ID: 1032473749

View in Genome Browser
Species Human (GRCh38)
Location 7:132198449-132198471
Sequence CATGCAACACAGGAGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 308}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032473749_1032473755 22 Left 1032473749 7:132198449-132198471 CCCTGTTCCTCCTGTGTTGCATG 0: 1
1: 0
2: 1
3: 32
4: 308
Right 1032473755 7:132198494-132198516 GGGATGTAACCATCCACTAAAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1032473749_1032473753 1 Left 1032473749 7:132198449-132198471 CCCTGTTCCTCCTGTGTTGCATG 0: 1
1: 0
2: 1
3: 32
4: 308
Right 1032473753 7:132198473-132198495 AGCTTCACTTACTGTTCTGCAGG 0: 1
1: 0
2: 0
3: 13
4: 185
1032473749_1032473754 2 Left 1032473749 7:132198449-132198471 CCCTGTTCCTCCTGTGTTGCATG 0: 1
1: 0
2: 1
3: 32
4: 308
Right 1032473754 7:132198474-132198496 GCTTCACTTACTGTTCTGCAGGG 0: 1
1: 0
2: 2
3: 29
4: 364
1032473749_1032473756 23 Left 1032473749 7:132198449-132198471 CCCTGTTCCTCCTGTGTTGCATG 0: 1
1: 0
2: 1
3: 32
4: 308
Right 1032473756 7:132198495-132198517 GGATGTAACCATCCACTAAAGGG 0: 1
1: 0
2: 0
3: 3
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032473749 Original CRISPR CATGCAACACAGGAGGAACA GGG (reversed) Intronic
902640751 1:17764751-17764773 CAGGCAACGCTGGAGGAACGCGG - Intronic
902735679 1:18399197-18399219 CCAGGAACACAGGAGGATCAGGG + Intergenic
905320192 1:37110617-37110639 CATGATACACAAGAGGACCATGG - Intergenic
905536119 1:38723199-38723221 CATCCAGCACAGGAGAAAGATGG + Intergenic
906924943 1:50105333-50105355 CATTCAGCAAAGGATGAACAAGG - Intronic
910333752 1:86105257-86105279 CATGCAAAACCGGTGGAACAAGG + Intronic
910741019 1:90516568-90516590 GATGCAACACAGAAAGAACAGGG + Intergenic
914372537 1:147041535-147041557 CATGCCTCACAGAAGGAAAATGG + Intergenic
915850110 1:159312683-159312705 CATTCAACACAAGAGTAAAAAGG - Intergenic
916015987 1:160750328-160750350 CAGGAGACACAGGAGGACCATGG - Exonic
916218535 1:162420102-162420124 CATTCTCCACAGGAGGAACCTGG + Intergenic
918157807 1:181867004-181867026 CAGACAAAACAAGAGGAACAGGG + Intergenic
918711997 1:187742649-187742671 CATCCAGCACAGGAGAAAGATGG - Intergenic
918815413 1:189174167-189174189 CATCCAACACAAGAGAAAGATGG - Intergenic
919318288 1:196001967-196001989 CATCCAGCACAGGAGAAAGATGG - Intergenic
919355716 1:196518750-196518772 CAACCAACACAGGAGCAACCAGG + Intronic
919600631 1:199618044-199618066 CATGGAACACAGGCTGTACAGGG + Intergenic
920101621 1:203520439-203520461 CATGCCCCACAGGAGAGACAGGG + Intergenic
921815867 1:219562715-219562737 CATGCATCATAGAAGGAACTGGG + Intergenic
923190735 1:231618021-231618043 TGTGTAACACATGAGGAACATGG + Intronic
923416966 1:233772275-233772297 CATCCAGCACAGGAGAAAGATGG + Intergenic
1063039770 10:2325274-2325296 CATCCAGCACAGGAGAAAGATGG - Intergenic
1063404116 10:5776248-5776270 CATCCAAGACAGGTGGAAAAGGG + Intronic
1064422805 10:15204921-15204943 CATGGAACACAGGTCGTACAGGG + Intergenic
1065155856 10:22869534-22869556 CATCCAGCACAGGAGAAAGATGG - Intergenic
1065867994 10:29930245-29930267 CATCCAGCATAGGAGAAACATGG + Intergenic
1067169411 10:43894209-43894231 CATCCAGCACAGGAGAAAGATGG + Intergenic
