ID: 1032480850

View in Genome Browser
Species Human (GRCh38)
Location 7:132245587-132245609
Sequence CCTGCAAAACAACCAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032480850 Original CRISPR CCTGCAAAACAACCAAAAGC AGG Intronic
903545313 1:24120310-24120332 CCTGGAAAAGAACCAGAAGGAGG - Exonic
903551577 1:24160887-24160909 CCTACAAAAAAAAAAAAAGCTGG - Intronic
905261693 1:36723472-36723494 CCTGCACAGCAAACAACAGCAGG + Intergenic
907261013 1:53218739-53218761 CCTCCCAAACCACAAAAAGCAGG + Intronic
907773265 1:57487274-57487296 CCAGGAAGACCACCAAAAGCTGG - Intronic
907948210 1:59155197-59155219 CCAGCAAAACAACAAAAAATAGG + Intergenic
908629289 1:66084707-66084729 CCTGAAAAAAGACTAAAAGCAGG - Intronic
908719178 1:67105700-67105722 CCTGGAGAATAAACAAAAGCAGG + Intronic
909004378 1:70257679-70257701 CCTGAAAAACAACCCCAGGCAGG + Intergenic
909438489 1:75672064-75672086 CCTTCATAAGAACCAAAATCAGG + Intergenic
909748007 1:79123147-79123169 TCTTCAAAACCAGCAAAAGCAGG + Intergenic
910945517 1:92587746-92587768 CCAGGAAAAAAACCAAAAGTTGG + Intronic
911219364 1:95231109-95231131 CCACCAAAACAACCAAAAGAGGG - Intronic
912402949 1:109411113-109411135 CCTGCAAAACCCCCAAAATGAGG + Exonic
915375619 1:155392417-155392439 ACTGGAGAGCAACCAAAAGCAGG - Intronic
915690389 1:157683244-157683266 CCTGCAAAACAAACAAAGGAAGG + Exonic
917647592 1:177044454-177044476 CCAGCAGAACAGCCAAATGCTGG + Intronic
917668890 1:177252970-177252992 CATTCAAAACAACCAAAATATGG - Intronic
920496840 1:206461015-206461037 CCTGCAAAACAGGAAAAAGGAGG - Exonic
921411253 1:214838669-214838691 CCAGAAAAACAACCCAAAGTGGG + Intergenic
921865684 1:220085596-220085618 CCTGCAAAATAACCGAAATAAGG - Intronic
923564663 1:235067925-235067947 TCAGCAGGACAACCAAAAGCTGG + Intergenic
924431648 1:244002193-244002215 CCTCCAAACTAACCCAAAGCAGG - Intergenic
924740137 1:246790119-246790141 GCTGCTGAACAACCAAAAGAAGG + Intergenic
1063987111 10:11516530-11516552 CATGCAAAACAGCCTAAGGCTGG - Intronic
1065419460 10:25526233-25526255 ACTGAAAAACTATCAAAAGCAGG + Intronic
1065571833 10:27079250-27079272 CCTCCAAAAAAACAAAAACCTGG + Intronic
1065722085 10:28636781-28636803 CCTGCCAAACACACAAAACCAGG + Intergenic
1067656826 10:48199385-48199407 TCTGCTAAGCAACCAAAAGTAGG + Intronic
1068555101 10:58449705-58449727 ACTGGAAAGCAACTAAAAGCAGG - Intergenic
1070399674 10:76042317-76042339 CATACAAAATACCCAAAAGCAGG + Intronic
1071130170 10:82381757-82381779 CTTGGAAAACAAGCATAAGCTGG + Intronic
1072653113 10:97310883-97310905 CCTGCAAAAGAACAAAGAGATGG - Intergenic
1072675016 10:97459282-97459304 CCTGGAACACAACCACAAGGAGG + Exonic
1072937097 10:99723899-99723921 TATCCAAAAGAACCAAAAGCGGG + Intronic
1072960665 10:99926443-99926465 ACTGAAAAGCAATCAAAAGCAGG + Intronic
1074336906 10:112586326-112586348 GCTGAAAAACAACCCAAAGAAGG - Intronic
1074668267 10:115756982-115757004 AATGCAAAACAAAAAAAAGCAGG - Intronic
