ID: 1032480662

View in Genome Browser
Species Human (GRCh38)
Location 7:132244153-132244175
Sequence CCAAGTTTACCCAGGAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032480662_1032480667 -7 Left 1032480662 7:132244153-132244175 CCCAGTTTCCTGGGTAAACTTGG 0: 1
1: 0
2: 0
3: 22
4: 136
Right 1032480667 7:132244169-132244191 AACTTGGACAAGTCTCTCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 107
1032480662_1032480670 27 Left 1032480662 7:132244153-132244175 CCCAGTTTCCTGGGTAAACTTGG 0: 1
1: 0
2: 0
3: 22
4: 136
Right 1032480670 7:132244203-132244225 TGATCTGAAAAATGAGGAACTGG No data
1032480662_1032480669 21 Left 1032480662 7:132244153-132244175 CCCAGTTTCCTGGGTAAACTTGG 0: 1
1: 0
2: 0
3: 22
4: 136
Right 1032480669 7:132244197-132244219 TTGTGATGATCTGAAAAATGAGG 0: 1
1: 0
2: 4
3: 37
4: 416
1032480662_1032480671 28 Left 1032480662 7:132244153-132244175 CCCAGTTTCCTGGGTAAACTTGG 0: 1
1: 0
2: 0
3: 22
4: 136
Right 1032480671 7:132244204-132244226 GATCTGAAAAATGAGGAACTGGG No data
1032480662_1032480666 -8 Left 1032480662 7:132244153-132244175 CCCAGTTTCCTGGGTAAACTTGG 0: 1
1: 0
2: 0
3: 22
4: 136
Right 1032480666 7:132244168-132244190 AAACTTGGACAAGTCTCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032480662 Original CRISPR CCAAGTTTACCCAGGAAACT GGG (reversed) Intronic
902376155 1:16030832-16030854 CCAAGGTCACCCAGGGCACTGGG - Intronic
903469556 1:23576365-23576387 ACAAGCTTACCCAGGAAACACGG - Intergenic
904824805 1:33267118-33267140 GCAAGTTTACCCAGGAGAGTGGG - Intronic
905338644 1:37263034-37263056 CCAAGTGAACCCAGGGAAATAGG + Intergenic
907675400 1:56513312-56513334 CCAAGTTCCCACAGGAACCTGGG - Intronic
907927405 1:58967350-58967372 CCAAGGCTACTGAGGAAACTGGG + Intergenic
911166310 1:94727556-94727578 CCAAGTTTATCCAGTGAACGAGG - Intergenic
912127467 1:106556338-106556360 TCAAGATTACCCAGGAAAACAGG + Intergenic
912485280 1:110022175-110022197 CCACCTTTACGCAGGAAACAGGG - Exonic
915166454 1:153950653-153950675 CCAAGTTTACCCAGCAAGTTAGG - Intronic
919141843 1:193582268-193582290 ACATGTTTATCCAGGAAACAGGG + Intergenic
922794638 1:228333991-228334013 TGAAGTTGACCCAGGAAAGTGGG + Intronic
1062842794 10:684077-684099 TCAAATTTAGCCAGGAAGCTAGG - Intronic
1063029616 10:2220790-2220812 GCAAGTTTACCCAGCAACCTAGG - Intergenic
1063364158 10:5479827-5479849 CCTAGTCTACCCAGGCCACTCGG - Intergenic
1063660944 10:8034817-8034839 CCCAGTTTGTCCAGGAAACAGGG - Intergenic
1064950562 10:20845021-20845043 TCAAGTTTTCCCAGGAAATCTGG + Intronic
1068923035 10:62505171-62505193 CAAAGCTCACCCAGGACACTGGG - Intronic
1070376174 10:75832990-75833012 CCTTATTTAGCCAGGAAACTAGG - Intronic
1074308711 10:112302544-112302566 CCAATTTCACAGAGGAAACTAGG - Intronic
1079154766 11:17935604-17935626 CCAAGTTTATACAGGTAATTAGG + Intronic
1081363132 11:42204506-42204528 CAAACTTTAACCCGGAAACTAGG + Intergenic
1084043425 11:66555607-66555629 CCCAGGTAACCCAGGTAACTGGG - Intronic
1084708010 11:70826905-70826927 CCCAGTTATCCAAGGAAACTCGG + Intronic
1087185645 11:95191235-95191257 CCAAATATACCCAAGACACTTGG + Intronic
1089809215 11:121117906-121117928 CCCAGTTTACCCAGGTTACTCGG - Intronic