1068521231 10:58079885-58079907 CATGGAACCCAGGCGGTACAGGG + Intergenic
1075423557 10:122324439-122324461 CATGAATCACAAGAGGCACATGG - Intronic
1076853578 10:133104679-133104701 CAAGGAACACAGCTGGAACACGG - Intronic
1076987209 11:246863-246885 CAAGCAACACAGTAGAAAAATGG - Intronic
1078362206 11:10677778-10677800 CCTGCCAGAAAGGAGGAACAGGG - Intronic
1078376821 11:10802342-10802364 CATGCCACCCAGGATGAAAATGG - Exonic
1078463729 11:11534911-11534933 CCTGCAGCACGGGAGGAAAACGG + Intronic
1078861897 11:15256230-15256252 CATGCATGACTTGAGGAACAAGG + Intergenic
1079334402 11:19558729-19558751 CATGGAACACAGGCTGTACAGGG - Intronic
1079537130 11:21527801-21527823 CATCCAGCACAGGAGAAAGATGG + Intronic
1080151432 11:29056747-29056769 CATGCACAACAGGAGGAGCTGGG - Intergenic
1080407985 11:31996952-31996974 CATCCAGCACAGGAGAAAGATGG + Intronic
1080755240 11:35191025-35191047 AATCCTCCACAGGAGGAACATGG - Intronic
1080848385 11:36046237-36046259 CATGCAACAGAGCTGGTACAGGG - Intronic
1081536733 11:44002158-44002180 CACGTAACACAGGAGGAAGGAGG - Intergenic
1081776016 11:45676419-45676441 CATTCAGCACAGGAGAAAGATGG - Intergenic
1082757139 11:57088618-57088640 CATGCAGCAAAGGAAGAAGAGGG + Intergenic
1082918841 11:58469701-58469723 CATCCAGCACAGGAGAAAGATGG + Intergenic
1082919682 11:58479587-58479609 CATCCAGCACAGGAGAAAGATGG + Intergenic
1084434760 11:69132257-69132279 CGTGCAACACAGGTGCACCAGGG - Intergenic
1085383097 11:76138533-76138555 CTTGCCGCACAAGAGGAACAGGG - Intronic
1086907545 11:92434681-92434703 CATGCCACAGAGGAGGAAATGGG - Intronic
1086907596 11:92435151-92435173 CATGGAACACAGGCTGCACAGGG - Intronic
1087286592 11:96270989-96271011 CATCCAGCACAGGAGAAAGATGG - Intronic
1090965808 11:131596956-131596978 CATCCAGCACAGGAGAAAGATGG + Intronic
1092064510 12:5578647-5578669 TATGTGACACAGGAGGAAAAGGG - Intronic
1096923930 12:55120965-55120987 CATCCAGCACAGGAGAAAGATGG + Intergenic
1097346734 12:58501621-58501643 CATCCAGCACAGGAGAAAGATGG - Intergenic
1097527692 12:60758984-60759006 CATGTAACATAGCTGGAACATGG - Intergenic
1098307246 12:69114556-69114578 CATCCAGCACAGGAGAAAGATGG - Intergenic
1099368427 12:81798765-81798787 CCTGGAACAAAGGAAGAACAGGG + Intergenic
1100715276 12:97299191-97299213 CATTCAGCACAGGAGAAAGATGG + Intergenic
1100915207 12:99412528-99412550 CATCCAACACTGGTGGAAGAGGG - Intronic
1101258733 12:103007097-103007119 CATCCAGCACAGGAGAAAGATGG + Intergenic
1101362630 12:104042260-104042282 CATGCAAGGCAGGAGGAAGGGGG - Intronic
1103376205 12:120457986-120458008 CATTCAAAGCAGGAGGAGCATGG + Intronic
1104700329 12:130898236-130898258 CATCCAGCACAGGAGAAAGAAGG + Intergenic
1106289127 13:28344246-28344268 CGTGGAGAACAGGAGGAACAAGG - Intronic
1107581249 13:41789142-41789164 CATCCAACAAATGAGGAAAATGG + Intronic
1108067597 13:46594199-46594221 CAGGCAAAACAGTAAGAACATGG - Intronic
1108150656 13:47530594-47530616 CATAAAATACAGGAGGAAAATGG + Intergenic
1108455114 13:50605395-50605417 CATGCTAAACAGCAGGTACAAGG - Intronic
1109171066 13:59097551-59097573 CATCCAGCACAGGAGAAAGATGG - Intergenic
1109860455 13:68191138-68191160 CATACAGCACAGGAGAAAGATGG - Intergenic
1110010911 13:70332148-70332170 CATCCATCACAGGAGAAAGAAGG - Intergenic
