ID: 1032465983

View in Genome Browser
Species Human (GRCh38)
Location 7:132145357-132145379
Sequence CTCCCCTGCCTAGGTCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032465983_1032465988 4 Left 1032465983 7:132145357-132145379 CCTCACAGACCTAGGCAGGGGAG 0: 1
1: 1
2: 2
3: 14
4: 213
Right 1032465988 7:132145384-132145406 GTATACAGCCCACCCTACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1032465983_1032465992 14 Left 1032465983 7:132145357-132145379 CCTCACAGACCTAGGCAGGGGAG 0: 1
1: 1
2: 2
3: 14
4: 213
Right 1032465992 7:132145394-132145416 CACCCTACTTGGGTAAAATTGGG 0: 1
1: 0
2: 0
3: 4
4: 93
1032465983_1032465987 3 Left 1032465983 7:132145357-132145379 CCTCACAGACCTAGGCAGGGGAG 0: 1
1: 1
2: 2
3: 14
4: 213
Right 1032465987 7:132145383-132145405 GGTATACAGCCCACCCTACTTGG 0: 1
1: 0
2: 0
3: 5
4: 33
1032465983_1032465991 13 Left 1032465983 7:132145357-132145379 CCTCACAGACCTAGGCAGGGGAG 0: 1
1: 1
2: 2
3: 14
4: 213
Right 1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032465983 Original CRISPR CTCCCCTGCCTAGGTCTGTG AGG (reversed) Intronic
900505398 1:3027794-3027816 ATCCTCTGCCAAGGTCTGTTGGG - Intergenic
900649670 1:3724548-3724570 CTCACCTGCCTAGGCCTGCCAGG + Intronic
901195877 1:7439501-7439523 TTCACCTGCCTGAGTCTGTGTGG + Intronic
902518881 1:17004788-17004810 ATCCTCTGCCTGGGACTGTGGGG + Exonic
903455390 1:23483872-23483894 GCCCCCTCCCTAGGTCTGGGAGG - Intronic
903681909 1:25103049-25103071 CCCCCCTCACTAGGTCTGAGGGG - Intergenic
904713364 1:32448180-32448202 TTCTCCTTCCTTGGTCTGTGTGG + Intergenic
905279479 1:36839916-36839938 CCCCCTTGCCTCGGTCTGAGGGG - Intronic
905288630 1:36905930-36905952 CCCACCTGCCAAGGTCTGAGAGG - Intronic
907623103 1:56001849-56001871 CTTTCATGCCTAGGGCTGTGGGG - Intergenic
915247977 1:154569449-154569471 TTCCCCTGCCCAGGGGTGTGGGG + Exonic
919785510 1:201255551-201255573 CTCCCCTGCCAAGGGCTGCAGGG - Intergenic
920179431 1:204123293-204123315 CTTCCCTCCCTTGGTCTGTTGGG + Intronic
921989669 1:221350840-221350862 CTGCCCTCCCTAGGGCTTTGTGG + Intergenic
922706420 1:227793089-227793111 CTCCCCAGGCTAGGTTTCTGTGG - Intergenic
923162606 1:231329544-231329566 CTCTCATCCCTTGGTCTGTGGGG - Intergenic
1063378131 10:5566304-5566326 CTCCCCTGCCAAGATGTGGGTGG - Intergenic
1067146473 10:43697651-43697673 ATCCCCTCCCCAGGGCTGTGAGG - Intergenic
1067569393 10:47360430-47360452 CTCTCCTGTGTAGGCCTGTGCGG - Intergenic
1069777458 10:70935261-70935283 CTGGCCTGCCCAGGTCAGTGGGG - Intergenic
1070586585 10:77771437-77771459 CTCCACTGGCTAGGTCCATGGGG - Intergenic
1071088970 10:81897278-81897300 TTCCCCTACCTAGGTCCCTGTGG - Intronic
1072607912 10:96999419-96999441 GTCCCCTGCCCAGGGCAGTGAGG - Exonic
1073044419 10:100628469-100628491 CTGACCTGCCCAGGTGTGTGGGG - Intergenic
1073475755 10:103752017-103752039 CTCCCCTCTCTAGGTTTGGGAGG - Intronic
1073730365 10:106280561-106280583 CTCCCCTGCCTAAGTCTGAATGG - Intergenic
