ID: 1032465991

View in Genome Browser
Species Human (GRCh38)
Location 7:132145393-132145415
Sequence CCACCCTACTTGGGTAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032465986_1032465991 4 Left 1032465986 7:132145366-132145388 CCTAGGCAGGGGAGGATGGTATA 0: 1
1: 0
2: 2
3: 17
4: 188
Right 1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG 0: 1
1: 0
2: 0
3: 5
4: 72
1032465979_1032465991 17 Left 1032465979 7:132145353-132145375 CCTGCCTCACAGACCTAGGCAGG 0: 1
1: 0
2: 2
3: 20
4: 254
Right 1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG 0: 1
1: 0
2: 0
3: 5
4: 72
1032465983_1032465991 13 Left 1032465983 7:132145357-132145379 CCTCACAGACCTAGGCAGGGGAG 0: 1
1: 1
2: 2
3: 14
4: 213
Right 1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032465991 Original CRISPR CCACCCTACTTGGGTAAAAT TGG Intronic
903740477 1:25555870-25555892 CCACTCTAGTTGGGTATAGTCGG + Intronic
906552949 1:46681397-46681419 ACACCATACCTAGGTAAAATAGG + Intronic
911485629 1:98501477-98501499 CCACCCTTCCTGGGTCAAGTGGG - Intergenic
911526167 1:98989169-98989191 ACAGCCTATTTGGTTAAAATGGG + Intronic
917908206 1:179611201-179611223 CCACCATACTTGGCTAATTTTGG + Intronic
919413390 1:197275359-197275381 CCACTTTTATTGGGTAAAATTGG + Intronic
920352893 1:205349426-205349448 CCTGCCTACTTAGGTAAAACTGG + Intronic
922761761 1:228137239-228137261 ACAGGCTACTTGGTTAAAATGGG + Intergenic
922794315 1:228332530-228332552 CCATCCTACTAGGGAATAATGGG - Intronic
922804776 1:228379610-228379632 CGACCCCTCTTGGCTAAAATGGG + Intergenic
924149999 1:241120205-241120227 CCTGCCTACCTGGTTAAAATGGG + Intronic
1065603601 10:27393709-27393731 CCACCTGACTAGGGTAATATGGG - Intergenic
1068456157 10:57256286-57256308 CCACCTTACTTGTGTAAGAATGG - Intergenic
1070728843 10:78811010-78811032 CCACCCTACCTGCATCAAATAGG + Intergenic
1071252805 10:83838184-83838206 CCACCCTACTGCAATAAAATAGG + Intergenic
1073415868 10:103381417-103381439 CCACCCTGCTTGGCTAATTTTGG + Intronic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085371943 11:76016180-76016202 CCACCCTATTTATGTAATATAGG - Intronic
1088919031 11:114248372-114248394 CCACCTTAGTTGCTTAAAATTGG + Intronic
1104655548 12:130571712-130571734 CCACCCCACTTGGGACAAAACGG + Intronic
1104899124 12:132178782-132178804 CCACCCTACACGTGTAAAGTGGG - Intergenic
1113258586 13:108534560-108534582 TCACCCTTCCTGGGTAGAATTGG - Intergenic
1113901246 13:113799368-113799390 CCACCCCACTGGAGTAAAACTGG - Exonic
1114995095 14:28339464-28339486 CTACCTTACTAAGGTAAAATTGG - Intergenic
1119098908 14:71861396-71861418 CCACCTTACTTCTGCAAAATTGG + Intergenic
1123945261 15:25235845-25235867 CCACCCTCCATGGGGAGAATGGG - Intergenic
1125353280 15:38789980-38790002 CCAACCTACTAGGGTATTATTGG + Intergenic
1137481705 16:48857285-48857307 CCATCCTACTGAGGGAAAATAGG + Intergenic
1150160701 17:62895518-62895540 CCACCCCACTGGGGTGAAAATGG - Intergenic
1150852252 17:68714866-68714888 CCACCTTACTTAAGCAAAATTGG + Intergenic
1151169683 17:72236353-72236375 CCACCCTATCTGGCCAAAATGGG - Intergenic
1155159885 18:23186822-23186844 CCACCCTGGATGGGTAACATGGG + Intronic
1166925675 19:46265468-46265490 CCACCCTGCTGGGCTGAAATAGG - Intergenic