1110084714 13:71363922-71363944 CATCCAGCACAGGAGAAAGATGG + Intergenic
1110409740 13:75191210-75191232 CATCCAGCACAGGAGAAAGATGG - Intergenic
1111182415 13:84686591-84686613 CATCCAGCACAGGAGAAAGAAGG - Intergenic
1111571468 13:90092880-90092902 CATTCAGCACAGGAGAAAGATGG + Intergenic
1111880133 13:93945555-93945577 TTTGCAACTCAGGAGGAACCAGG - Intronic
1113096224 13:106666818-106666840 CATCCAGCACAGGAGAAAGATGG + Intergenic
1113211583 13:107988791-107988813 CACCCAACACAGGAGCACCAAGG - Intergenic
1113537618 13:111080816-111080838 CTTGCAGGGCAGGAGGAACAAGG - Intergenic
1114879041 14:26760972-26760994 AATCCAACACAGGAGAAAGAAGG - Intergenic
1115068422 14:29293984-29294006 CATCCAGCACAGGAGAAAGATGG + Intergenic
1116531905 14:45981772-45981794 CATCCAGGACAGGAGGAAGATGG + Intergenic
1119554289 14:75541507-75541529 CATGCAGCCCAGGAGGCAGATGG + Intronic
1119615957 14:76099366-76099388 CACTCAACACAGGTAGAACAAGG + Intergenic
1119727775 14:76932570-76932592 CCTGGAACACAGTAGGTACAGGG + Intergenic
1120655900 14:87189620-87189642 CATCCAGCACAGGAGAAAGATGG - Intergenic
1121862194 14:97329098-97329120 CATGCTACTCAGGGGGAAAAGGG - Intergenic
1122136482 14:99635727-99635749 CCTGCAGCTCAGGAGGGACATGG + Intergenic
1122459595 14:101884167-101884189 CATCCAGCACAGGAGAAAGATGG + Intronic
1126420269 15:48465085-48465107 CCAGTAACACAGGATGAACAAGG + Intronic
1126490276 15:49229459-49229481 CATGCAACACCTGTGGCACAGGG - Intronic
1130066387 15:80608421-80608443 CATCCAGCACGGGAGAAACATGG - Intergenic
1130797788 15:87229003-87229025 CATGCAAGACAGGAGGGAAAAGG + Intergenic
1131136025 15:89936382-89936404 CAGGCATCACAGTAGGAACAAGG + Intergenic
1131701275 15:94938709-94938731 CATCCAGCACAGGAGAAAGATGG + Intergenic
1131986628 15:98048683-98048705 CATCCAGCACAGGAGAAAGATGG - Intergenic
1133017653 16:2951668-2951690 CATGCAGCACAGGTGGCAGAGGG + Intergenic
1133634084 16:7649846-7649868 CATGAACCAGGGGAGGAACAGGG + Intronic
1135934093 16:26764543-26764565 CATCCAGCACAGGAGAAAGAGGG + Intergenic
1136677773 16:31928473-31928495 CATGCATCACAGGAGCACCCAGG + Intergenic
1137022411 16:35441800-35441822 CAAGCAATATAGGAGGGACAAGG + Intergenic
1138957339 16:61987053-61987075 TATGCTACACAGGAGGAAGATGG + Intronic
1141429311 16:83962982-83963004 GATGCACCCCAGGAGGAGCAGGG - Intronic
1141547622 16:84781841-84781863 CATCCAGCACAGGAGAAAGATGG - Intergenic
1141844516 16:86598244-86598266 CATCCAGCACAGGAGAAAGATGG + Intergenic
1141915452 16:87093545-87093567 CAGCCAACACAGAAGGGACATGG + Intronic
1144141124 17:12349243-12349265 CATGTAACAAATGAGGAACAAGG + Intergenic
1146238362 17:31188807-31188829 CAACCAGCACAGGAGGAAGATGG - Intronic
1147033488 17:37661326-37661348 CATGCCACAGAGGAGGAAACTGG - Intergenic
1147550695 17:41439360-41439382 CTTTCATCACAGGAGGTACAGGG + Intronic
1147576904 17:41607309-41607331 AATGCAACACAGGAAAAAGAAGG + Intergenic
1149637058 17:58179422-58179444 CATCCAGCACAGGAGAAAGATGG - Intergenic
1149998297 17:61416454-61416476 CACCCAACTCAGGAGGAAGAAGG - Intergenic
1150777867 17:68096249-68096271 CAGGTACCACAGGAGGCACAAGG + Intergenic
1153048926 18:882800-882822 CATCCAGCACAGGAGAAAAATGG + Intergenic