1074948114 10:118300799-118300821 CTCCCCTCCCTGGGTCTTTAGGG - Exonic
1075095591 10:119468780-119468802 CTCCCCTGCGAGGGTGTGTGGGG - Intergenic
1075721732 10:124591377-124591399 CTCCCCTGCCATGGACAGTGTGG + Intronic
1077065984 11:641097-641119 CTCCCCTGCCGGGGTCTGCTGGG - Intergenic
1078771263 11:14354497-14354519 CTCCCCTCCTTACTTCTGTGTGG - Intronic
1078845916 11:15118208-15118230 CCTCCTTGCCTGGGTCTGTGAGG + Intronic
1081653557 11:44841666-44841688 CTCCTCTTCCTAGCTCTGCGTGG - Intronic
1083235512 11:61348384-61348406 GGCCCCTCCCTAGGTCTGTGAGG + Exonic
1084627995 11:70323571-70323593 CTCCCCTTTCCAGGTCAGTGAGG - Intronic
1085462350 11:76701840-76701862 CTCCCCTGCCTCTGCCTTTGTGG + Intergenic
1089255191 11:117190396-117190418 CTCCCCTCCCCAGTTCTGTCTGG + Intronic
1089414663 11:118277556-118277578 CTTTCCTGCCTAGCTCAGTGAGG + Intergenic
1089763722 11:120748114-120748136 CTCCCCAGCCAAGGTCTTGGTGG - Intronic
1090808502 11:130217670-130217692 CTCCTCTGCCTGGGGCAGTGTGG + Intergenic
1091783082 12:3226057-3226079 CTCTCCTGCCGAAGTCTGTAGGG + Intronic
1092142482 12:6193513-6193535 GTCCTCTGCATATGTCTGTGTGG - Intergenic
1092915989 12:13189413-13189435 CTGCCCTGCAGAGCTCTGTGTGG + Intergenic
1096181007 12:49550317-49550339 CTCGCCATCCTAGGTTTGTGAGG + Exonic
1098081140 12:66786722-66786744 CTCCCCTTCCTAGTCATGTGAGG - Intronic
1103851409 12:123936041-123936063 CCAGCCTGCCTGGGTCTGTGTGG + Exonic
1104583720 12:130030418-130030440 CTGCCTTGCCTGGTTCTGTGGGG - Intergenic
1106410494 13:29508005-29508027 AGACCCTGCCCAGGTCTGTGTGG + Intergenic
1106758278 13:32843830-32843852 CTTCCCTGCCAACGTTTGTGTGG + Intergenic
1106925398 13:34607851-34607873 CTCCCTTGCATAGGCCTGAGAGG - Intergenic
1112062779 13:95757875-95757897 TTCTCCTGTCTAGGTCTTTGTGG - Intronic
1113799053 13:113077199-113077221 TGCCCCTCCCCAGGTCTGTGTGG + Exonic
1118729958 14:68659207-68659229 CTCCCCTGCCTGGGGACGTGAGG + Intronic
1120008679 14:79388679-79388701 CTCTCCTAGCTATGTCTGTGTGG + Intronic
1120180517 14:81338247-81338269 CTCCCCTTCCTAGGTTGGGGAGG - Intronic
1120710214 14:87785700-87785722 CTCCCTTCCCTAGGGCTGGGGGG - Intergenic
1121001078 14:90452522-90452544 CTCCCCTGCCCAGGCCTTCGGGG - Intergenic
1121483026 14:94292878-94292900 CTCCCCTTCCCAGGGCTGAGGGG - Intronic
1122204702 14:100142720-100142742 CTCCCCAGCCCAGGCCTTTGGGG - Intronic
1122671907 14:103379150-103379172 CTCCTGTGCTTAGGTCAGTGTGG - Intergenic
1124373369 15:29115787-29115809 CTCCCCCGCCGGGATCTGTGTGG - Intronic
1125437966 15:39668313-39668335 GTCCCCTCCCCAGGTCTGTCTGG + Intronic
1126559754 15:50030458-50030480 CTCCCCTGTCTTGGTGTCTGGGG - Intronic
1129712982 15:77830567-77830589 CTCCCCGGCCCAGGGCAGTGGGG + Intergenic
1129985833 15:79919270-79919292 CTCCCCAGCCTGGCTCTGTGTGG - Intronic
1130658030 15:85806265-85806287 ATCCCCTGCCAAGATCTGTAGGG + Intergenic
