ID: 1032480275

View in Genome Browser
Species Human (GRCh38)
Location 7:132240502-132240524
Sequence GCTGCCAAACACCCATTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032480275_1032480280 -5 Left 1032480275 7:132240502-132240524 CCAGCTAATGGGTGTTTGGCAGC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1032480280 7:132240520-132240542 GCAGCAGTGGGAGGGTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032480275 Original CRISPR GCTGCCAAACACCCATTAGC TGG (reversed) Intronic
901745786 1:11372507-11372529 GATGCCAAACAAAAATTAGCTGG - Intergenic
907768144 1:57431534-57431556 GCTGCCACACAACCTTTCGCTGG - Intronic
914801120 1:150963407-150963429 GCTGAGAAACACCAATAAGCTGG - Intronic
914921008 1:151847491-151847513 GCTGCAAATTACCCATTACCTGG + Intronic
1063261944 10:4399459-4399481 GCTGCAAAACAATCATTATCTGG - Intergenic
1066109615 10:32184427-32184449 GCTGCCAAGCCACCATTTGCCGG + Intergenic
1072741398 10:97912189-97912211 GGTGCCACACAGTCATTAGCTGG + Intronic
1075782733 10:125027328-125027350 GCTGCCAAGCACTCCGTAGCTGG + Exonic
1077874737 11:6294473-6294495 GCTGCCTAGCACCCTTTAGGAGG + Intergenic
1078056588 11:8014285-8014307 CCTGCCAAACACACAGTGGCAGG - Intergenic
1078822072 11:14892266-14892288 CCTGCCATACTCCCATTGGCAGG + Intergenic
1082571774 11:54749989-54750011 GCTCCCAAATGTCCATTAGCAGG - Intergenic
1082584854 11:54924263-54924285 GCTCCCAAACTTCCATTAGTAGG + Intergenic
1088326370 11:108605198-108605220 GATGGCTAAAACCCATTAGCAGG - Intergenic
1089413386 11:118266098-118266120 GTAGCCAAACACCCATGAGCTGG + Intergenic
1092967635 12:13659931-13659953 GCTTCCAGACACGCTTTAGCTGG + Intronic
1095076756 12:37938662-37938684 TCTCCCAAACACCCATTCGCAGG + Intergenic
1105775044 13:23651965-23651987 AATGCCAAACAACCATTAGGTGG - Intronic
1107527592 13:41248463-41248485 ACTGCCAAACACCAAGTAGTAGG - Intronic
1108071096 13:46629481-46629503 GCTGCCAATGAGCCATTGGCTGG + Intronic
1111311179 13:86488387-86488409 GCTGGCAAACATCCATAAACAGG + Intergenic
1113780036 13:112971307-112971329 GCAGCCAAACACTCTTCAGCGGG + Intronic
1114654257 14:24306582-24306604 GCTGCCCAACATCCATCAGTTGG + Exonic
1114969306 14:28005674-28005696 GCTGGCATGCACCCACTAGCAGG - Intergenic
1120319398 14:82940387-82940409 TCTGCCAAAAACCTATGAGCTGG - Intergenic
1125441926 15:39712150-39712172 GCTGCCTAACTCTCATTAGGGGG + Intronic
1128591120 15:68898359-68898381 AGTGCCAAACACACACTAGCAGG - Intronic
1130855075 15:87833208-87833230 GCTGCCAAAAAGCCATGAACTGG - Intergenic
1131274658 15:90970884-90970906 ACAGCCAAATACCCATCAGCAGG + Intronic
1142502277 17:339784-339806 CCTGCCACACACCCAGCAGCGGG + Intronic
1147791761 17:43018209-43018231 GCAGCAAGACACCCATAAGCAGG + Intronic
1164339731 19:24378680-24378702 GCTCCCAAACATCCCTTTGCAGG - Intergenic
1165696279 19:37903399-37903421 GCTGACAAACATACATTAACAGG + Intronic
935574960 2:104699879-104699901 GCTTCCTAACACACATTAGTTGG + Intergenic
941917382 2:170821713-170821735 GCTGCCCAACACCCACTGGCCGG - Intronic
944445016 2:199780376-199780398 GCTGCCAGATTCCCATCAGCAGG - Intronic
945227536 2:207547591-207547613 GCTGTGAAACACCCATTAAGTGG + Intronic