1153684899 18:7535965-7535987 CATCCAACACAGGAGAAAGATGG + Intergenic
1154042323 18:10868463-10868485 CAGGTAGCCCAGGAGGAACAGGG - Intronic
1154053056 18:10981816-10981838 CATCCAGCACAGGAGAAAGATGG - Intronic
1156330374 18:36115852-36115874 CAGGAAAAACAGGAGAAACATGG + Intronic
1156896563 18:42253490-42253512 CATCCAGCACAGGAGAAAGATGG + Intergenic
1157152278 18:45230167-45230189 GAAGTAACAAAGGAGGAACAAGG - Intronic
1157737090 18:50059270-50059292 CATGTAACAAAGTATGAACATGG + Intronic
1158374668 18:56849347-56849369 CAAGAAACAGAGGAGGAATAAGG - Intronic
1158588827 18:58762853-58762875 CAGGGAATACAGGAGGAAAATGG - Intergenic
1158880682 18:61776823-61776845 CATCCAGCACAGGAGAAAGACGG - Intergenic
1159442863 18:68504255-68504277 CATGCAAAAGATGAAGAACAAGG + Intergenic
1159526627 18:69600392-69600414 CACGCAAGAAAAGAGGAACACGG - Intronic
1161412941 19:4126954-4126976 TAGGCAAAACAGAAGGAACATGG - Intergenic
1163978524 19:20875880-20875902 CATTTATCACAGGGGGAACATGG + Intergenic
1164056663 19:21627822-21627844 AATGGAACAGAGGACGAACACGG - Intergenic
1166360855 19:42252493-42252515 CATGCAACACAAAGGGAACTCGG + Intronic
1167014409 19:46831108-46831130 CAAACAGCACAGGAGGAAAATGG + Intergenic
1167712550 19:51121377-51121399 CATGCATAAGAGGAGGATCAAGG - Intergenic
1168190207 19:54732831-54732853 CAGGAAACTAAGGAGGAACAAGG + Intronic
1168205119 19:54844733-54844755 CAGGAAACTAAGGAGGAACAAGG + Intronic
925014121 2:508819-508841 CATGTAACACAGGAAAAACTAGG - Intergenic
925213726 2:2073858-2073880 CCTGCAGCCCATGAGGAACAGGG - Intronic
925245914 2:2382787-2382809 CATTCAGCACAGGAGAAAGATGG - Intergenic
925280291 2:2679455-2679477 CATCCAGCACAGGAGAAAGATGG - Intergenic
925316615 2:2931554-2931576 CATCCAGCACAGGAGGTCCAGGG + Intergenic
925704781 2:6674065-6674087 CATCCAACACTGGAGAAAGATGG + Intergenic
925772424 2:7296442-7296464 CATGCAGCACAGGAGAAAGATGG + Intergenic
925847571 2:8047582-8047604 CATCCAGCACAGGAGAAAGATGG - Intergenic
925891214 2:8436673-8436695 AATGCATCAGAGAAGGAACATGG + Intergenic
925900225 2:8503978-8504000 CATCCAGCACAGGAGAAAGATGG - Intergenic
926156500 2:10457275-10457297 CATCCAGCACAGGAGAAAGATGG + Intergenic
926578225 2:14606389-14606411 CATCCAGCACAGGAGAAAGATGG - Intergenic
926885999 2:17599403-17599425 CAGCCAACACAATAGGAACAGGG - Intronic
927398417 2:22682711-22682733 CATCCAACACAGTAGTAATACGG - Intergenic
927462824 2:23313684-23313706 CCTCCAACCCACGAGGAACATGG - Intergenic
927621213 2:24661340-24661362 CAAACAACCCAGCAGGAACATGG - Intronic
929056376 2:37880446-37880468 CATGCTACACAGTGGTAACAGGG - Intergenic
929471934 2:42202613-42202635 CATCCAGCACAGGAGAAAGATGG + Intronic
933265385 2:80175891-80175913 CATCCAGCACAGGAGAAAGATGG + Intronic
933571142 2:84014263-84014285 CATGCCACAAAGTAGCAACAAGG + Intergenic
935476994 2:103534851-103534873 CATCCAACATGGGAGAAACATGG - Intergenic
935491196 2:103722476-103722498 CATCTAGCACAGGAGGAAGATGG - Intergenic
938509089 2:131921282-131921304 CATCCAGCACAGGAGAAAGATGG + Intergenic
939057161 2:137379833-137379855 CTAGTAGCACAGGAGGAACAGGG - Intronic
940254544 2:151714886-151714908 CATCCAACAAGGGAGGCACAGGG - Intronic
940372309 2:152917045-152917067 CATGGCAAAAAGGAGGAACACGG - Intergenic