1131529475 15:93179574-93179596 CTGCCCTGCCTAGGACAGTAAGG - Intergenic
1132375281 15:101324635-101324657 TTCTCCTGGCCAGGTCTGTGGGG + Intronic
1132545010 16:528856-528878 TTCCTCTGCCCAGGTCTGAGGGG + Intronic
1132546639 16:536223-536245 CCCCCCTGCCGAGGTCTGGCCGG + Intronic
1133360124 16:5167668-5167690 CTCTGGTGCCTAGCTCTGTGTGG - Intergenic
1137558920 16:49490561-49490583 CTCCCCAGCCTAGGGCCGCGTGG - Exonic
1139485374 16:67253210-67253232 CTCCCCAGGCCAGGTCTGGGTGG + Intronic
1140468909 16:75204073-75204095 CTGCACTGCCTGTGTCTGTGTGG - Intergenic
1144037632 17:11381759-11381781 CTCCCCTGCCCATGCCTGTGGGG + Intronic
1144141990 17:12358666-12358688 CTGCGCTGCCAAGGCCTGTGTGG + Intergenic
1144201828 17:12948904-12948926 CACCCCTGCCTGAGGCTGTGGGG + Intronic
1144849137 17:18235300-18235322 CTCCAGTGCCTTGGTGTGTGCGG + Exonic
1145029764 17:19495582-19495604 CACCCCTGCCTAGGTCTCCCAGG + Intronic
1147456419 17:40541036-40541058 CTGGCCTGTCTAGGTCTCTGTGG - Intergenic
1148396431 17:47311546-47311568 GTACCCTGCCCAAGTCTGTGTGG - Intronic
1148764155 17:50027715-50027737 CTCCCCTGCTTCCGGCTGTGAGG + Intergenic
1148821643 17:50363503-50363525 CTCCCCTGTCCAGGTCACTGAGG + Intergenic
1149522210 17:57326002-57326024 CCCACCTGCCTAGTTCAGTGGGG + Intronic
1149553588 17:57557609-57557631 CACCCCAGCCCAGGGCTGTGGGG - Intronic
1151349787 17:73525017-73525039 CTCACCTTCCTAGGCCTGTGTGG + Intronic
1151656772 17:75499831-75499853 CTCCCCTCCCTCCCTCTGTGGGG + Exonic
1151860075 17:76754289-76754311 CCCACCTGCCCAGGTGTGTGAGG + Intronic
1152517459 17:80834159-80834181 CTTCCCTGCCTTGCTCTGAGTGG + Intronic
1152750427 17:82060079-82060101 CTCCCCTCCCTGGGCCTGAGGGG + Exonic
1153527254 18:6009044-6009066 CACCCCTCCCGAGGTCTGTGTGG - Intronic
1153692362 18:7606413-7606435 CTCCCCTTCCCAGACCTGTGCGG + Intronic
1154309447 18:13255732-13255754 CTCCCCAGGCCAGGGCTGTGGGG + Intronic
1155577451 18:27263672-27263694 ATCCCCTGGCTGGCTCTGTGTGG + Intergenic
1157019433 18:43761734-43761756 TTCCCCTCCCCAAGTCTGTGAGG - Intergenic
1160172634 18:76567630-76567652 CTCTCCTCCCTAGACCTGTGGGG - Intergenic
1161342845 19:3752461-3752483 CTCCCCTTCCTGGGAGTGTGGGG + Intronic
1161535968 19:4818609-4818631 GTCACCTGGCTAGGTCTGGGTGG - Intronic
1161591394 19:5130814-5130836 CTTGCCTGCCAAGGCCTGTGAGG - Intronic
1163152848 19:15425125-15425147 CCCCCATGGCTGGGTCTGTGTGG - Intronic
1163795594 19:19336026-19336048 CTACCCTGCCAAGGTCTGCAGGG - Intronic
1164419315 19:28074788-28074810 TTTCCCTACCTAGGTCAGTGAGG + Intergenic
1164845005 19:31424559-31424581 CTCCTCTGCCTATGTCTGCCAGG + Intergenic
1165410231 19:35655497-35655519 CACCCCTGCCTACTTCAGTGTGG + Intronic
1165890122 19:39106934-39106956 CTCCCCGCCCCAGGGCTGTGAGG + Exonic
1166116430 19:40658053-40658075 CTCCCGTGCCTAGGAGTTTGAGG - Intergenic
1167867051 19:52336921-52336943 CTCCCCTGCCTATGGATGTGTGG + Intronic
