGAGGTCCATGGGTAGG + Intergenic
1118044085 14:61947828-61947850 CTGCCAGGTGGGACTTGGATAGG + Intergenic
1119206750 14:72800128-72800150 CAGCCTAGAGGTATTTGGATGGG - Intronic
1119925730 14:78491466-78491488 CTCCCAGGAGCTTGTTGGATTGG + Intronic
1128602785 15:69011699-69011721 CACTAAGGAGGAAGTTGGATTGG - Intronic
1131229671 15:90650791-90650813 CACCCAGGAGGGAGTTGCTTTGG - Intergenic
1132468716 16:89938-89960 CACCCAGGAGGAAGTTGGAGTGG - Intronic
1133117767 16:3587912-3587934 CTCCCCGGAGGTGCCTGGATGGG + Intronic
1133323620 16:4930333-4930355 CACGCAGGAGGTGACTGGATGGG + Intronic
1136187241 16:28595662-28595684 CACCCAGGTGGTGCCTGGAGAGG + Exonic
1136317262 16:29461629-29461651 CACCCAGGTGGTGCCTGGAGAGG - Exonic
1136431837 16:30200972-30200994 CACCCAGGTGGTGCCTGGAGAGG - Exonic
1137764460 16:50967362-50967384 CACCCAGTAGGTCTGTGGATGGG + Intergenic
1139449348 16:67017344-67017366 CACCCAGCAGCTACTTGGTGAGG - Intergenic
1142108624 16:88319382-88319404 CACACAGGAGGTGCAAGGATTGG + Intergenic
1147254583 17:39174386-39174408 CACCCAGGTGGCACAGGGATGGG + Exonic
1151734602 17:75931276-75931298 CACCCAGGAGGGACCTGCAAAGG + Exonic
1152134089 17:78493914-78493936 CTCCCAGGATGTACTGGGTTGGG + Intronic
1157584439 18:48792159-48792181 CACCCAGGTGACCCTTGGATAGG + Intronic
1160969778 19:1762434-1762456 CCCCCAGCAGGTCCTTGGACGGG - Intronic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1163604086 19:18264776-18264798 CACCCAGGACCTCCTTGGACAGG + Exonic
1165744885 19:38224657-38224679 GAGCCAGGAGGGACTTGGGTGGG - Intronic
1166865182 19:45831638-45831660 CACACAGGAGGTCCTCGGGTTGG - Intronic
1167068525 19:47205413-47205435 CACCGAGGAGATATTTGGAGGGG + Intronic
1167971481 19:53190243-53190265 AACTCAGGAGGTACTGGGAATGG - Intronic
925030819 2:648881-648903 CAGCCAGCAGGTATTTGCATGGG + Intergenic
925728288 2:6895813-6895835 CATCCAGGATGGACTTGGAAGGG - Exonic
927889843 2:26741458-26741480 CCCCAGGGAGGGACTTGGATAGG + Intergenic
929911395 2:46092492-46092514 TACTCAGGAGGTACTTAGAAAGG + Intronic
931736680 2:65200294-65200316 CATCAAGGAGGTACTTCTATAGG + Intergenic
935844744 2:107153526-107153548 TAGCCAGGAGGTACATGGAGAGG - Intergenic
936447133 2:112605209-112605231 CACCCAGTAGGAACTTGGCCTGG + Intergenic
939053436 2:137333214-137333236 CTCCCAGGAGGTAGATGTATCGG - Intronic
945535607 2:211014099-211014121 CACAGAGGAGATACCTGGATAGG + Intergenic
945968945 2:216217732-216217754 AACCCAGGACCTACTTGGAAAGG + Intergenic
946630429 2:221661717-221661739 CACCTAGGAGGTACTTATGTGGG - Intergenic
947855258 2:233319632-233319654 CACCCAGGAGGAAGGTGGAGAGG - Intronic
1170132393 20:13034891-13034913 CACCCAGGAGGTAATTGCAGTGG + Intronic
1172670889 20:36633771-36633793 GACTCAGGAGGTACCTGGACAGG - Intronic
1176515081 21:7777794-7777816 CTCCCAGGAGATGCCTGGATGGG - Intergenic
1178649109 21:34407806-34407828 CTCCCAGGAGATGCCTGGATGGG - Intronic
1178761331 21:35405471-35405493 CACCCAGGGGAGACTTGGAAGGG + Intronic
1180391774 22:12290477-12290499 CACACAGGCGGCACTGGGATTGG + Intergenic
1180407970 22:12574279-12574301 CACACAGGCGGCACTGGGATTGG - Intergenic
1180597443 22:16988005-16988027 CACCCCGGAGGTGCAGGGATGGG + Exonic
1183743351 22:39680091-39680113 CACACAGTAGGTGCTTGGGTAGG + Intronic
1184938222 22:47740411-47740433 CAGCCAGGAGGCACTGGGCTGGG - Intergenic
1185398837 22:50605715-50605737 CACCCAGCAGGTCCTTGGCAGGG - Exonic
950535513 3:13575992-13576014 CACCCAGGAGGTGCTCGGCAAGG + Intronic
952761540 3:36919233-36919255 CACCCAGGTGGGAGTTAGATGGG - Intronic
