ID: 1032472011

View in Genome Browser
Species Human (GRCh38)
Location 7:132185387-132185409
Sequence GATGAAGGTGTCGGTGCAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 317}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032472011_1032472016 2 Left 1032472011 7:132185387-132185409 CCACCTGCACCGACACCTTCATC 0: 1
1: 0
2: 2
3: 27
4: 317
Right 1032472016 7:132185412-132185434 TAGCACCTCATCTGAGGATGTGG 0: 1
1: 0
2: 0
3: 13
4: 108
1032472011_1032472015 -4 Left 1032472011 7:132185387-132185409 CCACCTGCACCGACACCTTCATC 0: 1
1: 0
2: 2
3: 27
4: 317
Right 1032472015 7:132185406-132185428 CATCTCTAGCACCTCATCTGAGG 0: 1
1: 0
2: 1
3: 17
4: 129
1032472011_1032472019 24 Left 1032472011 7:132185387-132185409 CCACCTGCACCGACACCTTCATC 0: 1
1: 0
2: 2
3: 27
4: 317
Right 1032472019 7:132185434-132185456 GTGTTGCAGACAATGTAGGATGG 0: 1
1: 0
2: 0
3: 9
4: 138
1032472011_1032472018 20 Left 1032472011 7:132185387-132185409 CCACCTGCACCGACACCTTCATC 0: 1
1: 0
2: 2
3: 27
4: 317
Right 1032472018 7:132185430-132185452 TGTGGTGTTGCAGACAATGTAGG 0: 1
1: 0
2: 2
3: 17
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032472011 Original CRISPR GATGAAGGTGTCGGTGCAGG TGG (reversed) Exonic
900396525 1:2455328-2455350 CACCAAGGTGTCGGGGCAGGAGG + Intronic
900975302 1:6012659-6012681 GATGAAGGTGGAGGTGGAGATGG + Intronic
901077597 1:6565017-6565039 GGTGAAGGAGTAGGTACAGGGGG + Intronic
902683991 1:18063870-18063892 AATGATGGTGCCGATGCAGGTGG - Intergenic
903056102 1:20637260-20637282 GATGGAGGTGCAGGTGCTGGGGG - Intronic
903277696 1:22232346-22232368 GATGAAGATGGTGGTGAAGGAGG - Intergenic
903558721 1:24212084-24212106 GATGAAGGTGGTGATGGAGGTGG + Intergenic
903558740 1:24212156-24212178 GATGGAGGTGGTGGTGGAGGTGG + Intergenic
903558763 1:24212268-24212290 GATGAAGGTGGTGATGGAGGTGG + Intergenic
905641705 1:39594511-39594533 GATGAAGGAGTTGGGGAAGGGGG - Intergenic
905938936 1:41847707-41847729 GAGGAAGGTGGCCGTGAAGGAGG - Intronic
907297699 1:53465915-53465937 GATGAAGGCATTGGTGAAGGTGG + Intronic
908081169 1:60580107-60580129 GATCAAGGTGTCGGTGGGGTTGG + Intergenic
910598617 1:89006099-89006121 GCTGAAGGTTTGTGTGCAGGAGG - Intergenic
912867719 1:113273142-113273164 GAAGAAGGTGCCTGTGCAGGAGG - Intergenic
913179208 1:116303376-116303398 GATGAAGATGCCGGTGGAGGTGG - Intergenic
913193706 1:116434797-116434819 GATTAAGGAGTCGGTGGGGGTGG - Intergenic
920098289 1:203500378-203500400 GGTGGAGGTGGAGGTGCAGGTGG - Intronic
920149625 1:203894187-203894209 GGTGTAGGGGTCGGGGCAGGGGG + Intergenic
920540161 1:206772168-206772190 GATGGAGGTGGAGGCGCAGGAGG + Intronic
920868277 1:209771364-209771386 GCTGGAGGTGTGTGTGCAGGTGG + Intronic
920872162 1:209803857-209803879 TATGAAGTTGTGGGGGCAGGGGG + Intronic
922472840 1:225887520-225887542 GCTACAGGTGTCGGTGCAGAGGG - Exonic
922480852 1:225939482-225939504 GCTACAGGTGTCGGTGCAGAGGG - Exonic
922909668 1:229205011-229205033 GAGGAAGGAGTGGGTGGAGGGGG + Intergenic
924708238 1:246515100-246515122 GATGAAGGAATCGCTCCAGGAGG - Intergenic
1062912350 10:1219753-1219775 GATGATGGTGGCGGTGGAGACGG + Intronic
