ID: 1032465986

View in Genome Browser
Species Human (GRCh38)
Location 7:132145366-132145388
Sequence TATACCATCCTCCCCTGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032465986_1032465988 -5 Left 1032465986 7:132145366-132145388 CCTAGGCAGGGGAGGATGGTATA 0: 1
1: 0
2: 2
3: 17
4: 188
Right 1032465988 7:132145384-132145406 GTATACAGCCCACCCTACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1032465986_1032465992 5 Left 1032465986 7:132145366-132145388 CCTAGGCAGGGGAGGATGGTATA 0: 1
1: 0
2: 2
3: 17
4: 188
Right 1032465992 7:132145394-132145416 CACCCTACTTGGGTAAAATTGGG 0: 1
1: 0
2: 0
3: 4
4: 93
1032465986_1032465987 -6 Left 1032465986 7:132145366-132145388 CCTAGGCAGGGGAGGATGGTATA 0: 1
1: 0
2: 2
3: 17
4: 188
Right 1032465987 7:132145383-132145405 GGTATACAGCCCACCCTACTTGG 0: 1
1: 0
2: 0
3: 5
4: 33
1032465986_1032465991 4 Left 1032465986 7:132145366-132145388 CCTAGGCAGGGGAGGATGGTATA 0: 1
1: 0
2: 2
3: 17
4: 188
Right 1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032465986 Original CRISPR TATACCATCCTCCCCTGCCT AGG (reversed) Intronic
900649665 1:3724539-3724561 TGTCCCACCCTCACCTGCCTAGG + Intronic
900657963 1:3769414-3769436 TGGACCATCCTCCACTGCCCAGG - Intronic
901381200 1:8875847-8875869 CAAGCGATCCTCCCCTGCCTTGG + Intronic
902795854 1:18799984-18800006 TATTCCATCTTCCCCTTCCGTGG - Intergenic
902807791 1:18871872-18871894 TGTAGAATCCTCCTCTGCCTGGG - Exonic
906543488 1:46605547-46605569 TAAGCCATCCTCTCCAGCCTGGG - Intronic
910797338 1:91111599-91111621 TATACCATCCTTGCATCCCTGGG - Intergenic
910849252 1:91635084-91635106 AATACCAACTTCCCCTACCTGGG - Intergenic
914349415 1:146827190-146827212 TATACTACCTTCCCCTGCCAGGG + Intergenic
915368003 1:155326107-155326129 TCTGCCCTCTTCCCCTGCCTTGG + Intronic
915386911 1:155502995-155503017 GTTACCAAGCTCCCCTGCCTTGG + Intronic
915458868 1:156057866-156057888 TATATCTTCCTCCCATGCCCTGG - Intronic
917708338 1:177657575-177657597 TACACCATCCTCCCCTATCGAGG - Intergenic
917999659 1:180480285-180480307 TATATCATCATCTCTTGCCTAGG - Intronic
918127244 1:181595528-181595550 TCCACCATCCTCCCCTTCCCGGG + Intronic
918939609 1:190975190-190975212 TATACATTCCACCCCTTCCTTGG + Intergenic
922232388 1:223698420-223698442 TTTACCGTCATCACCTGCCTGGG + Intergenic
923457891 1:234180760-234180782 TCTTCCCTCCTTCCCTGCCTGGG - Intronic
924696648 1:246407487-246407509 TATAGCAGCCTCAGCTGCCTAGG - Intronic
924948593 1:248862983-248863005 TATACCACCCCACCCTACCTGGG - Intergenic
1068577272 10:58698382-58698404 CATGCCCTCCTCCTCTGCCTGGG + Intronic
1070786498 10:79165238-79165260 CAAGCCTTCCTCCCCTGCCTGGG + Intronic
