ID: 1032468528

View in Genome Browser
Species Human (GRCh38)
Location 7:132161830-132161852
Sequence TGGGTACCCACGTGGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032468528_1032468532 -10 Left 1032468528 7:132161830-132161852 CCAGGCTCCCACGTGGGTACCCA 0: 1
1: 0
2: 3
3: 17
4: 117
Right 1032468532 7:132161843-132161865 TGGGTACCCAGTGCTCTAGTGGG No data
1032468528_1032468536 2 Left 1032468528 7:132161830-132161852 CCAGGCTCCCACGTGGGTACCCA 0: 1
1: 0
2: 3
3: 17
4: 117
Right 1032468536 7:132161855-132161877 GCTCTAGTGGGCTTCTAGGTAGG 0: 1
1: 0
2: 0
3: 8
4: 81
1032468528_1032468535 -2 Left 1032468528 7:132161830-132161852 CCAGGCTCCCACGTGGGTACCCA 0: 1
1: 0
2: 3
3: 17
4: 117
Right 1032468535 7:132161851-132161873 CAGTGCTCTAGTGGGCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032468528 Original CRISPR TGGGTACCCACGTGGGAGCC TGG (reversed) Intronic
900113440 1:1019321-1019343 GGAGGACCCAAGTGGGAGCCTGG - Intergenic
900166951 1:1247663-1247685 TGGGAACCCACCAGGGACCCCGG + Intergenic
900393121 1:2442453-2442475 TGGGCACCAAGCTGGGAGCCAGG - Intronic
902563689 1:17295712-17295734 TGGGTCCCCAGGTGGGGTCCAGG + Intergenic
902765979 1:18615551-18615573 TGGGTACCCAGGTGGACCCCCGG + Intergenic
902843688 1:19092808-19092830 TGGCTACCCACCTGGGTGCCAGG + Exonic
905860783 1:41349808-41349830 TGGGGAGCCATGCGGGAGCCTGG + Intergenic
906282686 1:44565256-44565278 TGGGTACCAATCTGGAAGCCTGG + Intronic
911498822 1:98661667-98661689 TGGGCACGCTCGGGGGAGCCGGG + Intergenic
915918899 1:159959538-159959560 TGGGCTCCCATGAGGGAGCCAGG - Intergenic
919797804 1:201331869-201331891 CAGGGACCCACGTGGGAGCCTGG + Exonic
920259262 1:204677862-204677884 TGGAAACCCAGGTGGGAGGCAGG + Intronic
920565183 1:206967402-206967424 TGGGCACCCACTTGCCAGCCTGG + Intronic
1068190472 10:53645765-53645787 TGTGAGCCCAAGTGGGAGCCAGG + Intergenic
1068611797 10:59068400-59068422 TTGGTACCAACGAGGGAGCCTGG - Intergenic
1069359692 10:67627326-67627348 TGAGTACCCATGTGGCACCCAGG - Intronic
1069397961 10:68010305-68010327 GGGGTACCAAAATGGGAGCCTGG + Intronic
1070919104 10:80172820-80172842 TGGGTAGCCACCTGGGGGCGGGG + Exonic
1072235055 10:93446539-93446561 CGGGTACCACAGTGGGAGCCAGG + Intronic
1075375607 10:121975526-121975548 TGCGTGCCCATGTGGGTGCCAGG - Intergenic
1075810065 10:125218795-125218817 TCAGCACCCAAGTGGGAGCCTGG + Intergenic
1076479330 10:130774608-130774630 TGTGATCCCACGTGGGAGACGGG + Intergenic
1078084811 11:8227366-8227388 TGAGGACCCTTGTGGGAGCCTGG - Intronic
1079203438 11:18394467-18394489 CGGGAACCCACGTGTGAGTCGGG - Intronic
1083399435 11:62413708-62413730 TGGGTGCACATGTGGGTGCCAGG - Intronic