942322772 2:174750422-174750444 CATGGGACACAGGAAGAAGATGG + Intronic
942427220 2:175872803-175872825 CATGAGACATAGGAGAAACAGGG - Intergenic
943231163 2:185254372-185254394 CATTGAATACAGCAGGAACAGGG - Intergenic
943741512 2:191415251-191415273 AATGAGACACTGGAGGAACAGGG + Intronic
943886587 2:193225621-193225643 CATCCAACACTGGAGAAAAATGG + Intergenic
946202030 2:218076111-218076133 CATCCACCACAGGAGCAACTAGG - Intronic
946573591 2:221050730-221050752 CATGGAACACAGGCCAAACAAGG + Intergenic
946941861 2:224777470-224777492 CATCCAGCACAGGAGAAAGATGG - Intronic
947346861 2:229200665-229200687 CATGAAAAACAAGAGCAACATGG - Intronic
947917076 2:233839593-233839615 CAGGCACCACAGAAGGAACAAGG + Intronic
948365831 2:237453884-237453906 CCTGCCACACAGGTGGCACATGG - Intergenic
948636384 2:239340469-239340491 CATGGGACAGAGGAGGACCATGG + Intronic
1169094848 20:2888149-2888171 CATGAAATACAGGAAGAAAAGGG - Intronic
1169665712 20:8033365-8033387 CATGCATCCAAGGAGGAAAAGGG + Intergenic
1170459843 20:16567221-16567243 CATTCTACAGATGAGGAACAAGG - Intronic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1171064608 20:22002324-22002346 CTTGCAACACAGAAGGATCTCGG - Intergenic
1171865674 20:30486046-30486068 CATGCGCCACAGGGGGAACACGG + Intergenic
1173370420 20:42429839-42429861 GATGCAAGAAAGGAGGAAGAGGG + Intronic
1173644569 20:44625582-44625604 CATGCAGCACAGGATGGACCGGG + Exonic
1174572933 20:51515595-51515617 CAGGCAACACAACAGGAAAATGG + Intronic
1174944598 20:54971162-54971184 CATCCAGCACAGGAGGAAGATGG + Intergenic
1175524558 20:59624551-59624573 CAGGCTACACAGGAGCAGCATGG - Intronic
1175698099 20:61117519-61117541 CATCCAGCACAGGAGAAAGATGG - Intergenic
1176085897 20:63295280-63295302 CATTCAACTTAGGAGGAAGACGG - Intronic
1177395948 21:20536458-20536480 CATCCAGCACAGGAGAAAGATGG + Intergenic
1177982447 21:27931119-27931141 CATCCAGCACAGGAGAAAGATGG - Intergenic
1178369731 21:32017517-32017539 CAGGCAAAACAGGTGAAACAGGG - Intronic
1178370682 21:32024809-32024831 CATCCAACACAGGAGAAAGATGG + Intronic
1179084024 21:38201395-38201417 CATCCAGCACAGGAGAAAGATGG - Intronic
1179887702 21:44321474-44321496 CAGGCAACAGAGGAGGCAGAAGG - Intronic
1182091974 22:27602154-27602176 CATTCAGCACAGGAGTATCATGG - Intergenic
1182635461 22:31723079-31723101 CATGCAACACAGGAATACCCTGG + Intronic
1183058101 22:35319319-35319341 CAGGCAACACAGGAGGCACTAGG + Intronic
1184401685 22:44278216-44278238 CATCCAGCACAGGAGAAAGATGG - Intronic
950733343 3:14981847-14981869 CATCCAGCACAGGAGAAAGATGG + Intronic
953233820 3:41088426-41088448 GATACAACACAGGAAGGACATGG + Intergenic
955668679 3:61378175-61378197 AATGCAAGACAGGAGAAAAAAGG - Intergenic
955978367 3:64499414-64499436 CATCCAGCACAGGAGAAAAATGG + Intergenic
956510993 3:69993330-69993352 CATGCAAGACTGGAGGAGGATGG + Intergenic
956599598 3:71005990-71006012 AATCAAACACAGGAGGAACACGG + Intronic
957020285 3:75118814-75118836 CATGCATCATAGGAGGATCCTGG - Intergenic
957656543 3:83085271-83085293 CATGCAAACCAAGAGGAACAGGG + Intergenic
957761780 3:84568150-84568172 CCTGCAGCACAGGAGAAAGATGG + Intergenic
958778128 3:98509873-98509895 CACCCAACACAGGAGAAAGAGGG + Intronic