1168172117 19:54595973-54595995 CTCCCCTGGCAGGGCCTGTGCGG - Intronic
925178697 2:1802588-1802610 CTGCCCTGCCGAGGTCCCTGGGG + Intronic
925767319 2:7249131-7249153 GTCCCCTGCCTAGCCCTGAGTGG + Intergenic
926023639 2:9519390-9519412 CTCCCCTGCCATGGGCTGTCTGG + Intronic
927067222 2:19485323-19485345 CTGCTCTGCCTAGGTCAGGGTGG - Intergenic
927092841 2:19725561-19725583 CTCACCTGCCTTGGCCAGTGAGG + Intergenic
927199808 2:20571276-20571298 CTCCCCAGCCTAGGCCAGGGTGG - Intronic
929778493 2:44942942-44942964 CTCCCCTTCCCAGGCCTCTGAGG - Intronic
930025367 2:47026165-47026187 CTAGCCTGCCTGGGTCTCTGAGG + Intronic
933968689 2:87452271-87452293 CTCCCAGGCCTATGTCAGTGAGG - Intergenic
934120602 2:88834879-88834901 CTCCCATGCCAGGGCCTGTGTGG - Intergenic
935737371 2:106117054-106117076 CTCCTCTCCCCACGTCTGTGTGG + Intronic
937236834 2:120436318-120436340 CTCTCCTGCCCAGGACTGTTGGG + Intergenic
945041073 2:205744428-205744450 CTCCCTTGCCTCAGTCTGAGAGG - Intronic
946338178 2:219052147-219052169 CTGCACTGCCTGGGTCTGGGTGG + Intergenic
1174255054 20:49248360-49248382 CACCCCTGCATTGGTCTCTGTGG - Exonic
1174416405 20:50370004-50370026 CTTCCCAGCATGGGTCTGTGTGG + Intergenic
1175012974 20:55758521-55758543 CTCCCCATCCTGGGTCTTTGAGG + Intergenic
1175181894 20:57154265-57154287 CTCCACTCCCAAGGTGTGTGTGG - Intergenic
1175424653 20:58855687-58855709 CTCCCCTGGCTAGGCTGGTGGGG + Intronic
1175992933 20:62798370-62798392 CTGCCCTCCCTGGGTCTGTCTGG + Intronic
1176031062 20:63011996-63012018 CTGGCCAGCCTAAGTCTGTGGGG + Intergenic
1176133065 20:63505022-63505044 CTCCCCTGCAGATCTCTGTGGGG + Intergenic
1176361222 21:5998391-5998413 CTCCCCTGCTTAGGTAAGTCAGG + Intergenic
1178828485 21:36035206-36035228 CTCCCCACCCAAGGTCTGCGTGG + Exonic
1179030313 21:37714404-37714426 CTCCCCCTCCGAGGTCTGTTTGG + Exonic
1179762296 21:43540159-43540181 CTCCCCTGCTTAGGTAAGTCAGG - Intronic
1179990016 21:44943069-44943091 CTTCCCTGCCAAGGTCAGTGAGG + Intronic
1180753966 22:18147371-18147393 ATCCCCTGACTTGGTCTGTAGGG - Intergenic
1180904787 22:19401875-19401897 CTCCTCTGCCTAGATCCCTGCGG + Intronic
1180936605 22:19629626-19629648 CTCTCCAGCCAAGGGCTGTGAGG - Intergenic
1185379782 22:50503109-50503131 TTCCCCTGCCCTGGGCTGTGGGG - Exonic
951384071 3:22023978-22024000 ATCCCCTGGGTATGTCTGTGAGG + Intronic
952644364 3:35638738-35638760 CTACCCTGCCCAGGTTTCTGTGG + Intergenic
952842818 3:37662567-37662589 CTGCCTTGGGTAGGTCTGTGGGG + Intronic
956778693 3:72587593-72587615 CTCTCCTGCCTAGGTCTCCATGG + Intergenic
959580119 3:107974735-107974757 CTTCACTGCATAGCTCTGTGGGG + Intergenic
961051394 3:123750067-123750089 CTTTCAGGCCTAGGTCTGTGGGG + Intronic
961521928 3:127472077-127472099 CGCCCCTCCCCAGGTCAGTGAGG + Intergenic
963566213 3:146934454-146934476 CCCCCCAGCCTAGTGCTGTGAGG + Intergenic
966878950 3:184338921-184338943 CTCCCCCGCCTAGGCCTGGCTGG + Intronic
967281561 3:187828556-187828578 CTCCCTTGCCTTGTTCTTTGGGG - Intergenic