1089974336 11:122719315-122719337 CTAAATTTAACCAGGAAATTTGG + Intronic
1091806121 12:3357292-3357314 CCAAGGAAACCCAGGAAAATGGG + Intergenic
1092089903 12:5795823-5795845 CCAAGTTTTCCCAGAAAATAAGG + Intronic
1092959615 12:13583693-13583715 CCAAGTTTATCCAGGCAAAGAGG + Intronic
1094184965 12:27632025-27632047 CTATGGTTACCCAGGAAACAAGG - Intronic
1094204698 12:27827954-27827976 GAAAGTTTACCCAGCAAACTGGG - Intergenic
1095895262 12:47274053-47274075 TCAAGTTAAACCAGGAAAATGGG - Intergenic
1096759904 12:53832581-53832603 CCACGTTAGCCCAGAAAACTTGG + Intergenic
1096867025 12:54570715-54570737 CCAATTTTATCCAGGAAACATGG - Intronic
1097661362 12:62435037-62435059 GCAAGTTTACCCAAGAAAATGGG + Intergenic
1098377990 12:69837734-69837756 CCAAGTTAACCAAGTAAACAAGG - Intronic
1101241178 12:102841511-102841533 CCAATTTTACAGAGGAAATTGGG - Intronic
1102680856 12:114689395-114689417 GCAAGTTAACCTAGGAACCTAGG + Intergenic
1103106919 12:118235848-118235870 GCAAGTACACCCAGGAATCTGGG - Intronic
1103392732 12:120585903-120585925 CCAAGTTGACACAGTAAATTTGG + Intergenic
1106323639 13:28666633-28666655 CCAAGTTTACTTAGCAAAGTGGG - Intronic
1107877124 13:44800643-44800665 CCAAGTATCCACAGGATACTTGG + Intergenic
1108275556 13:48805974-48805996 CCAAGTTTCTGTAGGAAACTTGG - Intergenic
1109096700 13:58128026-58128048 CGTGGTTTACCCAGGAAACATGG + Intergenic
1109844663 13:67971479-67971501 GCAAGTTTACCCAGGACAGTAGG - Intergenic
1110857546 13:80313018-80313040 CCAAGTGTATCAGGGAAACTTGG - Intergenic
1112044896 13:95586944-95586966 ACAAGTCAACCCAGGACACTGGG - Intronic
1115712154 14:36062359-36062381 CTAAGTTTACCCAGTTAACCTGG - Intergenic
1115750608 14:36486166-36486188 CCCTGGTTACCCAGGAAGCTTGG - Intronic
1119177459 14:72579669-72579691 CCAATTTGACATAGGAAACTAGG + Intergenic
1121003221 14:90467127-90467149 TCAAGTTTGTCCAGGAAACTGGG - Intergenic
1121579158 14:95013772-95013794 CCAAGATTCCCCAGGGAAATTGG + Intergenic
1124548388 15:30654020-30654042 CCACGTTTACCCAGGAGGCCAGG + Intronic
1127780316 15:62307204-62307226 CCAGTATTACCAAGGAAACTTGG + Intergenic
1128655194 15:69455773-69455795 TCAAGTTTACACAGGTAACCTGG - Exonic
1129483514 15:75845565-75845587 CTAAGTTTACTCAGGTAAGTTGG + Intronic
1132750370 16:1454809-1454831 CCCAGGCTACCCTGGAAACTAGG + Intronic
1132997702 16:2831791-2831813 CCAAGTTTCACCTGGACACTGGG - Exonic
1134363855 16:13558157-13558179 CCAAGATCACACAGCAAACTCGG - Intergenic
1134363946 16:13559315-13559337 CCAAGATCACACAGCAAACTGGG + Intergenic
1139041783 16:63006497-63006519 CCCAGTCTACCCATGAAGCTGGG + Intergenic
1139578171 16:67855558-67855580 CCCAGTTTACTGAGGACACTGGG - Intronic
1140838328 16:78815953-78815975 ACAAGGTCACCCAGGAGACTTGG - Intronic
1142210661 16:88806939-88806961 ACAAGTTCACCCAGCACACTGGG - Intronic
1144958647 17:19032686-19032708 CCAAGGTCACCCAGCAAAGTGGG - Intronic
1144976512 17:19141838-19141860 CCAAGGTCACCCAGCAAAGTGGG + Intronic
1148821710 17:50363812-50363834 CCATGGTTGCCCTGGAAACTGGG - Intergenic
1149418106 17:56481534-56481556 CCAAGTTTAGCCTGTAAACTGGG + Intronic
1152753636 17:82077892-82077914 CCAGGTTGACCCAGAAGACTTGG - Intergenic