1062982527 10:1737186-1737208 GAGGCAGGTGCAGGTGCAGGAGG - Exonic
1063059979 10:2540747-2540769 GAAGAAAGTGTCGTTGCAGTTGG - Intergenic
1067249398 10:44574502-44574524 GATGGAGGTATGCGTGCAGGAGG + Intergenic
1067802852 10:49371200-49371222 CATGAAGTTGTTTGTGCAGGCGG - Intronic
1068027133 10:51660283-51660305 GATGAAGGTGGCGGTGCTGCCGG - Intronic
1069596445 10:69674900-69674922 GATGGAGGTGTTGTTGCTGGTGG + Intergenic
1069613642 10:69792266-69792288 GATGATGGTGGCGGTGGTGGTGG - Intergenic
1072010625 10:91299903-91299925 GATGGAGGTGATGGTGAAGGTGG - Intergenic
1078360254 11:10662453-10662475 CATGAAGGTGTCAGAGAAGGAGG - Intronic
1078680415 11:13470334-13470356 GAAGAGGGTGTAAGTGCAGGGGG - Intergenic
1080306311 11:30840358-30840380 GATGAGGTTGTCTATGCAGGAGG + Intronic
1082079835 11:48004261-48004283 GATCAAGGTATTGGTGCAAGGGG - Intronic
1084701240 11:70787527-70787549 GATGATGGTGTTGATGCTGGTGG - Intronic
1085472076 11:76764852-76764874 GATGAAGGTTTGCTTGCAGGAGG + Intergenic
1089080634 11:115773593-115773615 GGTGCAGGTGACGGTGCTGGGGG + Intergenic
1089723369 11:120450754-120450776 GATGAAGGTGTGAGTGTTGGGGG + Intronic
1089868311 11:121651108-121651130 GAGGCAGGTGGGGGTGCAGGCGG - Intergenic
1090423049 11:126588877-126588899 GAAGAAGGTGGCGGTGGTGGGGG + Intronic
1091058176 11:132438463-132438485 CAGGAAGGTGTCTGTGGAGGGGG + Intronic
1093521186 12:20051921-20051943 GATGAAGGAGTCAGTGCAGGAGG + Intergenic
1094663581 12:32495752-32495774 GATCAATGTGTGTGTGCAGGAGG - Intronic
1097513608 12:60574456-60574478 TATGCATGTGTGGGTGCAGGAGG + Intergenic
1097990078 12:65824974-65824996 GGTGGAGGTGGCGGTGGAGGTGG - Exonic
1102362140 12:112297155-112297177 GCAGAAGGTGTAGGTGCAGAGGG + Intronic
1102920508 12:116788387-116788409 GATGAATCAGTAGGTGCAGGTGG - Intronic
1104338137 12:127920045-127920067 GATGCAGGAGTGGGTGTAGGTGG + Intergenic
1106156956 13:27168240-27168262 GGAGAAGTTGTTGGTGCAGGAGG - Intronic
1108244088 13:48497936-48497958 GCTGAAGGTGTGCGTGGAGGAGG - Intronic
1109894356 13:68664683-68664705 GATCAAGTTGTCAGTGGAGGTGG + Intergenic
1113639539 13:111947310-111947332 GATGCAGGTGTCTGTGGAGTTGG - Intergenic
1113793110 13:113041180-113041202 GATGAAGGTGATGGTGCCGGAGG - Intronic
1115776645 14:36722517-36722539 GATGCATGTGTCGGGGCATGGGG + Intronic
1118323396 14:64766301-64766323 TGTGTAGGTGTGGGTGCAGGGGG + Intronic
1118941634 14:70344936-70344958 GATGAGCGCGTGGGTGCAGGTGG - Intronic
1122652117 14:103231754-103231776 GACGCAGGTGCCAGTGCAGGAGG + Intergenic
1122815872 14:104313724-104313746 AATTAAGGAGTGGGTGCAGGGGG + Intergenic
1124437902 15:29666251-29666273 GATGAAGGTGGCTGGGGAGGAGG - Intergenic
1124467015 15:29949125-29949147 GGTGAAGGTGGAGGTGGAGGTGG - Intronic
1124467095 15:29949431-29949453 GGTGAAGGTGGAGGTGGAGGTGG - Intronic
1124467228 15:29949905-29949927 GGTGAAGGTGGAGGTGGAGGTGG - Intronic
1124467258 15:29950013-29950035 GGTGAAGGTGGAGGTGGAGGTGG - Intronic
1124954401 15:34350635-34350657 GATGTAGGTGTCAGGGCAGGTGG + Intronic
1126954251 15:53914582-53914604 GCTGCAGGTGTCGGGGCAGCAGG + Intergenic