1070867225 10:79713727-79713749 CAGAGCATCCTCCCCAGCCTCGG - Intronic
1070881017 10:79851851-79851873 CAGAGCATCCTCCCCAGCCTCGG - Intergenic
1071634139 10:87235951-87235973 CAGAGCATCCTCCCCAGCCTCGG - Intronic
1071647589 10:87368168-87368190 CAGAGCATCCTCCCCAGCCTCGG - Intronic
1072788093 10:98297888-98297910 TCTGGCATCCTCCCCTGCCAGGG + Intergenic
1075265820 10:120999051-120999073 TTTCCCCTCCTCCCCTCCCTGGG - Intergenic
1076055314 10:127367887-127367909 TATCCCCACCTCCCCTGGCTTGG - Intronic
1078181484 11:9015315-9015337 CCTACCACACTCCCCTGCCTTGG - Intergenic
1080679313 11:34459329-34459351 TATATCAACCGCCACTGCCTAGG - Intronic
1082737704 11:56874642-56874664 TCTACCATCATCTCTTGCCTGGG + Intergenic
1082997560 11:59265749-59265771 TAGCCCTTCCTGCCCTGCCTGGG + Intergenic
1083804776 11:65067173-65067195 TATACCACCCACCCCTTCCAAGG - Intronic
1084873974 11:72117165-72117187 CACACCATGCTCTCCTGCCTGGG - Intronic
1084938184 11:72598402-72598424 CATACCAACCTCCCCTGCCTTGG - Intronic
1085009787 11:73130502-73130524 TAAACTATCTTCACCTGCCTTGG + Intronic
1087700158 11:101428171-101428193 TATATCATCCTACCCTCTCTTGG + Intergenic
1088795104 11:113261089-113261111 TATGCCCACCTCTCCTGCCTGGG - Intronic
1089544876 11:119216167-119216189 TGTAACAGCCTCCACTGCCTGGG + Intronic
1091298522 11:134490006-134490028 TATCCCCTCCTACCCCGCCTTGG + Intergenic
1092007423 12:5081164-5081186 TAGCCCCTCCTCCCCTGCCTGGG + Intergenic
1092303802 12:7279264-7279286 AGTACCATCCTCCTCTTCCTAGG + Intergenic
1093083476 12:14840600-14840622 TTTACCATATTCACCTGCCTGGG - Exonic
1093730737 12:22562994-22563016 ACAACCATCATCCCCTGCCTTGG + Intergenic
1093910798 12:24744649-24744671 TATGCCTTCCTCCCGTGCCAAGG + Intergenic
1101341314 12:103843918-103843940 TTTACCACCATCCCCTGCCATGG - Intronic
1101718895 12:107334279-107334301 GCCACCATCCTCTCCTGCCTGGG - Intronic
1101724224 12:107375913-107375935 TGTACCATCCTGCCTAGCCTGGG + Intronic
1104607363 12:130199876-130199898 CATCCCACCCTCCCCGGCCTGGG - Intergenic
1105878971 13:24586825-24586847 TATACCATTCTCTCATGCCCAGG + Intergenic
1105920866 13:24962225-24962247 TATACCATTCTCTCATGCCCAGG - Intergenic
1111810951 13:93094557-93094579 AATATCATCCTCCCCTCACTTGG - Intergenic
1112433815 13:99376253-99376275 TCTGTCATGCTCCCCTGCCTTGG + Intronic
1115544738 14:34455483-34455505 TCTTCCTTCCACCCCTGCCTCGG - Intronic
1120393207 14:83934705-83934727 ATTCCCATCCTCTCCTGCCTGGG + Intergenic
1120579957 14:86234360-86234382 TAAACCATCCTTGCATGCCTGGG - Intergenic
1122983692 14:105202728-105202750 CATCCCAGCCTCCTCTGCCTGGG - Intergenic
1126925760 15:53584794-53584816 CATGCCATACTGCCCTGCCTTGG + Intronic