1083636999 11:64126191-64126213 TGGGTACCCAGGTGGGCTGCTGG - Intronic
1083780034 11:64913027-64913049 TGGGGACCCACCTTGGGGCCAGG + Exonic
1084149714 11:67282421-67282443 TGGGTGCCCCTGTGGGAGCAAGG - Exonic
1084395204 11:68904649-68904671 TGGGGAGCCATGTGAGAGCCGGG + Intronic
1090164516 11:124533526-124533548 TGGGCAGGCACTTGGGAGCCAGG - Intergenic
1092108847 12:5945079-5945101 TGGGGACCCCCAAGGGAGCCTGG - Intronic
1103613082 12:122135747-122135769 TGGGTCCCCAGGACGGAGCCTGG + Intronic
1103986692 12:124772205-124772227 TCGGGACACGCGTGGGAGCCGGG + Intergenic
1104823247 12:131690758-131690780 TGGGATCCCGGGTGGGAGCCTGG + Intergenic
1108699245 13:52929804-52929826 TTGGTACCCACAGGGGATCCTGG + Intergenic
1117447131 14:55814875-55814897 TGTGTACCCACCTGGCAGTCAGG - Intergenic
1119654812 14:76409685-76409707 TGGGGACCTCCCTGGGAGCCAGG + Intronic
1121916495 14:97840617-97840639 TGTGTACCCAGGAGGGGGCCTGG + Intergenic
1202864293 14_GL000225v1_random:105038-105060 AGGGGACCCACGAGGGAGCAGGG + Intergenic
1125140735 15:36403529-36403551 TGGGGGCCCACCAGGGAGCCTGG + Intergenic
1129168353 15:73792500-73792522 AGAGCCCCCACGTGGGAGCCAGG + Intergenic
1131668014 15:94590755-94590777 TGGGCAGCCACGTGGAATCCAGG - Intergenic
1132546337 16:535079-535101 TGGGAGCCCACATGGGAGCAGGG - Intronic
1132864034 16:2084909-2084931 TGGGCACCCAGGTGAGGGCCTGG - Intronic
1138478062 16:57283808-57283830 TGGGCGCCCGCGCGGGAGCCGGG - Intronic
1140482015 16:75266944-75266966 TGGGTGCCCATGTGGGGGGCGGG + Intronic
1141767832 16:86070395-86070417 TGCGTGGCCAGGTGGGAGCCAGG + Intergenic
1142029639 16:87832087-87832109 TGGGCGCCCACATGGGTGCCTGG + Exonic
1142176949 16:88649846-88649868 AGGGCACCCAGCTGGGAGCCAGG - Intronic
1143270837 17:5673363-5673385 GGGGTACCCAGGTGGGGGCCAGG + Intergenic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1145003020 17:19318768-19318790 GGGGTTCTCACGTGGAAGCCTGG + Intronic
1146903235 17:36601595-36601617 GAGGGACCCACGTGGGAGCCTGG + Exonic
1148085832 17:44993344-44993366 TGGGTCCCCAGGCAGGAGCCGGG - Intergenic
1148818192 17:50345847-50345869 GGGGAGCACACGTGGGAGCCAGG + Intergenic
1151877986 17:76878170-76878192 TGGGTACCCAGGAGGGAAGCAGG - Intronic
1151903872 17:77035244-77035266 TGAGGCCCCACGTGGGGGCCTGG + Intergenic
1152096696 17:78276782-78276804 TGGGTCCCCAGGTGGGAGGGTGG + Intergenic
1152778123 17:82214497-82214519 TGGGAACCCATGTGTGGGCCGGG + Intergenic
1153682425 18:7513174-7513196 TGGGCACCCACACGGGAGCAGGG + Intergenic
1153966114 18:10183589-10183611 TGAGTACCCATGTGGCACCCAGG + Intergenic
1157198917 18:45642600-45642622 TGGGTTCCCCCATGGGAGCTGGG - Intronic
1158391757 18:57050464-57050486 TGGGTAGCCAGGTTGGAGCCTGG + Intergenic