1076386872 10:130063410-130063432 CGTGCCAAACAACCAAAGCCGGG - Intergenic
1076822813 10:132948874-132948896 CCTGCAAATGAAACAAAAGACGG - Intergenic
1077977491 11:7263166-7263188 CTAGCAAAACTACCATAAGCTGG + Intronic
1081004241 11:37714247-37714269 ACTGCAAAACAGCCACAGGCAGG - Intergenic
1081056201 11:38413439-38413461 CTTATAAAACAACCAATAGCTGG - Intergenic
1082286920 11:50327931-50327953 ATTGGAAAACAAACAAAAGCAGG - Intergenic
1082967966 11:58987739-58987761 AATGGAAAACAACAAAAAGCAGG - Intronic
1084686156 11:70696831-70696853 CATTCACAACAACCAAAAGGTGG + Intronic
1084688686 11:70712170-70712192 CCTTCAAAGCCAGCAAAAGCGGG + Intronic
1085551574 11:77378215-77378237 CCTGCAAAACAATGGAAAGCTGG + Intronic
1086023346 11:82259645-82259667 ATTGAAAAACAACCCAAAGCAGG - Intergenic
1086150973 11:83610258-83610280 CGTGAAAAACATCTAAAAGCCGG + Intronic
1086496329 11:87407763-87407785 CCTGCAAAATGGGCAAAAGCAGG + Intergenic
1086815511 11:91365844-91365866 TCTTCAAAACACCCAAAAGTAGG - Intergenic
1088197928 11:107296008-107296030 AATGCAAAACAAAAAAAAGCAGG + Intergenic
1088275901 11:108085010-108085032 CTTTCAAAACAAACAAAAGAAGG + Intronic
1090384638 11:126350006-126350028 CTTGCAAAAAAACCAAAAGGGGG - Intergenic
1093690396 12:22102680-22102702 GCTGCAAAACAGCAAAAAGGTGG + Intronic
1096255850 12:50061998-50062020 GCTGCAAAACAGCAAAAACCTGG - Intronic
1098209541 12:68149113-68149135 CCTTTAAAACAAGGAAAAGCTGG - Intergenic
1100200394 12:92292102-92292124 CATGAAAAACAAGCAAAAACGGG - Intergenic
1101748215 12:107560414-107560436 CCTGGAAAAAAAGCAACAGCTGG - Intronic
1103627218 12:122228562-122228584 GCTGTAAAACACCCAAAATCAGG - Intronic
1103753648 12:123185124-123185146 CCTGCAAAAGAACCAACACTTGG + Intronic
1108027146 13:46189911-46189933 CCAGCAAACCCACCAGAAGCTGG - Intronic
1108317104 13:49247760-49247782 CCAACAAAACAACCAAATACAGG + Intergenic
1108522266 13:51257169-51257191 CATGCAAAAGAACTGAAAGCAGG - Intronic
1110738526 13:78966722-78966744 TCTGAAAAATAAACAAAAGCAGG + Intergenic
1111522984 13:89428739-89428761 CATGGAGAACAACAAAAAGCAGG - Intergenic
1112853593 13:103736306-103736328 CCTGAAAAACAAACAAATGAGGG - Intergenic
1113302855 13:109041648-109041670 CCTGCAAAACTATCACAACCAGG - Intronic
1113419502 13:110159605-110159627 CCTCCAGAACAATTAAAAGCAGG + Intronic
1114961403 14:27895114-27895136 CATGAAAAACAACCAAAAAAAGG + Intergenic
1114975575 14:28093061-28093083 CATTCAAAAGAACCAAAAACTGG - Intergenic
1115546392 14:34468285-34468307 CCTCCAAAACATACAAAATCTGG + Intergenic
1116753785 14:48920583-48920605 ACTGTAAAACAACCTCAAGCAGG - Intergenic
1118865320 14:69698602-69698624 CCTGCAAAACCAACAAAACCAGG + Intronic
1119631557 14:76236667-76236689 CCTGGGAATCAACCACAAGCAGG - Intronic
1120898058 14:89551924-89551946 CATGCAACACCCCCAAAAGCTGG + Intronic
1123885198 15:24719181-24719203 CATGAAAAACAAGGAAAAGCAGG - Intergenic
1125176621 15:36830009-36830031 ACTGCCATACAACCAAATGCAGG + Intergenic