1127878498 15:63133570-63133592 TATACCCTGCTCTCCAGCCTGGG + Intronic
1130339288 15:82985796-82985818 TACACCTTTCTCTCCTGCCTGGG - Intronic
1130919852 15:88334815-88334837 CACCCCATCCTCCCCAGCCTGGG - Intergenic
1132995871 16:2822157-2822179 TGTTCCTTCCTTCCCTGCCTCGG - Intronic
1135037717 16:19091939-19091961 TAAGCAATCCACCCCTGCCTTGG + Intergenic
1135388729 16:22069966-22069988 GATCCCATCCTCCCCTTCTTTGG - Intronic
1136007339 16:27340099-27340121 TATGCAACCCTCCCCTGCCCTGG - Intronic
1138459019 16:57137140-57137162 AATACCATCCACACCTGCCTCGG - Exonic
1139984621 16:70888364-70888386 TATACTACCTTCCCCTGCCAGGG - Intronic
1140175988 16:72660557-72660579 TTTTCCATTCTCCCCTGCCCTGG + Intergenic
1140881740 16:79204703-79204725 GTTAACATCCTCCCATGCCTTGG + Intronic
1141753480 16:85975474-85975496 AAGATCATCCTCCCCTGCCTTGG + Intergenic
1143473738 17:7191708-7191730 TTTCCCCTCCTCTCCTGCCTTGG - Intronic
1145885010 17:28375972-28375994 TATACAATCTTCCCCTCCTTTGG + Intronic
1147876196 17:43622342-43622364 TTTACCACCTTCACCTGCCTGGG - Intergenic
1148337109 17:46849427-46849449 CACTCCATCCTCACCTGCCTAGG + Intronic
1148904383 17:50902650-50902672 GAAACCATTCTCCCCTGCTTGGG - Intergenic
1149900677 17:60474859-60474881 TATACTGTCTTCCCCTACCTTGG + Intronic
1150884471 17:69069463-69069485 CAGACCCTCCTCCCCTGCTTTGG - Intergenic
1151167978 17:72220856-72220878 TATTCCAGCCTCCTCTGCATGGG + Intergenic
1151184679 17:72354831-72354853 TATACCATCAACTCCTGGCTGGG - Intergenic
1152073812 17:78146894-78146916 CTTACCTTCCTCCCGTGCCTTGG - Exonic
1152272665 17:79334131-79334153 TCTACCATCCACCCATTCCTAGG + Intronic
1153110053 18:1575482-1575504 TATACAATCCTCTGCTGCTTTGG - Intergenic
1157311854 18:46559060-46559082 TACACCATACTCACCTGCCAAGG + Intronic
1157419192 18:47531259-47531281 TGTTCTATCCTGCCCTGCCTTGG - Intergenic
1157582777 18:48782960-48782982 TAGACCCTTCTCCCCTGCCCAGG + Intronic
1162472075 19:10878294-10878316 TCTACAAGCTTCCCCTGCCTCGG - Intronic
1162724715 19:12683068-12683090 AAAACCATCCTCCCCTCCCGAGG - Intergenic
1164640314 19:29820207-29820229 TGTCCCACCCTCACCTGCCTAGG - Intronic
1167607971 19:50491584-50491606 TCTCCCATCCTCCCCTCCATGGG - Intergenic
927132410 2:20071716-20071738 TATGTCATCTTCCCCAGCCTGGG - Intergenic
928177705 2:29046383-29046405 CAAAGCCTCCTCCCCTGCCTTGG + Intronic
928531794 2:32200037-32200059 TATAACCTCCTCCACTTCCTGGG - Intronic
928950955 2:36812534-36812556 AATCCCATCCTCTCCTCCCTGGG + Intronic
932256868 2:70295053-70295075 CACACCATGCTCCCCAGCCTAGG - Intergenic
933512127 2:83254098-83254120 TATATCATCCTGCTCAGCCTCGG + Intergenic
