ID: 1032472138

View in Genome Browser
Species Human (GRCh38)
Location 7:132186238-132186260
Sequence GGGGCTGCACAGTAGGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032472126_1032472138 13 Left 1032472126 7:132186202-132186224 CCCCTAGGCTCCAGTTCATGACA 0: 1
1: 0
2: 0
3: 3
4: 120
Right 1032472138 7:132186238-132186260 GGGGCTGCACAGTAGGACCAGGG No data
1032472130_1032472138 3 Left 1032472130 7:132186212-132186234 CCAGTTCATGACAGGTGTGCCCT 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1032472138 7:132186238-132186260 GGGGCTGCACAGTAGGACCAGGG No data
1032472125_1032472138 14 Left 1032472125 7:132186201-132186223 CCCCCTAGGCTCCAGTTCATGAC 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1032472138 7:132186238-132186260 GGGGCTGCACAGTAGGACCAGGG No data
1032472121_1032472138 29 Left 1032472121 7:132186186-132186208 CCTGCCTTGCTCCTACCCCCTAG 0: 1
1: 0
2: 3
3: 15
4: 278
Right 1032472138 7:132186238-132186260 GGGGCTGCACAGTAGGACCAGGG No data
1032472123_1032472138 25 Left 1032472123 7:132186190-132186212 CCTTGCTCCTACCCCCTAGGCTC 0: 1
1: 0
2: 2
3: 27
4: 286
Right 1032472138 7:132186238-132186260 GGGGCTGCACAGTAGGACCAGGG No data
1032472127_1032472138 12 Left 1032472127 7:132186203-132186225 CCCTAGGCTCCAGTTCATGACAG 0: 1
1: 0
2: 4
3: 5
4: 107
Right 1032472138 7:132186238-132186260 GGGGCTGCACAGTAGGACCAGGG No data
1032472124_1032472138 18 Left 1032472124 7:132186197-132186219 CCTACCCCCTAGGCTCCAGTTCA 0: 1
1: 0
2: 0
3: 10
4: 233
Right 1032472138 7:132186238-132186260 GGGGCTGCACAGTAGGACCAGGG No data
1032472128_1032472138 11 Left 1032472128 7:132186204-132186226 CCTAGGCTCCAGTTCATGACAGG 0: 1
1: 0
2: 4
3: 6
4: 135
Right 1032472138 7:132186238-132186260 GGGGCTGCACAGTAGGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032472138 Original CRISPR GGGGCTGCACAGTAGGACCA GGG Intronic
No off target data available for this crispr