959143021 3:102508709-102508731 CATGCCACAGAGGATGAAGAGGG + Intergenic
959463038 3:106650496-106650518 CATTCAGCACAGGAGAAAGATGG + Intergenic
959696782 3:109256665-109256687 CATCCAGCACAGGAGAAAGATGG + Intergenic
960177129 3:114531197-114531219 GCTGGAACACAGGAGGAAGAAGG - Intronic
960458146 3:117899328-117899350 TATGCAGCACAGTAGCAACATGG + Intergenic
964841100 3:160994470-160994492 CATGGAACACAGGCTGTACAGGG - Intronic
965000618 3:162947944-162947966 CATACAACACGGGAGAAAGAAGG + Intergenic
965269810 3:166600684-166600706 CAGGCAGCACAGGAGAAAGATGG + Intergenic
966107219 3:176350733-176350755 CATCCAGCACAGGAGAAAGATGG + Intergenic
968528851 4:1079309-1079331 GATTCAACACAGGACCAACATGG + Intronic
970506999 4:16741965-16741987 TGAGCAACACAGCAGGAACATGG + Intronic
970773725 4:19647660-19647682 CATCCAGCACAGGAGAAAGATGG + Intergenic
970935813 4:21568595-21568617 CATCCAGCACAGGAGAAAGATGG - Intronic
971051467 4:22867266-22867288 CATCCAGCACAGGAGAAAGATGG - Intergenic
972176722 4:36417300-36417322 CATGCACAACTGGAAGAACAGGG - Intergenic
972336046 4:38107871-38107893 CAAGAAACACAGAAGCAACATGG - Intronic
972554887 4:40171867-40171889 CATCCAGCACAGGAGAAAGATGG + Intergenic
972921490 4:43947822-43947844 CATCCAGCACAGGAGAAAGAAGG - Intergenic
974876501 4:67709723-67709745 CATGTATCACAGGAGGGACCTGG - Intergenic
975054660 4:69915326-69915348 CATTCAGCACAGGAGAAAGAAGG - Intergenic
975235462 4:71990281-71990303 CATCCAGCACAGGAGAAAGATGG - Intergenic
976788799 4:88853867-88853889 CATCCAGCACAGGAGAAAGATGG - Intronic
976854040 4:89581916-89581938 CATGCAGCACAGGAGAAAGATGG - Intergenic
983595896 4:169467525-169467547 AATGCAAAACAGGAGGAAAAAGG + Intronic
983661962 4:170137567-170137589 CTTGGAATACAGGACGAACAGGG - Intergenic
983709314 4:170694398-170694420 CATGCAACAAAGGCAGAAAAGGG + Intergenic
983789788 4:171782668-171782690 CATGTGTCACAGGAGGGACACGG - Intergenic
984452005 4:179914299-179914321 CATGCAGCACAGGAGAAAGATGG - Intergenic
986374248 5:7114133-7114155 GATGAAGCACAGGAGGATCAAGG - Intergenic
986986763 5:13508999-13509021 CAAGCAAGTCAGGAGGAAAATGG - Intergenic
987257672 5:16173188-16173210 CAAGCAACAAAGGAGGAAGAAGG + Intronic
988234255 5:28520500-28520522 CATTCAGCACAGGAGAAAGATGG + Intergenic
989756628 5:44962970-44962992 CATCCAGCACAGGAGAAAGATGG + Intergenic
991585944 5:68202030-68202052 CATGAAAAACAGGAGGAACCAGG - Intergenic
992015703 5:72573303-72573325 CATCCAGCACAGGAGAAAGACGG - Intergenic
992319717 5:75601614-75601636 CATGCAGCACAGGAGAAAGACGG - Intergenic
992357860 5:76004030-76004052 AATGGAGCACAGGAGGGACAAGG + Intergenic
992846070 5:80749359-80749381 CATCCAGCACAGGAGAAAGATGG + Intronic
995233929 5:109804164-109804186 CGTGCACAACAAGAGGAACAAGG + Intronic
995287931 5:110413231-110413253 CATCCAGCACGGGAGAAACATGG - Intronic
996016343 5:118538138-118538160 CATCCAGCACAGGAGGAAGATGG + Intergenic
996325349 5:122267109-122267131 GATCCAACACGAGAGGAACAGGG + Intergenic
997625412 5:135327608-135327630 CAGGCCACACAGCAGGAACCTGG - Intronic
998486134 5:142504200-142504222 CATCCAGCACAGGAGAAAGATGG - Intergenic
1000347652 5:160328251-160328273 TTTTAAACACAGGAGGAACAGGG + Intronic