1167566741 19:50261624-50261646 TGGCTGCCCACCTGCGAGCCAGG - Exonic
927345004 2:22027839-22027861 TGTGTATCCACGTGTGAGGCTGG + Intergenic
927960676 2:27239072-27239094 TGGGAACCCAGGTGGGGGCCTGG - Exonic
928664448 2:33536844-33536866 TGGGTGCCGGCGTGGGGGCCGGG + Intronic
934538973 2:95159277-95159299 TGTGGATCCACGTGGGAGCTGGG - Exonic
938064011 2:128271441-128271463 TGCATTCCCAGGTGGGAGCCAGG - Intronic
938491904 2:131765489-131765511 TGGGTAGCCACCTGGGGACCAGG - Intronic
938495660 2:131796853-131796875 TGGGTAGCCACCTGGGGACCAGG + Intronic
939839003 2:147164812-147164834 TGGGTCCCCAGGTGGGACACTGG + Intergenic
948247561 2:236499299-236499321 TGGGAAGCCAGGTGGGAGCCTGG - Intronic
1168830678 20:843807-843829 TGGGTACTCACCTGGGAGGAGGG - Intronic
1170548416 20:17454837-17454859 TGGGATCCCACGTGGGAGCGTGG - Intronic
1173805806 20:45924596-45924618 TGGGAACCCAGCTGGGACCCAGG + Intergenic
1175466681 20:59194308-59194330 TGGGTACCCAACTGGGAGCTGGG + Exonic
1176190073 20:63804295-63804317 TGGGCACCCAGGAGGGGGCCGGG + Intronic
1176615993 21:9028685-9028707 TGGGTAGCCACCTGGGGACCAGG + Intergenic
1177041845 21:16122053-16122075 TGGGTATCCACGTGGGAGAGAGG - Intergenic
1182904384 22:33922325-33922347 TGGTTACCGAGGCGGGAGCCAGG - Intronic
1184253119 22:43272080-43272102 CTGGTACCCACTTGGCAGCCTGG + Intronic
1184445240 22:44543211-44543233 TGGATGCCCACGTGGGGTCCAGG - Intergenic
1184776823 22:46627497-46627519 TGGGGAGCCAGGCGGGAGCCAGG + Intronic
960902491 3:122566157-122566179 TGGGCACGTACATGGGAGCCAGG + Intronic
968540732 4:1167099-1167121 TCTGCAACCACGTGGGAGCCAGG + Exonic
968810997 4:2799661-2799683 GGGGGACCCACTTGGGACCCAGG + Intronic
969580953 4:8064758-8064780 TGGGGACTCACGGGGGAGTCTGG + Intronic
973574518 4:52273549-52273571 TGGGCACCCACGTGACAGTCTGG - Intergenic
973777714 4:54258231-54258253 TGGGTGCCCAGGTCTGAGCCTGG + Intronic
976097811 4:81528005-81528027 TGGGTAGCCATGAGAGAGCCAGG + Intronic
981959029 4:150513472-150513494 TGAGGACCCAGGTGGGACCCAGG - Intronic
995217359 5:109611263-109611285 TTGGTACCCTCGTGGGGGCCTGG + Intergenic
997234566 5:132265398-132265420 AGGGTACCCACTTGGGAGCCTGG + Intronic
998152082 5:139763361-139763383 TGGGCACCCCAGGGGGAGCCAGG - Intergenic
999980872 5:156956775-156956797 TGGGTACCCAAGGGGGAGCAGGG - Intronic
1002335323 5:178473631-178473653 TGGGTACCTATGAGGGATCCTGG + Intronic
1002667569 5:180836997-180837019 TGTGTAGCCACCTGAGAGCCAGG + Intergenic
1003390327 6:5707894-5707916 GGGGTGCCGCCGTGGGAGCCCGG + Intronic
1006164772 6:32057786-32057808 TGGGTACCCAGGGGACAGCCAGG - Intronic
1017036777 6:150274160-150274182 AGGCTACCCACGTGTGACCCTGG - Intergenic