1129663642 15:77567182-77567204 GTTGATGGGGTGGGTGCAGGAGG + Intergenic
1130987215 15:88852347-88852369 GGTAAGGGTGTCAGTGCAGGAGG - Intronic
1131356170 15:91749132-91749154 GATGAAGATGAAGGTGGAGGTGG + Intergenic
1131356171 15:91749138-91749160 GATGAAGGTGGAGGTGGAAGTGG + Intergenic
1131356200 15:91749264-91749286 GATGGAGGTGGAGGTGGAGGTGG + Intergenic
1131356248 15:91749438-91749460 GATGGAGGTGGAGGTGGAGGTGG + Intergenic
1131356314 15:91749669-91749691 GATGGAGGTGGAGGTGGAGGTGG + Intergenic
1131356398 15:91749972-91749994 GATGGAGGTGGAGGTGAAGGTGG + Intergenic
1131356427 15:91750086-91750108 GATGAAGGTGGAGGTGGAGATGG + Intergenic
1131675593 15:94667323-94667345 GGTGAAGGTGGTGGTGGAGGTGG - Intergenic
1132570103 16:640847-640869 GCTGGGGGTGTCTGTGCAGGGGG - Intronic
1132763608 16:1523569-1523591 GATGAAGAAGTCGGAGCAGCGGG + Exonic
1133181394 16:4057450-4057472 GATGATGGTGTCACTGCAGCCGG - Intronic
1133505505 16:6408320-6408342 GAATAAGGTGTGTGTGCAGGGGG + Intronic
1133747996 16:8701954-8701976 CATGGAGGTGTAGGTGTAGGGGG + Intronic
1134127936 16:11629316-11629338 GATGGAGATGTGGGTGCATGTGG + Intronic
1134570213 16:15284306-15284328 GATGGAGATCTGGGTGCAGGGGG + Intergenic
1134732162 16:16471747-16471769 GATGGAGATCTGGGTGCAGGGGG - Intergenic
1134935275 16:18240216-18240238 GATGGAGATCTGGGTGCAGGGGG + Intergenic
1138520551 16:57568637-57568659 GATGATGGTGGTGGTGAAGGAGG - Intronic
1138520808 16:57569897-57569919 GATGATGGTGATAGTGCAGGTGG - Intronic
1140928580 16:79606324-79606346 GATGAGTATGTCAGTGCAGGTGG + Intergenic
1141196865 16:81866838-81866860 GATGAAGGTGGAGGAGCAGTGGG - Intronic
1141440818 16:84028691-84028713 GGGGAAGGTGGCGGGGCAGGGGG - Intronic
1142006000 16:87689866-87689888 GAGGCAGGTGTCGGTGGACGAGG + Exonic
1142117443 16:88366972-88366994 GATGGAGGTGTCAGTGATGGTGG - Intergenic
1142699256 17:1649484-1649506 GCTGCAGGTGTCGGCGCAGCCGG - Exonic
1143204955 17:5134882-5134904 GATGATGGAGTCGCTCCAGGAGG + Intronic
1143758864 17:9086792-9086814 GATGATGGTGATGGTGCAGGTGG - Intronic
1145302467 17:21650290-21650312 GAGGAAGGTGATGGTGAAGGTGG + Intergenic
1145415747 17:22712400-22712422 GAGGAAGATGACGGTGAAGGTGG + Intergenic
1145760635 17:27423556-27423578 GATGAAGGAGTCGCTCCAGAAGG + Intergenic
1145798401 17:27668739-27668761 GATGAAGGAGTCACTCCAGGAGG - Intergenic
1146160687 17:30557872-30557894 GATGAAGGAGTCGCTCCAGGAGG + Exonic
1146265332 17:31449135-31449157 GCTGAAAGTGTGGGTGCAGGTGG - Intronic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147220171 17:38924011-38924033 GACGAAGGAGTGGGTGGAGGAGG + Intergenic
1148191424 17:45681316-45681338 GATGAGGGTGGAGTTGCAGGAGG - Intergenic
1149627364 17:58089288-58089310 GGTGAAGGTGTCAGTGGCGGCGG + Exonic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1151164067 17:72189241-72189263 GATGGAGGTGTTGGTGTTGGTGG + Intergenic
1151745387 17:76009082-76009104 GGAGAAGGTGGTGGTGCAGGAGG - Exonic
1152097140 17:78278834-78278856 GAGGAAGGTGTCTGGGCTGGTGG - Intergenic
1152471467 17:80492187-80492209 GGTGCAGGTGGTGGTGCAGGTGG + Intergenic
1152471470 17:80492199-80492221 GGTGCAGGTGGCGGTGCAGGTGG + Intergenic
