ID: 1032472197

View in Genome Browser
Species Human (GRCh38)
Location 7:132186544-132186566
Sequence AAGAGCACGTCCACTTTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032472193_1032472197 -8 Left 1032472193 7:132186529-132186551 CCAAATCCTCTCCCAAAGAGCAC 0: 1
1: 0
2: 3
3: 43
4: 473
Right 1032472197 7:132186544-132186566 AAGAGCACGTCCACTTTGTTAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1032472191_1032472197 3 Left 1032472191 7:132186518-132186540 CCAGACTGAGCCCAAATCCTCTC 0: 1
1: 0
2: 3
3: 17
4: 163
Right 1032472197 7:132186544-132186566 AAGAGCACGTCCACTTTGTTAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1032472189_1032472197 29 Left 1032472189 7:132186492-132186514 CCAGGGAAGGGAGGGCTGACAGG 0: 1
1: 0
2: 2
3: 61
4: 512
Right 1032472197 7:132186544-132186566 AAGAGCACGTCCACTTTGTTAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1032472192_1032472197 -7 Left 1032472192 7:132186528-132186550 CCCAAATCCTCTCCCAAAGAGCA 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1032472197 7:132186544-132186566 AAGAGCACGTCCACTTTGTTAGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032472197 Original CRISPR AAGAGCACGTCCACTTTGTT AGG Intronic
902199491 1:14823006-14823028 AAGAGAACCTCCATTTTCTTTGG - Intronic
904171667 1:28595609-28595631 AAAAGCACAGCCACTTTGCTGGG + Intronic
906212541 1:44020111-44020133 AAGAGCACCTCCACTGTACTAGG + Intronic
908923362 1:69223240-69223262 ATGAGCACATGCACTTTTTTAGG + Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
910633668 1:89383510-89383532 AAGAGCCCGCACACTTTGTAGGG + Intronic
910824994 1:91397369-91397391 AAGAACAAGTCAACTTTGATGGG - Intronic
1067656962 10:48200956-48200978 AAGAGGACGTGCACTTTTTAAGG + Intronic
1068866754 10:61903125-61903147 AGGAGGACGTCCACTTTGCGTGG - Intronic
1069551063 10:69364655-69364677 AGGAGTACGAGCACTTTGTTTGG + Intronic
1084847216 11:71910260-71910282 AATAACCCGTCCACATTGTTGGG + Intronic
1087268036 11:96082486-96082508 AACATCCTGTCCACTTTGTTAGG - Intronic
1087405900 11:97730088-97730110 AAGAGCACGTGCATTTGATTTGG + Intergenic
1118501675 14:66367990-66368012 CAGGGCACCTCCACTTAGTTAGG + Intergenic
1119034906 14:71221327-71221349 CACAGCACCTCCTCTTTGTTAGG - Intergenic
1120762586 14:88298867-88298889 AAGAGCAAGTCTCCGTTGTTTGG - Intronic
1121207271 14:92179893-92179915 AAGAACATGTACACTTTCTTTGG + Intergenic
1122307960 14:100777337-100777359 AAAATCAGGACCACTTTGTTGGG - Intergenic
1122314103 14:100815598-100815620 AAGAGCACGTCCACCTGGAATGG - Intergenic
1130771682 15:86930419-86930441 AAGAGGAGGTCCATTCTGTTGGG + Intronic
1135740219 16:24968789-24968811 ATGAGCACGTGCTCGTTGTTGGG - Intronic
1136395317 16:29989287-29989309 AAGAGCACGTGCACGGAGTTGGG - Intronic
1141495350 16:84405989-84406011 ATAAGCACGTCCACTGTATTGGG - Intronic
1148814582 17:50318430-50318452 CAGAGCACGTCCGCTCTGTCAGG + Intergenic
1151031896 17:70750366-70750388 AAGAGCAGATGCACTTTGTCGGG + Intergenic
1156039753 18:32807286-32807308 AACAGCAAGTCCACTTTACTTGG - Intergenic