1125208699 15:37185336-37185358 CCTACTGAACAAACAAAAGCTGG + Intergenic
1125554116 15:40569895-40569917 CCTGCAACTCAACGAGAAGCCGG + Exonic
1127152604 15:56093632-56093654 CTTGCAAACCAACCAGCAGCTGG - Exonic
1127390639 15:58502414-58502436 CCTTCAAAACAAGGAAAAGGTGG + Intronic
1127462525 15:59212331-59212353 ACAGCAAAACAACCAAGGGCAGG + Intronic
1127613310 15:60658022-60658044 CCTCCAAAAAAAGGAAAAGCGGG + Intronic
1130578755 15:85116493-85116515 CCAACAGAACAACCAAAAGCTGG - Intronic
1131054790 15:89368831-89368853 CCTGCATACAAACCAAGAGCCGG + Intergenic
1131734883 15:95321470-95321492 CAAGCAAAAAAACCAAAAGTAGG - Intergenic
1131927857 15:97405660-97405682 CCTGCAGAAAAACTAAAACCAGG - Intergenic
1133070465 16:3243459-3243481 CCTGCAAGACATCCATAAGCAGG - Exonic
1133147056 16:3796007-3796029 CCTTAAAAACAACCAAATACAGG - Intronic
1136570958 16:31096367-31096389 CCTGAAAAACAACCATTGGCCGG - Intergenic
1137592033 16:49699675-49699697 ACATCAAAACAACTAAAAGCCGG - Intronic
1137673808 16:50293892-50293914 CCTGCAAATCAGCCAAAGACAGG - Intronic
1139637853 16:68269534-68269556 CCTGCAAACCAACCGTAAGCTGG - Intronic
1140875445 16:79147735-79147757 ACTGCAACACCACCAAATGCTGG - Intronic
1141135866 16:81465041-81465063 TATCCAAAAGAACCAAAAGCAGG - Intronic
1142171556 16:88625180-88625202 CCTGTAATACAAGCAACAGCGGG - Exonic
1143852540 17:9823601-9823623 CCTCCACAACAGCCAAAAGGTGG - Intronic
1146320532 17:31843171-31843193 CCTGGAAAACTGCCCAAAGCAGG + Intergenic
1147581603 17:41630418-41630440 CCTGAAGAAGAACCACAAGCAGG - Intergenic
1148533423 17:48417125-48417147 CCTGCAAACCAAAACAAAGCTGG - Intronic
1150481619 17:65515701-65515723 CCAGCACAACAGCCAACAGCGGG + Intergenic
1150659208 17:67060919-67060941 CATCCAAAACAACCAAAAGCAGG - Intergenic
1150675266 17:67240216-67240238 CCTGCACAACATCCAAACTCTGG + Intronic
1151356984 17:73564962-73564984 ATTGGAGAACAACCAAAAGCAGG + Intronic
1151675791 17:75596735-75596757 CCTGCAAAATGGCCAAATGCCGG + Intergenic
1156734151 18:40232258-40232280 CCAGCAAAAAACACAAAAGCTGG - Intergenic
1158406239 18:57162129-57162151 CCTCCTAAACTACCAAGAGCAGG + Intergenic
1158425011 18:57331438-57331460 ACTGAAGAACAACCAAAAGCAGG + Intergenic
1159976842 18:74723855-74723877 CCTGGAAATTAAACAAAAGCTGG - Intronic
1161480536 19:4508134-4508156 TCTGCAAAGCCCCCAAAAGCAGG - Intronic
1162470131 19:10868047-10868069 TCTGCACAACAGCCAAAAGGTGG - Intronic
1162471572 19:10875251-10875273 GCTGCAAATCAAGCAACAGCTGG - Intronic
1163409526 19:17145375-17145397 CCTGCAAGGAAATCAAAAGCAGG - Exonic
1163415363 19:17183278-17183300 CCTGCAAAATAACCAAAATGGGG - Intronic
1164929555 19:32164945-32164967 CCTGCAAAACAGAGAAAAGGAGG + Intergenic
1165127416 19:33609498-33609520 CCTGAAGAAAAACCCAAAGCAGG - Intergenic
1165572376 19:36786198-36786220 CCTCTAAAACAACCACATGCTGG + Intergenic
1165964482 19:39563987-39564009 CCTTCATAAAAACCAAAAGCAGG - Intergenic