1167981677 19:53281420-53281442 CATCCCTACTTGGGTAAATAGGG + Intergenic
932432015 2:71681783-71681805 CCAGCCTACTTGGCTCAAGTTGG + Intronic
938820333 2:134951409-134951431 CCACACTACTTTGGAAAAGTGGG + Intronic
1172747598 20:37224727-37224749 CTACCCTAGTTGAGTAAAGTTGG - Intronic
1174659539 20:52199588-52199610 CCACCACACTTGGCCAAAATAGG - Intronic
1175129145 20:56776084-56776106 ACACCCTACTTGTGGAAAGTGGG + Intergenic
1181993401 22:26855668-26855690 CCACCCTAGATGGGGAAATTAGG - Intergenic
953192092 3:40697582-40697604 CCATCCTACTTCTGTGAAATGGG + Intergenic
954870187 3:53761883-53761905 CCACCCTACCTGGGTGCCATGGG + Intronic
960119857 3:113936849-113936871 CCACCACACCTGGCTAAAATTGG + Intronic
965617960 3:170613943-170613965 CCAGCCTTCTTGTGTAAACTGGG + Intronic
973614740 4:52667095-52667117 CCACCCTACTTGGCTAACTTAGG - Intergenic
976765044 4:88591040-88591062 CCACCCTACTCGGCTAATTTTGG + Intronic
978682552 4:111399399-111399421 CATCTCTACTTGGGTAAAATCGG - Intergenic
979320408 4:119316649-119316671 CCACCCTGCTTGGCCAAAAGAGG - Intergenic
980646191 4:135644707-135644729 CCACTCTACCTGGGAGAAATTGG - Intergenic
980786791 4:137566345-137566367 CCACTCTACTTAGGAAATATGGG + Intergenic
983649506 4:170024630-170024652 CCAGACTATTTGGCTAAAATGGG + Intronic
983984505 4:174041887-174041909 CCACCCTTCATAGGTAAAAGAGG - Intergenic
987781640 5:22444622-22444644 AAACACGACTTGGGTAAAATGGG + Intronic
993712236 5:91237046-91237068 TCAGCCTACTTGGTTAAAATGGG - Intergenic
995073232 5:107949321-107949343 CCTCCCTACTTGCCTTAAATTGG - Intronic
995953469 5:117745450-117745472 CCACCATACAAGTGTAAAATAGG + Intergenic
997932150 5:138081644-138081666 CCTCTCTGCTTGGGGAAAATAGG - Intergenic
1002085324 5:176771284-176771306 CCACCCTGCCTGGGTTACATGGG + Intergenic
1002085334 5:176771321-176771343 CCACCCTGCCTGGGTTACATGGG + Intergenic
1009975192 6:70664537-70664559 CTACGCTACTTGCTTAAAATAGG + Intergenic
1013842361 6:114412664-114412686 CCACACTGCTGGAGTAAAATTGG + Intergenic
1018925311 6:168201733-168201755 CCACCCAACTTGGGTCAATCAGG + Intergenic
1019626693 7:2019488-2019510 CCACCCTCCTTGTGCAAAACGGG + Intronic
1028435460 7:90797963-90797985 TCACCCTACTTGCAAAAAATAGG + Intronic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1034726858 7:153344385-153344407 CAATCCTAATTGTGTAAAATAGG + Intergenic
1037065990 8:14578093-14578115 TCACCCAACTTTGATAAAATAGG - Intronic
1044110461 8:88266597-88266619 CCCTCCTACTTTGGTAAAATGGG + Intronic
1045207502 8:100057179-100057201 CCACTCTAATTGGGAAAAATTGG - Intronic
1046033479 8:108811953-108811975 GCAGGCTACTTGGTTAAAATGGG + Intergenic
1056633227 9:88310730-88310752 CCACCCAACAGGGGTACAATGGG - Intergenic
1058212976 9:102196060-102196082 CAAACCTACTTGGGTTAGATTGG - Intergenic
1061082740 9:128382026-128382048 CCTCCCTACTTGGGTAACTCTGG - Intronic
1189012609 X:37061453-37061475 CCACTCATCTTGGGTAAACTTGG - Intergenic
1192317044 X:70061299-70061321 CCACCATACTTGGCTAATTTTGG - Intergenic
1195255193 X:103082995-103083017 CAGCCATACCTGGGTAAAATGGG + Exonic
1198387027 X:136138680-136138702 CCATCGTACTTGTGTAAAAATGG + Intergenic
1198831074 X:140751311-140751333 CCACCTTACTTGTGCAAAAATGG - Intergenic