1001120554 5:168976636-168976658 CACACAGCACAGGAGGAACAAGG - Intronic
1002389500 5:178898703-178898725 CATGCAGTACAGGAGGAAGGGGG - Intronic
1004426512 6:15510603-15510625 CAAGACACACAGGAGGATCAAGG - Intronic
1004833816 6:19507845-19507867 CATCCAGCACAGGAGAAAGATGG + Intergenic
1005502275 6:26439389-26439411 CATCCAAGACAAGAGGAAGAAGG + Intergenic
1006738165 6:36289847-36289869 CATAAAACACAGGAGGAGTAGGG + Intronic
1008667833 6:53733913-53733935 GATGCAATTCAGGAAGAACAAGG - Intergenic
1008867294 6:56228104-56228126 CAGGAAACAGAGCAGGAACATGG + Intronic
1010251044 6:73707407-73707429 TAAGCTACAGAGGAGGAACAAGG + Intronic
1010431293 6:75781332-75781354 AATGCAATACAGGAAGAATAGGG + Intronic
1011564364 6:88658781-88658803 CATCCAGCACAGGAGAAACATGG - Intronic
1012366392 6:98445760-98445782 CATCCAGCACAGGAGAAAGATGG - Intergenic
1012609784 6:101202577-101202599 CATGCTACACATGAAGAAAAGGG - Intergenic
1012937246 6:105380805-105380827 CATGCAAATCAGAAGGATCAGGG - Intronic
1013275250 6:108578898-108578920 CTTGCACCACAGGTGGAACCAGG + Intronic
1015510158 6:134030438-134030460 GATGGAACACAGGCAGAACAAGG + Intronic
1015594157 6:134850354-134850376 AATGCAACACAGCAGGAGCATGG - Intergenic
1016201856 6:141419634-141419656 CATGCAACAGAGAAGTTACAAGG + Intergenic
1016512575 6:144860077-144860099 CATCCAGCACAGGAGAAAGATGG - Intergenic
1016841780 6:148532769-148532791 CAGGAAACATAGGAAGAACACGG - Intronic
1017228276 6:152044680-152044702 CATCCAGCACAGGAGAAAGATGG + Intronic
1017357628 6:153528379-153528401 CATCCAGCACAGGAGAAAGATGG + Intergenic
1017564343 6:155668051-155668073 CATCCAGCACGGGAGGAAAATGG - Intergenic
1017920438 6:158867950-158867972 CATGCAACACATTAGTACCATGG - Intergenic
1018190759 6:161307415-161307437 CATCCAGCACAGGAGAAAAACGG + Intergenic
1018758349 6:166868855-166868877 CATCCAGCACAGGAGAAAGATGG - Intronic
1018918292 6:168152133-168152155 CAAGCAACAGAGCAGGAACGAGG - Intergenic
1019003148 6:168772362-168772384 CATCCAGCACAGGAGAAAGATGG - Intergenic
1019208035 6:170378955-170378977 CAGGCAAATCAGGAGGAGCAAGG + Intronic
1021249255 7:18304108-18304130 CATGTAACACAGGAGGAACCTGG - Intronic
1021324353 7:19247095-19247117 CATCCAGCACAGGAGAAAGATGG + Intergenic
1021608801 7:22436078-22436100 CATTTTACACAGTAGGAACAAGG - Intronic
1021942439 7:25691123-25691145 CATCCAGCACAGGAGAAAGATGG + Intergenic
1022914435 7:34933689-34933711 CATCCAGCACAGGAGAAAGATGG - Intronic
1023043574 7:36193385-36193407 AATGCCACACAGGAGGACAAAGG + Intronic
1023576847 7:41636924-41636946 CATCCAGCACAGGAGAAAGATGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025220258 7:57101967-57101989 CAAGCATCCCAGGAGGACCACGG - Intergenic
1025631037 7:63273549-63273571 CAAGCATCCCAGGAGGACCACGG - Intergenic
1025651424 7:63473044-63473066 CAAGCATCCCAGGAGGACCACGG + Intergenic
1027994361 7:85405648-85405670 CATCCAACGCAGGAGAAAAATGG - Intergenic
1028300297 7:89191049-89191071 AATGCAACACAGGCAGAACTCGG - Intronic
1030904154 7:115162297-115162319 CATGCATCATGGGAGGAACAAGG - Intergenic
1031775573 7:125904934-125904956 CCTGCAACAGAGCAGGAACATGG + Intergenic
1032473749 7:132198449-132198471 CATGCAACACAGGAGGAACAGGG - Intronic