1152471482 17:80492235-80492257 GGTGCAGGTGGCGGGGCAGGTGG + Intergenic
1152471488 17:80492259-80492281 GGTGCAGGTGGCGGTGCAGGTGG + Intergenic
1152471506 17:80492321-80492343 GGTGCAGGTGGCGGTGCATGTGG + Intergenic
1152471536 17:80492408-80492430 GGGGCAGGTGGCGGTGCAGGTGG + Intergenic
1152471545 17:80492441-80492463 GGTGCAGGTGGTGGTGCAGGTGG + Intergenic
1152471557 17:80492477-80492499 GGTGCAGGTGGCGGGGCAGGTGG + Intergenic
1152471560 17:80492489-80492511 GGGGCAGGTGGCGGTGCAGGTGG + Intergenic
1152471563 17:80492501-80492523 GGTGCAGGTGGCGGTGCAGGTGG + Intergenic
1152471574 17:80492537-80492559 GGTGCAGGTGGCGGTGCAGGTGG + Intergenic
1152471594 17:80492598-80492620 GATGCAGGTGGTGGTGCAGGTGG + Intergenic
1152471597 17:80492610-80492632 GGTGCAGGTGGTGGTGCAGGTGG + Intergenic
1152471599 17:80492622-80492644 GGTGCAGGTGGCAGTGCAGGTGG + Intergenic
1154112716 18:11584293-11584315 GATGACGGTTTCGGTGAAGTGGG - Intergenic
1157578056 18:48757009-48757031 GATGAAGGTGTCGGTGGGGTTGG + Intronic
1159085344 18:63783560-63783582 CCTGAAGGTGGCGGTGAAGGTGG - Intronic
1160952286 19:1673576-1673598 GAAGAGGGTGCGGGTGCAGGAGG - Intergenic
1160971329 19:1769027-1769049 GGTGGAGGTGACGGTGGAGGTGG + Intronic
1161152534 19:2717136-2717158 GAGGAGGGTGTCGGTGTTGGGGG + Exonic
1161407899 19:4100762-4100784 GATGAAGGGGAGGGTGCAGCTGG + Intronic
1161495603 19:4584335-4584357 GAAGAAGGTGTCGGTGGCCGCGG - Intergenic
1161921188 19:7267394-7267416 GATGACGGTGGCGGGGCAGTTGG + Exonic
1162139497 19:8577357-8577379 GATGGAGGTGCAGGTTCAGGGGG + Exonic
1163219183 19:15902385-15902407 GATGAAGGAGACACTGCAGGTGG - Intergenic
1165060778 19:33204283-33204305 GGGGAGGGTGTCGGGGCAGGGGG + Intronic
1165570841 19:36773343-36773365 AATGAAGGTGAAGGTGGAGGTGG + Intronic
1166742519 19:45122962-45122984 GAAGAAAGTGCAGGTGCAGGAGG - Intronic
1166811574 19:45517653-45517675 GATGACCGTCTCGCTGCAGGCGG - Exonic
1167082154 19:47283826-47283848 GATGAGTGTGTCTGTGCATGAGG + Intergenic
1167522030 19:49960873-49960895 GAGGCAGGTGCCGGTGCCGGAGG - Exonic
1167523352 19:49969852-49969874 GAGGCAGGTGCCGGTGCCGGAGG + Intergenic
1167721830 19:51184899-51184921 GAGGGAGGTGAGGGTGCAGGAGG + Intergenic
1167785176 19:51630154-51630176 GAAGTCGGTGACGGTGCAGGAGG - Intronic
1167787275 19:51646578-51646600 GAAGTCGGTGACGGTGCAGGAGG - Exonic
925415343 2:3666423-3666445 GATGAAGGGGTGTGTGCAGGGGG + Intronic
927461932 2:23306768-23306790 GATGAAGGAGGGGGTGGAGGTGG + Intergenic
928937968 2:36700387-36700409 GATGATGGTGGCGGTGGTGGTGG + Intronic
929590557 2:43143046-43143068 GAGGGAGGTGTCGGGGCAGTGGG - Intergenic
929595478 2:43172970-43172992 GATGAAGGTATCCTTGCAGATGG + Intergenic
930059108 2:47273695-47273717 GAGGAAGGTGAGGGAGCAGGCGG - Intergenic
931198063 2:60072024-60072046 GATGAAGTTGTTGCTTCAGGTGG - Intergenic
931368033 2:61636406-61636428 GATGAAGGTTTTTGTGCAGGTGG + Intergenic
935312347 2:101797424-101797446 GAGGGAGGGGGCGGTGCAGGAGG - Intronic
936577281 2:113667624-113667646 GATGAGGGTGTAGGTGGGGGTGG + Intergenic
938076297 2:128340472-128340494 GATGATGGTGCTGGTGCTGGTGG + Intergenic