968730148 4:2265686-2265708 CTTCCCTCCCTGGGTGTGTGAGG - Intergenic
968946811 4:3669208-3669230 CTCCCCAGCCTTGGTCCCTGTGG - Intergenic
969477361 4:7429168-7429190 ACCCCCTGCCTAGGGCTTTGGGG + Intronic
970351087 4:15202423-15202445 CAGCCCTGCCAATGTCTGTGGGG - Intergenic
975703546 4:77089584-77089606 CTCCCCTCCCTAGCTCTGGCAGG - Intergenic
979355264 4:119696083-119696105 CTACACTGCCTAGGTCTGAGGGG + Intergenic
986234402 5:5893793-5893815 CTCCCCTGTTTAGGTCTTGGAGG - Intergenic
988393449 5:30665940-30665962 CTCCTCTGCCAAGGTCTATGGGG + Intergenic
990618280 5:57530626-57530648 CTCCTCTGCCCATGACTGTGGGG - Intergenic
991975903 5:72183531-72183553 CTCCCCAGGCTGGGTTTGTGTGG - Intronic
992222581 5:74587429-74587451 ATCCCATCCCCAGGTCTGTGGGG - Intergenic
992465429 5:76999560-76999582 ATCCCCTGCCTTAGGCTGTGGGG - Intergenic
992700215 5:79334340-79334362 CTCTCCTGCCTGGTTCTGGGAGG + Intergenic
995138899 5:108711261-108711283 CTCCACTGCCTAATTCTTTGTGG - Intergenic
997962990 5:138336900-138336922 CTCCCCTCCCTGGCTCAGTGAGG + Intronic
998462407 5:142319576-142319598 GTCCCTGGCCCAGGTCTGTGAGG + Intronic
998565836 5:143215073-143215095 CTCCGCCGCCTGGGCCTGTGTGG - Intronic
999282400 5:150374283-150374305 CTTCCCTGCCTTGGTCTGGGAGG - Exonic
1000350657 5:160349815-160349837 CCCCTCTGCCTAGGTCTGTGAGG - Intronic
1001470046 5:172005954-172005976 CTCCCCAGCCTAGGTCTGTGTGG - Intronic
1001657207 5:173360789-173360811 CTTCCCTGCATATGTCTGTGAGG + Intergenic
1003173373 6:3737412-3737434 CTCCACTGCCCAGGTCGCTGAGG - Intronic
1003810799 6:9777540-9777562 CTCCCCAGTCTAGGTCTGTGTGG + Intronic
1005935963 6:30521125-30521147 CTCCCGTGCCTGGCTCGGTGGGG + Intergenic
1006939614 6:37743174-37743196 CTCCCCTCCCATGGTCTTTGTGG - Intergenic
1007031162 6:38628289-38628311 CTCCCCTGCTTTCTTCTGTGTGG - Intronic
1007706302 6:43793539-43793561 CTCCCCTGCCTGGGTCCCAGAGG - Intergenic
1007822400 6:44570326-44570348 GTCCCAAGGCTAGGTCTGTGAGG - Intergenic
1010102702 6:72128122-72128144 CGCCCCTCTCTAGGTTTGTGAGG - Intronic
1010650053 6:78443552-78443574 CTACACTGCCTAGGTATGTTGGG - Intergenic
1013589584 6:111608782-111608804 CTGCCCTGCCTAGGACATTGTGG + Intergenic
1014947991 6:127518935-127518957 CTCTCCTGCCCAGTTCGGTGAGG - Exonic
1017399178 6:154039688-154039710 CTCTCCCGCCCAGGTCGGTGCGG - Exonic
1018344746 6:162888684-162888706 CTCCCCTGCCTGGGTCTGCAGGG + Intronic
1019158835 6:170056367-170056389 CCCCACTGCCTGGCTCTGTGGGG - Intergenic
1019343391 7:518770-518792 CTGCCATGCCTAAGTGTGTGTGG - Intronic
1019419696 7:945341-945363 CTCTCCTGCGTGGGCCTGTGGGG - Intronic
1019518015 7:1448128-1448150 CTCCCCTGCCCAGTTCTATCCGG + Intronic
1023466873 7:40465832-40465854 CTGCCCTGGCTAGGTCTTTCTGG + Intronic
1024700389 7:51899787-51899809 CCGCCCTGCCTGGGTCTGGGAGG - Intergenic
1025254233 7:57372752-57372774 CTTCCCAGCATGGGTCTGTGTGG - Intergenic