933533719 2:83544773-83544795 TATTCTATCTTCCCCTGTCTTGG + Intergenic
933852509 2:86381810-86381832 TATACCATCCTACTCTCTCTAGG + Intergenic
936529402 2:113265287-113265309 ACTTCCATCCTCCCCTGGCTTGG - Intronic
941846070 2:170134695-170134717 TGAACCATCCTCACCTCCCTGGG - Intergenic
942717692 2:178912864-178912886 TGTACCATCCAGCCCTTCCTCGG + Intronic
947741888 2:232488402-232488424 TTCCCCATCCTCCCCAGCCTTGG + Intergenic
948298762 2:236886112-236886134 TATATGCTCCTCCCATGCCTAGG + Intergenic
1170922058 20:20688482-20688504 TATTCCATCCTTCCCCACCTGGG - Intronic
1173443044 20:43095126-43095148 TATGCCAGCCACCTCTGCCTTGG + Intronic
1176740309 21:10595590-10595612 TATACCATTCTCTCATGCCCAGG + Intronic
1178298165 21:31428407-31428429 TATACCACCCTCTCCTGTCCTGG - Intronic
1183282318 22:36938272-36938294 TATTGCTTCCTCCCCGGCCTGGG + Exonic
1183458621 22:37936278-37936300 TCTACCTTCCTCCACAGCCTTGG + Intronic
1184089304 22:42283910-42283932 TTTCCCCTCCTCCCCCGCCTCGG - Intronic
950264668 3:11564891-11564913 TACACCTCCCTCCCCAGCCTTGG - Exonic
951654648 3:24991956-24991978 TGTACCTTCCTCCCCTGCTCAGG + Intergenic
952435902 3:33272298-33272320 TACACTATCCACCGCTGCCTGGG - Intergenic
955405136 3:58621072-58621094 TATACTGTCCTCCCCTTCCCTGG - Intronic
956417453 3:69048530-69048552 TATCCCATCCTCCACTGACAGGG + Exonic
957718635 3:83966602-83966624 TATCCCATCCTCTCCTTCCTGGG - Intergenic
963430886 3:145201120-145201142 TAAACCATCCTCGCATCCCTGGG - Intergenic
967305273 3:188052932-188052954 TATGCCTTCCTCCCCTCCCCAGG + Intergenic
967670646 3:192231119-192231141 TATACCATCCTCTCTGGCCTTGG + Intronic
969785843 4:9456432-9456454 AATACCATCCTCTCCTTCTTTGG + Intergenic
971359335 4:25922495-25922517 TAGGCCATCCTCTCCTTCCTTGG + Intronic
971961401 4:33492164-33492186 TGTACCATCCTTCCATCCCTGGG + Intergenic
972576446 4:40356376-40356398 AACATCATCCTCCCCTTCCTAGG - Intergenic
973928500 4:55764924-55764946 TATACCATGCACTCCAGCCTGGG + Intergenic
975764204 4:77650105-77650127 TATAGCATCAGCTCCTGCCTAGG + Intergenic
976587300 4:86812877-86812899 TACACCTTCCTCCCCAGACTTGG - Intronic
980929540 4:139172391-139172413 CATACCATGCCCCTCTGCCTCGG + Intronic
982293102 4:153799195-153799217 CTTAACATCCTTCCCTGCCTGGG - Intergenic
982293116 4:153799249-153799271 CTTAACATCCTTCCCTGCCTGGG - Intergenic
983623419 4:169783020-169783042 AATATCATCCTCCCCTGCCCCGG - Intergenic
983623852 4:169785612-169785634 TATATCATCCTCTCCCACCTTGG - Intergenic
986136968 5:4989337-4989359 TTTACCAGCCTCCCCTTTCTAGG + Intergenic
986345285 5:6829286-6829308 TATGCCATCCTCCCTGGCCTGGG - Intergenic