938084041 2:128386487-128386509 GATGAAGGTGTAGGTGAGGCTGG + Intergenic
940997989 2:160171197-160171219 GGTGTAGGTGGGGGTGCAGGGGG - Intronic
947761920 2:232609678-232609700 GCTGAAGGTGAAGGAGCAGGAGG - Intronic
948032378 2:234829438-234829460 GATGAAGGTGAGAATGCAGGAGG - Intergenic
948178215 2:235960431-235960453 GATGAAGGTGTCATTGCACCGGG - Intronic
948505563 2:238425126-238425148 GGTGGAGGTGCAGGTGCAGGAGG + Intergenic
948831721 2:240601558-240601580 GCTGATGGTGTCAGAGCAGGAGG - Intronic
949007550 2:241658297-241658319 GAGGAAGGTGGTGGGGCAGGGGG + Intronic
1168953689 20:1819665-1819687 GAGGCAAGTGCCGGTGCAGGTGG + Intergenic
1169194879 20:3677693-3677715 GAAGCAGGTGTCGGAGCCGGAGG - Intronic
1169925361 20:10777982-10778004 GAGGGAGGTGTCAGTGCATGAGG + Intergenic
1170878868 20:20277271-20277293 GATGCAGGTGATGGTGGAGGCGG - Exonic
1171557859 20:26094678-26094700 GAGGAAGGTGATGGTGAAGGTGG - Intergenic
1172940840 20:38653343-38653365 GATGATGGTGGCGGTGGTGGTGG + Intergenic
1173347501 20:42214439-42214461 GATGAGGGTGATGGGGCAGGAGG - Intronic
1174104480 20:48152709-48152731 GATCAAGGTGTCGGTGGGGTCGG - Intergenic
1174502727 20:50997398-50997420 GATGAGTGTGTCTCTGCAGGAGG - Intergenic
1175390542 20:58624519-58624541 CATGAAGCTGACGGTCCAGGGGG + Intergenic
1176051132 20:63120285-63120307 GATGAACGTGACAGTGCTGGAGG - Intergenic
1176170330 20:63693715-63693737 GGTGGAGGTGGTGGTGCAGGTGG - Intronic
1176235902 20:64053404-64053426 TCTGAAGGTGTGGGTGCAGGGGG + Intronic
1176653186 21:9568002-9568024 GATGACGGTGATGGTGAAGGTGG + Intergenic
1176964820 21:15200408-15200430 GATGAAGGAGTCAGTGCAGAGGG + Intergenic
1180095849 21:45555134-45555156 GACGCAGGGGGCGGTGCAGGGGG + Intergenic
1181517388 22:23422969-23422991 GAGGAGGGTGTGGGCGCAGGGGG - Intergenic
1181911239 22:26239919-26239941 GGTGAAGGTGCGGGTGGAGGGGG - Intronic
1183705703 22:39473860-39473882 GATGGAGGTGTGTGGGCAGGGGG + Intronic
1183721546 22:39565626-39565648 GATGATGGTGTTGGTGGTGGTGG + Intergenic
1183721555 22:39565686-39565708 GATGATGGTGTTGGTGGTGGTGG + Intergenic
1183721606 22:39566010-39566032 GATGATGGTGTTGGTGATGGTGG + Intergenic
1184291517 22:43500111-43500133 GATGAAGGTGGTGATGGAGGTGG + Intronic
1184636131 22:45833269-45833291 GCTGAAGGCGTCGGGGGAGGTGG + Intronic
1184884756 22:47335960-47335982 GATGAAGGTGGAGATGAAGGTGG - Intergenic
1184996333 22:48210030-48210052 GGTGAAGCTGACGGTGCCGGGGG + Intergenic
1185075955 22:48682350-48682372 GATGAAGGGGTTGGGGCAGAAGG + Intronic
1185369742 22:50455549-50455571 GCTGCAGGTGTCTGTGCTGGTGG - Exonic
1185422947 22:50745040-50745062 GATGAGGGTGTAGGTGGGGGTGG - Exonic
950590234 3:13931770-13931792 GATGGAGGTGATGGTGGAGGTGG - Intergenic
950710312 3:14809356-14809378 GATGGAGGTGATGGTGGAGGTGG - Intergenic
951778597 3:26338071-26338093 GCTGAAGGTGAAGGTGAAGGTGG - Intergenic
952590895 3:34952711-34952733 GATGAAGATATTGATGCAGGTGG + Intergenic
953069581 3:39505957-39505979 GATGAACGTGTGGGGGCTGGTGG - Intronic
953151608 3:40330167-40330189 GATGAGGGTTTCAGTGCATGTGG - Intergenic
953684339 3:45064608-45064630 GAGGAAGGTGTCCGTGGGGGAGG + Intergenic