1156569042 18:38231876-38231898 AAGAGCAAGGACACTTTGATGGG - Intergenic
1157537683 18:48472017-48472039 AAGGGAACATCCACATTGTTGGG + Intergenic
1158977423 18:62724078-62724100 AAGAGGAGGTCTGCTTTGTTTGG - Intronic
925619235 2:5774660-5774682 AAGAGCAGTTTCACTTTCTTTGG - Intergenic
937200626 2:120202273-120202295 AAGAGCAAGTGCACTTTGAGAGG + Intergenic
1172081241 20:32342521-32342543 AAGGGCACAGCCACTTTGTTTGG - Intergenic
950652903 3:14418650-14418672 AAGAGCACACCCACTTCTTTGGG - Intronic
952356484 3:32589680-32589702 AATAGAACCTCCACTTTATTTGG - Intergenic
959716554 3:109439921-109439943 AAGAACACCTCTATTTTGTTTGG + Intergenic
971505428 4:27361310-27361332 AAGACAATGTCCACTTTTTTAGG - Intergenic
973304009 4:48623405-48623427 ATGAGCACAACCACTTTCTTTGG - Intronic
973660961 4:53105814-53105836 CAGAGCACGAGCACTGTGTTAGG - Intronic
975648634 4:76569868-76569890 AAGAGCATGTCCACTCCCTTAGG - Intronic
984488604 4:180403153-180403175 CAGAGCACATCCAGTTTGTCTGG - Intergenic
990508162 5:56465563-56465585 AAGAGCAGGTCCACTGGGTGAGG - Intronic
991676800 5:69096123-69096145 AAGAGAATGTCCACGTTCTTGGG + Intronic
996433767 5:123411240-123411262 AATAGCACGGCCACTTTGGAAGG + Intronic
998739990 5:145189672-145189694 AAGAGCACATTCACTTTAATAGG - Intergenic
1000718938 5:164681602-164681624 AAAAGCACTTCCACATTTTTAGG + Intergenic
1005886567 6:30102017-30102039 AAGCGGACGCCCACTTTGTTCGG + Intergenic
1011988209 6:93476805-93476827 AAGAGAACTTCTACTTTATTTGG - Intergenic
1013153971 6:107475585-107475607 AAGAGCACGTACATTTTTCTGGG - Intergenic
1019384816 7:748636-748658 AGGAGCACCTCCACTGTGGTAGG - Intronic
1020681807 7:11246044-11246066 AAGAAAACGTACACGTTGTTGGG - Intergenic
1024084422 7:45881661-45881683 AAGAGCACCTGCCCTATGTTTGG + Intergenic
1031306381 7:120131784-120131806 AAGAGAGAGTCCATTTTGTTTGG + Intergenic
1032472197 7:132186544-132186566 AAGAGCACGTCCACTTTGTTAGG + Intronic
1034089179 7:148348231-148348253 AAAAGCACGTCCAGGTTGTCTGG - Intronic
1034102651 7:148464152-148464174 AAGAGCACTTTCAGTTTATTAGG - Intergenic
1035047605 7:155979517-155979539 AGAAGCACTTCCACTTTGCTGGG - Intergenic
1037148769 8:15608923-15608945 AAGAGCAAGTCAAGTTTTTTGGG - Intronic
1043994075 8:86791024-86791046 AAGAGTACTTCCACTTCTTTGGG - Intergenic
1044181216 8:89197655-89197677 AAGACCACTACCACTTTGTTGGG - Intergenic
1050120075 9:2298985-2299007 AAGAGCACTCCCATATTGTTAGG - Intergenic
1057692884 9:97302176-97302198 AAGAGCACTAACAATTTGTTTGG - Intergenic
1060164180 9:121395449-121395471 AAGGGGAAGTCCATTTTGTTGGG + Intergenic
1186186454 X:7025211-7025233 CAGAGCACGTCCTCTTCTTTCGG + Intergenic
1187892873 X:23953611-23953633 CAGAGAATGTCAACTTTGTTAGG + Intergenic
1196189938 X:112783579-112783601 AAGAGAACAGTCACTTTGTTGGG - Intronic
1199447462 X:147942370-147942392 AAAAGCACTTCCAGTATGTTGGG - Intronic
1199883168 X:151992716-151992738 AAGAGAACATCCACTCTTTTAGG - Intergenic
1199986437 X:152955521-152955543 ATGAGCAACTCCATTTTGTTTGG + Intronic