1026518887 7:71097889-71097911 CTCCCCTTCCCAGCTCTGTTGGG + Intergenic
1029185317 7:98734174-98734196 CTCCTCTGCCTTTGTCCGTGGGG + Intergenic
1029539709 7:101175428-101175450 CTCCACTCCCAGGGTCTGTGTGG - Intronic
1029708839 7:102288783-102288805 TTCCCCTCCCTAAGTGTGTGGGG - Intronic
1032465983 7:132145357-132145379 CTCCCCTGCCTAGGTCTGTGAGG - Intronic
1034093119 7:148382212-148382234 CTCCCGGGCCCAGGCCTGTGGGG - Intronic
1034715553 7:153238206-153238228 CTCACTTGCCTATGTCTTTGTGG - Intergenic
1035888937 8:3323790-3323812 CTCCCCCTCCTGGGTCTCTGGGG - Intronic
1035888966 8:3323933-3323955 CTCCCCCTCCTGGGTCTCTGGGG - Intronic
1035888982 8:3324005-3324027 CTCCCCCTCCTGGGTCTCTGGGG - Intronic
1035888999 8:3324076-3324098 CTCCCCCACCTGGGTCTCTGGGG - Intronic
1035889099 8:3324505-3324527 CTCCCCCTCCTGGGTCTCTGGGG - Intronic
1036616594 8:10392508-10392530 CTCCCCTTCCTCTGTCTCTGGGG + Intronic
1038944433 8:32341612-32341634 CTCCCCTGCCTGTGCCTATGTGG - Intronic
1039493087 8:37962416-37962438 CTCCCCTGCCTAGCACTGACTGG + Intergenic
1047216234 8:122878368-122878390 CTCACATACCTAGGTCAGTGAGG + Intronic
1049273456 8:141708137-141708159 CTGCCATGCCTGGGCCTGTGGGG - Intergenic
1049337330 8:142093446-142093468 CGCCCCTGCCCAGGCCTGGGTGG + Intergenic
1049553542 8:143271491-143271513 CTCCCCTGCTTAGGAATCTGTGG - Intronic
1049654859 8:143792966-143792988 TGCCCCTGCCCAGGTGTGTGGGG - Exonic
1051322101 9:15915785-15915807 CTTCTCTGCCTAGTTCTTTGAGG + Intronic
1052122647 9:24737909-24737931 TTTCCTTGCCAAGGTCTGTGGGG - Intergenic
1052668342 9:31522984-31523006 CTACCATTCCTAGGTCAGTGTGG + Intergenic
1052729342 9:32266735-32266757 CTCCCCTTGCCAGGTTTGTGTGG - Intergenic
1052729557 9:32269170-32269192 CTCCCCTTGCCAGGTTTGTGTGG - Intergenic
1053105505 9:35404752-35404774 CTCCCCTGCCTAGAGGAGTGAGG - Exonic
1053459599 9:38258176-38258198 CTCCCCTGCCTAACTCTGCCAGG + Intergenic
1056825774 9:89875469-89875491 TTCTCCTGCCTTGGTCTGAGAGG + Intergenic
1057012667 9:91619630-91619652 CTGCCCTGCCCAGGCCTGGGAGG + Intronic
1057075041 9:92134208-92134230 CTCCCCATCCCAGGTCTGGGTGG - Intergenic
1058175321 9:101729200-101729222 CCTCCCTGCATAAGTCTGTGTGG + Intronic
1059351082 9:113665476-113665498 CATCCCTGCCAAGGTCTCTGGGG - Intergenic
1060242531 9:121916877-121916899 CTCAGCTGCCTAGGTATTTGAGG + Intronic
1060294889 9:122336767-122336789 CTCCCCTGCCTGGGGCTGTCTGG + Intergenic
1060295522 9:122340581-122340603 CTCACCTGCCCAGGGATGTGGGG - Intergenic
1060405420 9:123370670-123370692 CTGCCCTGCCCGGCTCTGTGTGG + Exonic
1061238857 9:129357732-129357754 CTCCCCTGCCTGCCTCTGTTCGG - Intergenic
1191666450 X:63707478-63707500 CCCCACTTCCTAGGACTGTGGGG - Intronic
1195410994 X:104567522-104567544 CTCCCCTGCCTAGTGCTTGGTGG - Intronic
1197009577 X:121544897-121544919 CTCCCCTTGCCAGGACTGTGGGG + Intergenic
1200093494 X:153646845-153646867 CTCCCCTGCCTGGATCTCAGTGG - Intronic