956736769 3:72244426-72244448 GATGATTCAGTCGGTGCAGGTGG - Intergenic
957127152 3:76176224-76176246 TGTGAAGGTGGCGGTGGAGGTGG - Intronic
957158687 3:76580039-76580061 GAAGAAGGTAACGGAGCAGGTGG + Intronic
957582312 3:82090097-82090119 CATGAAGGTGTCTGTGTAAGAGG - Intergenic
957937988 3:86968794-86968816 GATGATGGTGGCGGTGGCGGTGG + Exonic
958779383 3:98522856-98522878 GGTGAAGCTGGCGGAGCAGGAGG - Intronic
960438626 3:117658879-117658901 GAAGAAAGTGATGGTGCAGGTGG - Intergenic
960844811 3:121995613-121995635 CATGAAGGTGTAGCTGCTGGGGG - Intronic
961366496 3:126402887-126402909 GATGATGGTGAGGGTGCAGGTGG + Intronic
961660427 3:128465884-128465906 GATGAAGGTGAAGGTGGTGGAGG + Exonic
962258958 3:133891077-133891099 GATGAAGGGCTCCCTGCAGGAGG + Intronic
964004464 3:151811558-151811580 GGTGAAGGAGTAGGTACAGGGGG - Intergenic
964689805 3:159437589-159437611 GAGGAAGGAGACGGTGGAGGGGG + Intronic
965079773 3:164021159-164021181 GGTGAAGGAGTAGGTACAGGGGG + Intergenic
966055119 3:175677615-175677637 GATGAAGGAGTCCCTGGAGGGGG - Intronic
968523623 4:1045668-1045690 GATGGGGGTGTGGGTGGAGGGGG + Intergenic
968834108 4:2950116-2950138 GAAGAAGGTGACAGTTCAGGCGG - Exonic
968965491 4:3767244-3767266 GAAGAAGGAGCCGATGCAGGAGG - Exonic
969491797 4:7503645-7503667 GATGGAGGTGGGGGTGCAGATGG + Intronic
969709031 4:8832097-8832119 GATGCAGGCCTGGGTGCAGGAGG - Intergenic
972026162 4:34381137-34381159 GATGAAGCTGTCGGTACTTGTGG + Intergenic
972360543 4:38322130-38322152 GATGATGGTGGAGGTGGAGGTGG + Intergenic
974656087 4:64824467-64824489 GCTGAAGGTGTGGGTGGATGTGG + Intergenic
975202467 4:71607744-71607766 GAGGAGGGTGTCTGTGTAGGAGG - Intergenic
976208088 4:82640819-82640841 GAGGAAGGAGTAGGTGCAAGAGG - Intronic
979105741 4:116684579-116684601 GATGAAGGTGTAGATGCAGGAGG + Intergenic
980964223 4:139504996-139505018 TGTGAATGTGTCTGTGCAGGTGG + Intronic
981546783 4:145902249-145902271 GGTGGAGGTGGCGGTGGAGGTGG + Exonic
981689505 4:147491561-147491583 GATGAAGGTGGGGGTGGTGGTGG + Intronic
981716342 4:147756298-147756320 GAGGAAGGTGTGGGTGGTGGGGG + Intronic
982010507 4:151101435-151101457 GAGGAACGTTTAGGTGCAGGTGG + Intronic
982042623 4:151410123-151410145 GAGCGAGGTGTTGGTGCAGGCGG + Intronic
982278798 4:153663280-153663302 GATGAAGGTGGTGGTGATGGTGG + Intergenic
983289732 4:165786641-165786663 GATGAAGGTGTCAGTACAACGGG + Intergenic
985147673 4:186910569-186910591 GATTAAGGTGTCAGTGCTGGAGG + Intergenic
986400007 5:7371364-7371386 AATGAAGGTGATGGTGGAGGTGG - Intergenic
987016017 5:13820359-13820381 CATCAAGGTGTGGATGCAGGTGG + Exonic
987385708 5:17327291-17327313 GCTGAAGGTGTCAGCGGAGGCGG + Intergenic
993638927 5:90379560-90379582 TGTGAAGGTGGAGGTGCAGGAGG - Intergenic
993874324 5:93288674-93288696 GATGAAGGTTTCAGTGCAGTTGG + Intergenic
998299154 5:141001635-141001657 GGTGAAGGTGTGGGAGAAGGCGG + Intronic
998422795 5:142003063-142003085 GAGGGAGGTGTGGGTCCAGGAGG - Intronic
1001688774 5:173616513-173616535 GGTGAAGGGGGCGGTGAAGGAGG + Exonic
1002048193 5:176553770-176553792 GATGAAGGTGGAGACGCAGGTGG - Intronic
1002371161 5:178756004-178756026 GATGAAGGTGATGGTGATGGTGG + Intergenic