1153220343 18:2855330-2855352 ACAAGTTCAGCCAGGAGACTAGG + Intronic
1153766550 18:8380250-8380272 CCAAATATACTCAGGAAAATGGG - Intronic
1155183256 18:23366511-23366533 CCAATTTAAGCCAGGACACTGGG - Intronic
1155634981 18:27941871-27941893 CCAAGTACATCCAGGAAACTTGG - Intergenic
1163487904 19:17599901-17599923 CGGAATTTACCGAGGAAACTGGG + Intergenic
1164555103 19:29245407-29245429 CCAATTTTACCAAGGAAGCTGGG - Intergenic
1165129658 19:33623580-33623602 GAAAGGTTACCCAGGAAAGTGGG - Intronic
1166584173 19:43930537-43930559 CCAAGGGCACCCAGGAAACCAGG + Intronic
1167157800 19:47750057-47750079 CCAAGTCACCCCAGGAGACTTGG - Intronic
1168571943 19:57477631-57477653 ACTACATTACCCAGGAAACTTGG - Intergenic
927843507 2:26459677-26459699 TCAAGGTTACCCAGCAAATTAGG - Intronic
932091249 2:68808198-68808220 ACAAGTTCACGCAGGCAACTGGG - Intronic
933516396 2:83309194-83309216 CCTATATTACCCAGGAAAGTGGG - Intergenic
936676095 2:114716486-114716508 CAAACTGTACACAGGAAACTGGG + Intronic
940207064 2:151214453-151214475 CCATCTTTACCCAGAAAAGTTGG + Intergenic
941072938 2:160975173-160975195 ATCAGTTTACCAAGGAAACTGGG - Intergenic
941163873 2:162064507-162064529 TAAAGTTAACCCAGGAAAGTAGG - Intronic
944455050 2:199884613-199884635 CCAAGATTACCCATAAATCTTGG - Intergenic
949058875 2:241945094-241945116 CCATGTTTCCACAGGAGACTTGG - Intergenic
1170932620 20:20782434-20782456 CCAAGTTTTCTCAGCAAAGTAGG + Intergenic
1172122138 20:32604682-32604704 CCAAGTTCACACAGCAAATTAGG + Intronic
1172785343 20:37464805-37464827 CAAAGTTCACCCAGGACACGGGG + Intergenic
1173435126 20:43025509-43025531 CCTGCTTTACCCAGGAAATTAGG - Intronic
1173833395 20:46108226-46108248 CTATGGTCACCCAGGAAACTGGG - Intergenic
1175389717 20:58619290-58619312 CCAACTTTCCCCATGAAGCTCGG + Intergenic
1176016363 20:62935706-62935728 CTAACTTTACACAGGCAACTGGG + Intronic
1177208316 21:18036819-18036841 CTAATATTAGCCAGGAAACTGGG + Intronic
1178042712 21:28657829-28657851 CCAAGTCTATCTAGGAAGCTTGG - Intergenic
1178387445 21:32164559-32164581 CCAACTTAACACAGTAAACTGGG + Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
953369496 3:42375409-42375431 CTAAGTTTGCCCAGTACACTGGG + Intergenic
953445370 3:42960384-42960406 CCAAGTTTACCAAGCAAACAAGG - Intronic
954122396 3:48507104-48507126 CCCAATTTCCCCAGGAAACTGGG + Intergenic
954794826 3:53156187-53156209 ACAAGTTTACCGAGGAAAGTAGG - Intronic
955789649 3:62575374-62575396 CCAAGTTTGCACATGAATCTGGG - Intronic
956831454 3:73053121-73053143 CCTATTTTCCCCAGGCAACTGGG - Intronic
963123501 3:141795233-141795255 CCAAGTATCCCCAGGAAGTTTGG - Intronic
968312556 3:197696057-197696079 CCAAGTCTTCCCAGGTAACTGGG + Intronic
969079879 4:4610156-4610178 CCAAGTTTACACAGAACCCTGGG - Intergenic
969084211 4:4643332-4643354 CCAAGTTTGCACACGAAGCTGGG - Intergenic
970580173 4:17467726-17467748 CCAGGATTACCCAGGACAGTCGG + Intronic
971739199 4:30499099-30499121 CCAAGTTTCCACAGTAGACTTGG + Intergenic
971739198 4:30499099-30499121 CCAAGTCTACTGTGGAAACTTGG - Intergenic
974976723 4:68902361-68902383 CTTGGTTTACCCAGGAAAATGGG - Intergenic
977066865 4:92329011-92329033 CAAACTCTACCCAGGAGACTAGG - Intronic