953969614 3:47336888-47336910 CTCCCAGGAGGTACTGGCAGTGG - Intronic
954442134 3:50527680-50527702 GACTCAGGAGGTGCTTGGAGTGG + Intergenic
954515830 3:51175600-51175622 CTCCCAGCAGGTCCCTGGATGGG + Intronic
957305296 3:78450127-78450149 CTCCCAGGAGATATTTGGAAAGG - Intergenic
959212593 3:103406733-103406755 GACCAAGGAGGAACTTTGATTGG + Intergenic
964627297 3:158771895-158771917 CTCCCTGGAGGCACTGGGATAGG + Intronic
968035409 3:195543891-195543913 GGCCCAGGAGGTCCTTGGCTGGG - Intergenic
977683151 4:99817031-99817053 CACCCACTAGGTACTTTGAAAGG - Intronic
979100232 4:116603753-116603775 CACCAAGGAGGCTCTTGGGTTGG - Intergenic
985433162 4:189900990-189901012 CACACAGGTGGCACTGGGATTGG - Intergenic
985662800 5:1165709-1165731 CACCCAGGAGCTCCTTGCAAAGG - Intergenic
993857843 5:93097766-93097788 CTCCCAGGAGGTAGTGGGGTGGG + Intergenic
996078429 5:119226572-119226594 CACCCAGCCAGTACTTGGAGAGG - Intronic
999171361 5:149597946-149597968 CCTCCAGCAGGTACTTGGGTGGG + Exonic
999286569 5:150397827-150397849 CATCCAGGTGGTCCATGGATGGG + Intronic
1006438110 6:34036999-34037021 CACCCAGGAGCTTGTTGGAAAGG + Intronic
1007333274 6:41131435-41131457 GACCCAGGAGGTACATGGTTAGG - Intergenic
1007382266 6:41498170-41498192 CAGACAGGAGGTCCTGGGATGGG - Intergenic
1010565195 6:77402220-77402242 CCCCCAGGAGGACCTTGGAATGG - Intergenic
1012830607 6:104199895-104199917 CACCTAGCAGGTACTGGGAAAGG + Intergenic
1014694218 6:124598621-124598643 CACCGAGGAGGGCCCTGGATAGG + Intronic
1016130589 6:140463504-140463526 CACCCTGGAGGTACTAGAGTGGG - Intergenic
1017053808 6:150419601-150419623 CCCCTAGGAGGTAATTGAATTGG + Intergenic
1023344081 7:39253191-39253213 CTCCCAGGAGCTACATGGAAGGG + Intronic
1024716139 7:52081535-52081557 CACCAGGGAGGCACATGGATGGG + Intergenic
1024945322 7:54802297-54802319 CAGCCAGGAGCTGCTTGGGTCGG - Intergenic
1025794763 7:64729334-64729356 CAGCCAGGATTTCCTTGGATAGG + Intergenic
1029697374 7:102222768-102222790 CAGCCAGGAGCTAGGTGGATGGG - Intronic
1030876978 7:114825816-114825838 CAGCCTGGAAGTACATGGATTGG + Intergenic
1032465892 7:132144778-132144800 CACCCAGGAGGTACTTGGATGGG + Intronic
1035675219 8:1451341-1451363 CAACCTGGAGGCACTTGGACAGG - Intergenic
1037699755 8:21263674-21263696 CACCCAGGAGTTACTCTGATGGG - Intergenic
1037752251 8:21690508-21690530 CAGCCATGTGATACTTGGATAGG + Exonic
1045253502 8:100500405-100500427 CACCCAGGAGCCACTCGGAAAGG + Intergenic
1048818256 8:138354480-138354502 CACCCAGGAGGTATCAGGATGGG - Intronic
1049446387 8:142633404-142633426 CTCCCAGGAGCTACCTGGACAGG + Intergenic
1050183085 9:2941628-2941650 CATCCAGGAGGCAATTGGCTAGG + Intergenic
1051200476 9:14615249-14615271 CACCCACTAGTTACTTGTATGGG + Exonic
1057197241 9:93121888-93121910 CACACAGCAGGTCCGTGGATGGG - Exonic
1061397193 9:130349565-130349587 CGCTCAGGAGGTGCTAGGATTGG + Intronic
1062357508 9:136171804-136171826 CACCCAGGAGCCCCTTGGACTGG + Intergenic
1062377332 9:136268036-136268058 CACCCACCAGGTACGTGGAGAGG - Intergenic
1203452871 Un_GL000219v1:136935-136957 CACACAGGTGGCACTGGGATTGG + Intergenic
1187496535 X:19800807-19800829 CAGCCAGGATGAACTGGGATTGG + Intronic
1188483145 X:30653998-30654020 GACACAGGACGTCCTTGGATGGG + Intronic
1193470029 X:81889471-81889493 CATCCATGAGCTACTTTGATAGG + Intergenic
1196795966 X:119502123-119502145 TGTCCAGGAGGCACTTGGATGGG + Intergenic
1198804609 X:140481499-140481521 CACACAGGGCTTACTTGGATTGG - Intergenic
1199658360 X:150021481-150021503 CAACCAGCAGGTACTGAGATAGG + Intergenic