946021653 2:216644300-216644322 GCTGGCAAACACCCAGCTGCTGG + Intronic
1170719030 20:18859272-18859294 GCTGCAAAACAACCACTTGCTGG + Intergenic
1174831074 20:53812876-53812898 GCTGCCCAAAACCCAAAAGCCGG - Intergenic
1178254669 21:31041266-31041288 GCAGGCAAGAACCCATTAGCCGG + Intergenic
1179303526 21:40134306-40134328 GCTGCCACTCACCCTTCAGCAGG + Intronic
949198071 3:1337262-1337284 GCAGCCAGACTCCCATTAGCTGG - Intronic
949570275 3:5285637-5285659 GCCACTAAACACCCATAAGCTGG - Intergenic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953223565 3:40997121-40997143 ACTGACAAACACCCACAAGCAGG + Intergenic
955996539 3:64685670-64685692 GCTGCCAAATAGCATTTAGCAGG - Intronic
965510122 3:169559100-169559122 ACTGCCAACAACCCACTAGCAGG + Intronic
969358109 4:6643138-6643160 GCTGACAAACACCCTTCAGCTGG + Intergenic
970196959 4:13560711-13560733 GCAGCGAAACACCCATATGCTGG + Intergenic
986095969 5:4554529-4554551 GCCACCAAACATCCATTACCTGG + Intergenic
986194162 5:5522488-5522510 CCTGCCAACCTCTCATTAGCTGG + Intergenic
989833708 5:45955646-45955668 GCTCCCAAACATCCCTTTGCAGG - Intergenic
994285371 5:97958377-97958399 GATGCCAACCACCCTTAAGCTGG + Intergenic
997614070 5:135234475-135234497 GAGGCCAGGCACCCATTAGCTGG + Intronic
999275914 5:150330109-150330131 GCTGCCAAGGAGCCATGAGCTGG + Intronic
999324692 5:150636639-150636661 GCTGCCATTCACCAATTACCAGG - Intronic
1001585731 5:172832964-172832986 GCTTCCAAACAGCCATTCGTTGG - Intergenic
1001614921 5:173035446-173035468 GCTGTCAAAAAGCCATGAGCTGG - Intergenic
1006147661 6:31969068-31969090 GCTCCCAAACACCCTCAAGCAGG + Exonic
1007112137 6:39319056-39319078 GCTGCCAAAGTCCCAGTTGCTGG + Exonic
1009259850 6:61471753-61471775 GCTGCCAAATGTCCATTTGCAGG - Intergenic
1010997785 6:82552879-82552901 GCTGGCTAACTCCCATAAGCAGG - Intergenic
1022709026 7:32834304-32834326 GCTGCCAAGCAGCCATGAACTGG - Intergenic
1025525750 7:61807890-61807912 GCTCCCAAATATCCATTCGCAGG + Intergenic
1025549141 7:62220623-62220645 GCTCCCAAATATCCATTCGCAGG + Intergenic
1026882573 7:73916860-73916882 GCTGCCAAACACGCAGAAGCTGG - Intergenic
1032480275 7:132240502-132240524 GCTGCCAAACACCCATTAGCTGG - Intronic
1032563220 7:132913868-132913890 GCTCCGAAGCACCCATTGGCTGG - Intronic
1047501515 8:125445492-125445514 CCTGCAAAACACCCATTATTAGG - Intergenic
1049475543 8:142795468-142795490 GCTCCCAAGCACCCAGGAGCAGG - Intergenic
1054363258 9:64200645-64200667 GCTGCCAAATGTCCATTTGCAGG - Intergenic
1059104189 9:111497520-111497542 GATGCCAAAAACCCATTAAATGG + Intergenic
1061583018 9:131548999-131549021 GCTGCCAAACAGCCATGAACTGG - Intergenic
1190413342 X:50158323-50158345 GATGCCAAACAACAATTATCAGG + Intergenic
1194458622 X:94136890-94136912 GCTGCCATAAACCTATGAGCAGG + Intergenic
1195349826 X:103985584-103985606 CCTGCCAACCACCCTTTCGCAGG - Intergenic
1195357132 X:104049343-104049365 CCTGCCAACCACCCATTCTCAGG - Intergenic
1195357617 X:104053255-104053277 CCTGCCAACCACCCTTTCGCAGG + Intergenic
1196689991 X:118549031-118549053 GCAGCAAAACAACAATTAGCTGG - Intronic
1199508385 X:148592113-148592135 GCTGCCATGCACCCATGATCAGG + Intronic
1199551113 X:149062342-149062364 ACTGCTAAACACCGATTATCAGG + Intergenic