978819283 4:112946604-112946626 TTAAGTTTATACAGGAAACTGGG + Intronic
981023015 4:140048567-140048589 CCATAATTACCCAGGTAACTTGG + Intronic
981040869 4:140220268-140220290 ACAGGTTGAGCCAGGAAACTTGG - Intergenic
982175988 4:152706073-152706095 CCAAGTGTTCCCTTGAAACTAGG + Intronic
995887770 5:116915631-116915653 TCAAGTTCACCCACTAAACTGGG - Intergenic
996532550 5:124541660-124541682 GCAAGTTTGGCCAGTAAACTGGG + Intergenic
998130695 5:139649798-139649820 CCAAATTTACCCATGAAGTTCGG + Intronic
999785001 5:154882932-154882954 CCAAGTTAATCCTGGAAACTCGG + Intergenic
1001130951 5:169063069-169063091 CCAAGCTTAACCACGAAGCTTGG + Intronic
1003882194 6:10488977-10488999 TCACGTTAATCCAGGAAACTAGG + Intergenic
1004886945 6:20060200-20060222 CCCAGTTTACCAAGGAAGGTGGG + Intergenic
1013075890 6:106771378-106771400 CCAAGTTTTCCCATCAAACTCGG - Intergenic
1016795857 6:148116521-148116543 CCATGTTTAGCCAGAAAACTTGG - Intergenic
1017399161 6:154039625-154039647 ACAAGTTGACCCAGGAACCGGGG - Exonic
1018441534 6:163818250-163818272 GGAAGTTAACCCAGGAAATTTGG - Intergenic
1029381598 7:100219035-100219057 CCAAGTTGCCCCAGGATTCTGGG - Intronic
1029401036 7:100346365-100346387 CCAAGTTTCCCCAGGATTCTGGG - Intronic
1031626148 7:123995377-123995399 CAGGGTTTACGCAGGAAACTGGG + Intergenic
1032480662 7:132244153-132244175 CCAAGTTTACCCAGGAAACTGGG - Intronic
1032822067 7:135533139-135533161 ACAAGAATACACAGGAAACTTGG + Intergenic
1034872481 7:154696389-154696411 CCAAGTTTACCCGGGAGTCCAGG + Intronic
1035627426 8:1081747-1081769 CAAAGTTCACCCAGGATACTAGG + Intergenic
1037107431 8:15126621-15126643 CCAACTTTACCTGGGAAAGTCGG + Intronic
1037259405 8:16991016-16991038 TCAACATTACCTAGGAAACTAGG + Intergenic
1037912385 8:22751378-22751400 CCAAGTTTCCCAAGGCAACCAGG - Intronic
1043166566 8:76909775-76909797 CCAAGTTTGCTCAGGTAACAAGG - Intergenic
1044830464 8:96242503-96242525 CCAAGGTTACCCAAGTAACAAGG - Intronic
1045905219 8:107337150-107337172 CCAAGTTCACACAGGAACCAAGG + Intronic
1047415029 8:124657683-124657705 CCAAATTTAACCAGGATACAGGG + Intronic
1050775926 9:9260199-9260221 GCAAGTTAACCCAGAACACTGGG + Intronic
1051320379 9:15897841-15897863 CCAAATCAAACCAGGAAACTTGG + Intronic
1053615039 9:39756563-39756585 TCCAGCTTTCCCAGGAAACTTGG - Intergenic
1054238481 9:62585828-62585850 TCCAGCTTTCCCAGGAAACTTGG + Intergenic
1054262111 9:62877493-62877515 TCCAGCTTTCCCAGGAAACTTGG - Intergenic
1054552610 9:66620348-66620370 TCCAGCTTTCCCAGGAAACTTGG + Intergenic
1059075477 9:111188819-111188841 TAATGTTTACCCAGGATACTGGG + Intergenic
1060793250 9:126499586-126499608 CCGTGTTTACCCAGGAGACGGGG - Intronic
1061563794 9:131423858-131423880 CCAAGTTTATATAGGAAAATAGG + Intronic
1062680601 9:137777707-137777729 CCTAGTTTTCTCAGGAAATTTGG + Intronic
1188026152 X:25211411-25211433 CTTATTGTACCCAGGAAACTAGG + Intergenic
1188027531 X:25226293-25226315 TCAAGTTTACCCAGGACCCCAGG - Intergenic
1190407055 X:50098661-50098683 CCAAGTTTCCGCAGGAAGTTTGG + Exonic
1199111645 X:143942345-143942367 ACAATTTTACTCAGAAAACTTGG + Intergenic
1199547810 X:149025725-149025747 CCAAGTATCCCCAGGAGACATGG - Intergenic