1019525468 7:1478596-1478618 TGGGTACCCGCGTGGGCCCAGGG - Intronic
1019542053 7:1555946-1555968 TGTCCACCCACCTGGGAGCCCGG + Intronic
1021353803 7:19628690-19628712 TGAGTTCCCATCTGGGAGCCAGG - Intergenic
1022172076 7:27840460-27840482 TGCTCACCTACGTGGGAGCCTGG - Intronic
1025953283 7:66163026-66163048 TGGGGTCACAGGTGGGAGCCAGG - Intergenic
1029254637 7:99261337-99261359 TGGATGCCCACGTGGGTGTCTGG + Intergenic
1030820083 7:114084545-114084567 TGTTTACCGACGTGGGTGCCAGG + Intergenic
1032468528 7:132161830-132161852 TGGGTACCCACGTGGGAGCCTGG - Intronic
1034469462 7:151247741-151247763 TGTGAAGGCACGTGGGAGCCCGG - Intronic
1036781167 8:11648804-11648826 TGGGGACCAACGTGGGAGAGAGG + Intergenic
1040055774 8:43056114-43056136 TGGGAAGACGCGTGGGAGCCTGG + Intronic
1042881750 8:73500172-73500194 TGGGTATCCATGTGGGTTCCTGG - Intronic
1044911077 8:97059462-97059484 TGGGCACCCAAGGGAGAGCCAGG - Intronic
1044938745 8:97319103-97319125 TGTGTATCCACATGTGAGCCAGG + Intergenic
1044938863 8:97320023-97320045 TGTGTATCCACATGTGAGCCAGG + Intergenic
1049085268 8:140473688-140473710 TGGGTACCCAGCTGGGACCCAGG - Intergenic
1049742613 8:144248352-144248374 TGGGGACCCACATGAGAGCACGG - Intronic
1049838658 8:144755811-144755833 TGGTGACCGACGGGGGAGCCGGG - Intronic
1052028479 9:23601570-23601592 TGGGTACCCACCAGGTAGCCTGG - Intergenic
1056117024 9:83450605-83450627 AGAGTCCCCACGTGGCAGCCTGG + Intronic
1056763256 9:89429114-89429136 AGGTTACCCACGGGGCAGCCTGG + Intronic
1057227087 9:93298106-93298128 TGGGGACCCCCGAGTGAGCCTGG + Intronic
1057793871 9:98142339-98142361 TGGTTCCCCAAGTGTGAGCCTGG + Intronic
1058690747 9:107518418-107518440 TGGGTAGCCAAGTAAGAGCCAGG + Intergenic
1059356062 9:113700385-113700407 TGGCCAGCCAGGTGGGAGCCAGG + Intergenic
1059414413 9:114154348-114154370 TGGGTCCCTACGTGCGAGGCTGG - Intergenic
1059873247 9:118601800-118601822 CAGGTACCTATGTGGGAGCCAGG + Intergenic
1062500005 9:136848238-136848260 GGCGTTCCCAGGTGGGAGCCTGG + Exonic
1062581429 9:137230790-137230812 AGGGTACCCCCGTGAGGGCCTGG + Exonic
1062722573 9:138052021-138052043 TGGGGGGCCACGTGGGAGCTGGG + Intronic
1203740030 Un_GL000216v2:170978-171000 AGGGGACCCACGAGGGAGCAGGG - Intergenic
1203441924 Un_GL000219v1:16533-16555 TGGGTCCCCCCGTGGGAGCCAGG - Intergenic
1203512732 Un_KI270741v1:135442-135464 TGGGTCCCCCCGTGGGAGCCAGG - Intergenic
1203655286 Un_KI270752v1:18153-18175 TTGGTACCCAAGAGGCAGCCAGG + Intergenic
1186355183 X:8783331-8783353 TGGGTACCCAGGTGCTGGCCGGG - Intergenic
1192214614 X:69150042-69150064 GGGCTCCCCACGTGGGAGCCGGG + Intergenic
1192224966 X:69221721-69221743 GGGCTCCCCACGTGGGAGCCAGG - Intergenic