986361083 5:6978783-6978805 TTTGCCATCTTCTCCTGCCTGGG + Intergenic
986668207 5:10121196-10121218 ACTACCATCCTCCCCTGCGTTGG + Intergenic
987065522 5:14286265-14286287 CATACCATCCACCCGTCCCTGGG - Intronic
987911978 5:24159095-24159117 TAAACCATCCTCACATCCCTGGG - Intronic
989567012 5:42910847-42910869 TGTACCCCCCTCCCCTTCCTGGG + Intergenic
990282929 5:54270995-54271017 AATACACTCATCCCCTGCCTTGG + Intronic
990728489 5:58783120-58783142 TATTCCATCCTCCCTTTGCTAGG + Intronic
991337259 5:65563069-65563091 TATATCAACCTCCCCGGCCCAGG + Intronic
994391576 5:99197979-99198001 AATACTATCCTCTCCTGCCCTGG + Intergenic
995376927 5:111484297-111484319 TATCCCATCCTCCACTGCCTTGG - Exonic
997832147 5:137159072-137159094 GAGACCAGCCTCCCCTCCCTGGG - Intronic
997911779 5:137881586-137881608 TATACCAACCTCCGCTTCTTGGG - Intronic
998369059 5:141649638-141649660 TTTCCCATCCTCCCTTGTCTGGG + Intronic
999159189 5:149481248-149481270 TCAGCCATCTTCCCCTGCCTCGG - Intergenic
999766385 5:154744135-154744157 TTTATGATCCTCCCCTGCCAAGG - Intronic
1000946114 5:167425193-167425215 TATACTATCCTCATCTGCCTTGG - Intronic
1004565649 6:16794417-16794439 TATAACATCCTTCTCTGTCTTGG - Intergenic
1005342134 6:24852839-24852861 TTGCCCAGCCTCCCCTGCCTTGG - Intronic
1005981776 6:30842056-30842078 CCTCCCATCCTCTCCTGCCTGGG - Intergenic
1005987082 6:30882265-30882287 TTTCCCATCCTCTCCTTCCTGGG + Intronic
1007549791 6:42720482-42720504 TTTACAATCCTCTCCTGACTGGG + Intronic
1009632583 6:66217330-66217352 TATTCCATTCTCCTCTGTCTTGG + Intergenic
1010499934 6:76585310-76585332 TACACCATCTTCTACTGCCTTGG - Intergenic
1010794150 6:80100032-80100054 TATTCCTTCTTCCCCTTCCTCGG - Intergenic
1011022022 6:82825158-82825180 TATACCTTCCTCACCCTCCTTGG - Intergenic
1012774209 6:103481393-103481415 TATATCATCCTCCCCTTTCCTGG + Intergenic
1013268098 6:108520161-108520183 TATACCATGCTGCCCTTTCTGGG + Intronic
1013326753 6:109053498-109053520 TATAGCAGCCTCTCCTGTCTTGG - Intronic
1014405531 6:121046148-121046170 TCTACCATACTTCCCTTCCTTGG - Intergenic
1020014387 7:4822333-4822355 GATGCCACACTCCCCTGCCTGGG + Intronic
1022988097 7:35680021-35680043 TAAACCATCGTCTCCTGCCTGGG + Intronic
1029284394 7:99455926-99455948 TGTCCCAGCCTCCCCTCCCTTGG - Intronic
1030067917 7:105674604-105674626 TCTACCATGCCACCCTGCCTGGG + Intronic
1031279173 7:119774082-119774104 TATACCAGGCTTCCCTGCTTAGG - Intergenic
1032465986 7:132145366-132145388 TATACCATCCTCCCCTGCCTAGG - Intronic
1033238522 7:139657531-139657553 TTGGCCATCATCCCCTGCCTGGG + Intronic
1034589438 7:152127425-152127447 TGGACCATGCTCCCCTGCGTGGG + Intergenic
1034589454 7:152127489-152127511 TGGACCATGCTCCCCTGCGTGGG + Intergenic