1003995843 6:11538307-11538329 GATCAACCTGTCGGTGCAGCAGG + Exonic
1006306873 6:33227771-33227793 AATGATGGTGGCTGTGCAGGTGG + Intergenic
1006505729 6:34487507-34487529 GCTGAAGGTTTGGATGCAGGAGG + Intronic
1006551956 6:34831743-34831765 GACAAAGGTGACAGTGCAGGGGG - Intronic
1007275585 6:40671225-40671247 GCTGAAGGTGTGGGAGCAGCAGG - Intergenic
1007312411 6:40957019-40957041 GATGAATGTGGTGGGGCAGGGGG - Intergenic
1007345566 6:41227234-41227256 GATCAAGGTGTCAGTGGATGTGG + Intergenic
1009305421 6:62083443-62083465 GACCCAGGTGTGGGTGCAGGAGG + Intronic
1012099853 6:95018838-95018860 GATGAAAGTGTCGCTGTAAGAGG - Intergenic
1014008464 6:116448998-116449020 TATGAATGTGTGGGAGCAGGAGG - Intergenic
1018443238 6:163832764-163832786 AATCAAGGTGTCAGTGCAGCGGG + Intergenic
1019121569 6:169808798-169808820 GTTGAGGGTGTCAGTGCTGGAGG - Intergenic
1019212800 6:170420053-170420075 GATGGTGGTGTCGGTGCTGGAGG + Intergenic
1019298707 7:292027-292049 GATGATGGTGTCCGTGCTAGCGG + Intergenic
1019369616 7:654591-654613 GATGATGGTGATGGTGAAGGTGG - Intronic
1021897350 7:25249713-25249735 GTGGAAGGTGGCGGTGGAGGAGG + Intergenic
1022317878 7:29262770-29262792 GGTGAAGATGGGGGTGCAGGGGG + Intronic
1023254921 7:38303708-38303730 GATGGAGGTGAAGGTGGAGGTGG + Intergenic
1023254923 7:38303714-38303736 GGTGAAGGTGGAGGTGGAGGCGG + Intergenic
1023872144 7:44269002-44269024 GATGAGGGTGGCGTGGCAGGAGG - Intronic
1024047272 7:45593230-45593252 GATGAATGTGACCGTGCAGGTGG + Intronic
1024232446 7:47373020-47373042 CACGGAGGTGTAGGTGCAGGGGG - Intronic
1024461038 7:49659626-49659648 GATGTAGATGTAGGTGTAGGTGG - Intergenic
1024569647 7:50713394-50713416 GATGGAGGTGGCGGTGGAGGAGG - Intronic
1025228508 7:57183090-57183112 GGTGGAGGTGGAGGTGCAGGTGG - Intergenic
1025279541 7:57616763-57616785 GAGGAAGGTGATGGTGAAGGTGG + Intergenic
1025282238 7:57636467-57636489 GAGGATGGTGACGGTGAAGGTGG + Intergenic
1025302492 7:57829052-57829074 GAGGATGGTGACGGTGAAGGTGG - Intergenic
1025305190 7:57848737-57848759 GAGGAAGGTGATGGTGAAGGTGG - Intergenic
1026952565 7:74357254-74357276 CAGGAAGGTGTGGATGCAGGCGG - Intronic
1029170226 7:98625174-98625196 GGGGAGGGTGGCGGTGCAGGCGG - Intronic
1029519232 7:101049565-101049587 GATGAAGGTGTGGGTGGGTGTGG + Intronic
1032322897 7:130900612-130900634 CAGGAATGTGTGGGTGCAGGGGG - Intergenic
1032472011 7:132185387-132185409 GATGAAGGTGTCGGTGCAGGTGG - Exonic
1033610660 7:142961013-142961035 GCTGAAGAAGTCGGTGCAGGGGG + Exonic
1033663494 7:143420044-143420066 GCGGAAGGTGTCGGTGCTGCTGG - Intergenic
1033810015 7:145001647-145001669 CATGCAGGTGTCGGTGGTGGTGG + Intergenic
1034275511 7:149822135-149822157 GAGGAAGGTGCTGTTGCAGGTGG - Intergenic
1034679096 7:152914925-152914947 GATGATGGTGTTGGTGATGGTGG - Intergenic
1034679101 7:152914952-152914974 GATGATGGTGTTGGTGATGGTGG - Intergenic
1034679106 7:152914979-152915001 GATGATGGTGTTGGTGATGGTGG - Intergenic
1035035494 7:155891624-155891646 GATGAATGTGGTGGTGGAGGAGG + Intergenic
1035035529 7:155891769-155891791 GATGGAGGTGGAGGTGGAGGTGG + Intergenic