1033838928 7:145350172-145350194 CATGAAACACAAGAAGAAGAAGG - Intergenic
1034225433 7:149477505-149477527 CAGGGATCACAGGAGGGACAGGG - Intronic
1035087896 7:156277090-156277112 CATCCAGCACAGGAGAAAGATGG + Intergenic
1035778288 8:2207428-2207450 CATCCAGCACAGGAGAAAGACGG - Intergenic
1037194294 8:16168724-16168746 TATGGAACACATGAGCAACATGG - Exonic
1037485037 8:19339154-19339176 CATCCAGCACAGGAGAAAGATGG + Intronic
1039429172 8:37512131-37512153 CATGGAACATAGCAGGTACATGG + Intergenic
1040445765 8:47491973-47491995 CAGGCAGTACAGGAGGAACGAGG + Intronic
1041179880 8:55236348-55236370 CATGCAGACCAGGAGGTACAAGG - Intronic
1042733370 8:71961644-71961666 CAGGCACCACAGGAGGCACAGGG - Intronic
1045932201 8:107640295-107640317 CATGCAGCAGATGAGGAACATGG - Intergenic
1048337260 8:133512313-133512335 CATCCAGCACAGGAGAAAGATGG + Intronic
1049057945 8:140254002-140254024 CAGGCAACACGGGAGGAAGGGGG + Intronic
1050109829 9:2202742-2202764 CAAGCCACACAGGATGTACAGGG - Intergenic
1051817095 9:21121074-21121096 CTTGGAACCCAGGAGGAACTAGG - Intergenic
1055461602 9:76524870-76524892 CATCCAGCACAGGAGAAAGACGG + Intergenic
1055865512 9:80808734-80808756 CATCCAGCACAGGAGAAAGATGG - Intergenic
1057296496 9:93847361-93847383 CATGCAAAAAAACAGGAACATGG - Intergenic
1059651292 9:116318660-116318682 CTTGCTGCAGAGGAGGAACACGG - Intronic
1060538413 9:124411470-124411492 CATTCTACACAGAAGGAAAAAGG + Intronic
1061982063 9:134111356-134111378 CATCCAGCACAGGAGAAAGATGG - Intergenic
1062190777 9:135246841-135246863 CATGCAAGAGAGGAGGAAGAGGG + Intergenic
1203360877 Un_KI270442v1:218370-218392 CACGCGCCACACGAGGAACATGG + Intergenic
1185652212 X:1656166-1656188 CATCCAGCAAAGGAGGAAGATGG - Intergenic
1185934085 X:4236041-4236063 CATCCAGCACAGGAGAAAGATGG - Intergenic
1186129956 X:6455774-6455796 CATACAGCACAGGAGGAAGATGG + Intergenic
1187339127 X:18405710-18405732 CATCCAGCACAGGAGAAAGATGG + Intergenic
1187491836 X:19759341-19759363 CATTTAAAACAGGAGGGACAAGG + Intronic
1187724399 X:22187433-22187455 GATGCAACAGAGGAGGAAGTCGG - Intronic
1189447810 X:41097030-41097052 CAGACCACACAGGAGAAACAAGG - Intronic
1190098715 X:47503943-47503965 CATCCAGCACAGGAGAAAGATGG + Intergenic
1193053039 X:77121723-77121745 CATCCACCACAGGAGAAAGATGG - Intergenic
1193517521 X:82487109-82487131 CATGAGACACAGCAAGAACAAGG - Intergenic
1197390480 X:125857574-125857596 TACATAACACAGGAGGAACAGGG - Intergenic
1197554309 X:127935926-127935948 CATCCAGCACAGGAGAAAGATGG + Intergenic
1198565181 X:137896853-137896875 CATTCAGCACAGGAGAAAGATGG - Intergenic
1199081103 X:143577652-143577674 CATCCAGCACAGGAGAAAGATGG + Intergenic
1199287529 X:146070393-146070415 CATGAAACACAGGAAACACAGGG - Intergenic
1200056774 X:153465736-153465758 CATGCACCACAGGTGACACACGG + Intronic
1200972794 Y:9174791-9174813 CATCCAGCACAGGAGAAACATGG + Intergenic
1202138223 Y:21689409-21689431 CATCCAGCACAGGGGAAACATGG - Intergenic
1202173882 Y:22079781-22079803 CATGCCAGAGAGGAGGAAAAAGG - Intronic
1202217478 Y:22506601-22506623 CATGCCAGAGAGGAGGAAAAAGG + Intronic
1202325708 Y:23689458-23689480 CATGCCAGAGAGGAGGAAAAAGG - Intergenic
1202545063 Y:25980596-25980618 CATGCCAGAGAGGAGGAAAAAGG + Intergenic