1034686008 7:152972129-152972151 TCTCCCATCCTTCCCTGACTCGG - Intergenic
1035350166 7:158239850-158239872 TATAGCATCCTCCAGTGCCCCGG - Intronic
1038776887 8:30539355-30539377 TACACCATCCTTTCCTCCCTGGG - Intronic
1039612171 8:38928715-38928737 TATATCATCCTCTGCTGCGTGGG - Intronic
1040019961 8:42732022-42732044 TTTCTCATCATCCCCTGCCTGGG + Exonic
1040377898 8:46844226-46844248 TGTACTCTCCTCTCCTGCCTAGG + Intergenic
1044142060 8:88668716-88668738 GATACCCTCATCTCCTGCCTGGG - Intergenic
1045924777 8:107571231-107571253 AATATCATCCTCCCCTCCCCTGG - Intergenic
1047175826 8:122539528-122539550 TCTACCACCCTCCCCATCCTAGG + Intergenic
1049374934 8:142284911-142284933 TATACCATCCCCACTTGCCTGGG + Intronic
1049462285 8:142735730-142735752 GGCACCATCCTCCCCTACCTAGG - Exonic
1052872607 9:33523521-33523543 CAGACCATGCTCCGCTGCCTGGG + Intergenic
1056065069 9:82925191-82925213 TGTATAATCCTCCCCTCCCTTGG + Intergenic
1056251939 9:84757572-84757594 TATCTCATCCTCTCTTGCCTCGG + Intronic
1058437709 9:104978341-104978363 CAAACAATCCTCCCCTGCCTTGG - Intergenic
1059342132 9:113603233-113603255 GTTACCACCCTCCCCTTCCTTGG - Intergenic
1061084039 9:128389104-128389126 CAGACCAGCCTCCCCTTCCTGGG + Intronic
1061808401 9:133148970-133148992 TCTACCATCATCCTCAGCCTCGG + Intronic
1062401974 9:136376735-136376757 TACAGCCTCCTGCCCTGCCTGGG - Intronic
1203770774 EBV:48972-48994 GATGCCATCATCCCCTGCTTGGG + Intergenic
1187732803 X:22272762-22272784 TGCACCATCTTCCCCAGCCTAGG - Intergenic
1189921131 X:45904125-45904147 TAGACCACCCCTCCCTGCCTTGG - Intergenic
1192800600 X:74461654-74461676 TTTACCTTCCTCCTTTGCCTGGG + Intronic
1197728673 X:129792934-129792956 CTTACCAGCCACCCCTGCCTAGG - Intronic
1199318324 X:146407679-146407701 TAGACCATCCTCTGCTCCCTGGG + Intergenic
1199934378 X:152557752-152557774 AATACCAGACTCCCCTCCCTGGG + Intergenic
1200696559 Y:6366219-6366241 TATACCATTTTCCTCTGCCTAGG - Intergenic
1200704882 Y:6434148-6434170 TGTACCATTTTCCTCTGCCTAGG - Intergenic
1200911391 Y:8534408-8534430 TATACCATTTTCCTCTGCTTAGG + Intergenic
1200916848 Y:8578745-8578767 TATACCATTTTCCTCTGCTTAGG + Intergenic
1200926832 Y:8662222-8662244 TATACCATTTTCCTCTGCTTAGG + Intergenic
1201029229 Y:9730560-9730582 TGTACCATTTTCCTCTGCCTAGG + Intergenic
1201037554 Y:9798480-9798502 TATACCATTTTCCTCTGCCTAGG + Intergenic
1201153285 Y:11107078-11107100 CAGACCATGCTCCCCTGCCTGGG + Intergenic
1202179066 Y:22124065-22124087 TGTACCATCTTCCTCTGCCTAGG - Intergenic
1202212295 Y:22462329-22462351 TGTACCATCTTCCTCTGCCTAGG + Intergenic
1202598590 Y:26569464-26569486 TATACCATTCTCTCATGCCCAGG + Intergenic