1035035577 7:155891981-155892003 GGTGAAGGTGGTGGTGGAGGTGG + Intergenic
1035035722 7:155892648-155892670 GGTGAAGGTGGTGGTGGAGGTGG + Intergenic
1035035753 7:155892782-155892804 GGTGAAGGTGGTGGTGGAGGTGG + Intergenic
1035227007 7:157439258-157439280 GATGGAGGTGATGGTGAAGGAGG - Intergenic
1035340166 7:158155436-158155458 GATGATGGTGTTGGTGATGGTGG - Intronic
1035405435 7:158594083-158594105 GTTGAAGGTGTCAGTGTTGGTGG + Intergenic
1035661888 8:1354572-1354594 GATGATGCTGTGGGTGAAGGTGG + Intergenic
1036592811 8:10184173-10184195 GTTGATGGTGTTGGTGGAGGTGG + Intronic
1038370960 8:26989879-26989901 GATGCAGCTGTGGGTGCAGAAGG - Intergenic
1038685862 8:29717909-29717931 AAGGAAGGGGTGGGTGCAGGAGG + Intergenic
1040549734 8:48428924-48428946 GATGGAGTTGTGGGGGCAGGGGG - Intergenic
1041555234 8:59146724-59146746 GCTGAAGTTGGCTGTGCAGGTGG + Intergenic
1042611757 8:70608032-70608054 GCTGGAGGTGGCGGGGCAGGCGG + Intronic
1042696468 8:71558556-71558578 CAGGAAGGTGACTGTGCAGGAGG + Intronic
1042821749 8:72937154-72937176 GGTGAAGCTGTCGATGCTGGAGG - Exonic
1048192543 8:132302861-132302883 GATGTATGTGTCTGTCCAGGAGG + Intronic
1048744939 8:137603923-137603945 GATGAATGGGACGGTGCCGGTGG + Intergenic
1049381904 8:142320380-142320402 GGTGAAGTTGCAGGTGCAGGAGG - Intronic
1049381930 8:142320483-142320505 GGTGAAGTTGGAGGTGCAGGAGG - Intronic
1051123192 9:13774297-13774319 GATGAGGCTGTTGGTGCATGTGG - Intergenic
1055035610 9:71815218-71815240 AATGAAAGTGTCGGGGCAGTTGG - Intronic
1056067666 9:82953733-82953755 GGTGAAGGGGTGGGTGCAGGTGG + Intergenic
1056697263 9:88870586-88870608 GAAGGAGGTGCAGGTGCAGGTGG - Intergenic
1057274911 9:93671046-93671068 GGTGCAGGTGTAGATGCAGGTGG + Intronic
1057275264 9:93673001-93673023 GATGCAGGTGTGGGTAAAGGTGG + Intronic
1057516588 9:95727156-95727178 GATGCTGCTGTTGGTGCAGGAGG + Intergenic
1058438349 9:104985033-104985055 GTTGATGGGGTGGGTGCAGGAGG + Intergenic
1059582011 9:115559923-115559945 TATGAATGTGTGGGGGCAGGAGG + Intergenic
1059755820 9:117292375-117292397 GATGAAAGTGTCATTGCAAGGGG + Intronic
1060015067 9:120079929-120079951 GATGATGGTGGCGGTGGTGGTGG + Intergenic
1060389608 9:123267668-123267690 GAGGAGGGGGTCGGGGCAGGGGG - Intronic
1061940340 9:133880523-133880545 GAAGAAGGGGTGGGTGCGGGGGG + Intronic
1062634105 9:137480930-137480952 GAGGAAGGAGTCGGGGCTGGCGG + Intronic
1203630917 Un_KI270750v1:71542-71564 GATGACGGTGATGGTGAAGGTGG + Intergenic
1185466733 X:359213-359235 GATGAAGGTGTCCCAGCAGACGG + Intronic
1186496239 X:10014885-10014907 GAGGAAGGTGGCGGAGCGGGAGG + Intergenic
1186510269 X:10125259-10125281 GGTGAAGGTGCCGGTGCTGGTGG + Intronic
1189446515 X:41085740-41085762 GGTGAAGCCGTCGCTGCAGGAGG + Exonic
1189876962 X:45446518-45446540 GGGGAAGGTGGAGGTGCAGGTGG + Intergenic
1190262087 X:48803728-48803750 GATGATGGTGGCAGTGGAGGTGG - Intronic
1191779075 X:64847455-64847477 GATGAAGGAGTAGGTAGAGGGGG - Intergenic
1193635356 X:83943712-83943734 TATGCAGGTGTGGGTGCTGGTGG + Intergenic
1193716061 X:84935752-84935774 GATGAAGGTGTGGGGGCTGTCGG - Intergenic
1201743106 Y:17344286-17344308 GGTGAAGGAGTAGGTACAGGGGG + Intergenic