1165983454 19:39746653-39746675 CCTTCATAAGAACCAAAACCAGG + Intergenic
925594698 2:5543822-5543844 GCAGCAAAACATTCAAAAGCTGG + Intergenic
926338258 2:11881070-11881092 CCTGCAAAAAAAAAAAAAACAGG - Intergenic
926587450 2:14703395-14703417 ACTGAAAAACAATCAAAAGGAGG + Intergenic
926788853 2:16549222-16549244 CCTGAATAACAGCCAAAGGCAGG - Intergenic
926991881 2:18689033-18689055 CCTGCAGAACAAGCAGAAGAGGG - Intergenic
927195597 2:20544363-20544385 CCTGCAGAGCCACCAAAAACAGG + Intergenic
928248298 2:29651251-29651273 CGTGTAAAACAAGCAAAGGCTGG + Intronic
929030589 2:37646822-37646844 CCTGCAGAAGAAACCAAAGCAGG + Exonic
929403332 2:41611339-41611361 CCTCCAAAGCAACCCAAAACAGG - Intergenic
931986675 2:67748742-67748764 CATGCAAAACAGCCCAAGGCAGG - Intergenic
935828092 2:106971690-106971712 CCTGTAAAACAACCTCAGGCGGG - Intergenic
936882287 2:117268274-117268296 CCTGAAAAAGAACAAAAAGCAGG + Intergenic
937171099 2:119869731-119869753 ACTGGAAAGCAACCAAAAGTAGG - Intronic
938028263 2:127969686-127969708 CCAGCAAAGCCACCAGAAGCTGG - Intronic
938662273 2:133499432-133499454 CATGCAAAAAAACCAACACCAGG + Intronic
939389083 2:141543561-141543583 CCTTAAAAACAAACACAAGCTGG + Intronic
939955578 2:148525401-148525423 CCTGCCAAACAACCTAATCCTGG - Intergenic
942421320 2:175811044-175811066 TCTTCAAAACCAGCAAAAGCAGG + Intergenic
943596452 2:189863147-189863169 ACTGAAGAACAGCCAAAAGCAGG - Intronic
945715088 2:213348207-213348229 CAAGCAAAACAAAAAAAAGCAGG - Intronic
948033035 2:234835248-234835270 CCTGCAAATCAACAAAAGGCTGG - Intergenic
948181457 2:235984314-235984336 CCTTCATAACAGCCAAAAGGCGG - Intronic
1169270917 20:4198855-4198877 CCTGCAAAATAACTTAAAGATGG - Intergenic
1169559127 20:6780498-6780520 CCTACAAAACAAGCAAAACCTGG + Intergenic
1170663710 20:18366721-18366743 CCGGCAAAGCAAACCAAAGCTGG + Intergenic
1170719030 20:18859272-18859294 GCTGCAAAACAACCACTTGCTGG + Intergenic
1171121306 20:22571395-22571417 CCTGCAAAACGTCCAGCAGCTGG + Intergenic
1171220093 20:23388460-23388482 TCTGAAAAAGAACAAAAAGCTGG + Intronic
1172218709 20:33256850-33256872 CCTGCAAAGGAAGCAAAACCAGG + Intergenic
1174801602 20:53568082-53568104 GCTTCAAAACAACCAAAAATGGG + Exonic
1176040523 20:63063248-63063270 CCCGCAAAAGAACTGAAAGCAGG - Intergenic
1176377192 21:6092543-6092565 GCTGCACAACATCCAAAAGCAGG + Intergenic
1178259923 21:31089209-31089231 CATACAAAAGAACCGAAAGCAGG - Intergenic
1179746283 21:43445701-43445723 GCTGCACAACATCCAAAAGCAGG - Intergenic
1180631781 22:17234836-17234858 CCTTCAAAACAACCCCAAACAGG + Intergenic
1181182031 22:21075126-21075148 CCCAAAAAACAAACAAAAGCTGG + Intergenic
1181583430 22:23840217-23840239 CATTCAAAAGAATCAAAAGCAGG + Intergenic
1182197251 22:28531226-28531248 AATGGAAAACAACAAAAAGCAGG + Intronic
1182315295 22:29442129-29442151 ACTGCAAAAAAACAAAAAACAGG + Exonic
1182679530 22:32067969-32067991 CCAGCACAACCACCAAAACCAGG - Exonic
1184537443 22:45096815-45096837 TCTTCACAACAGCCAAAAGCTGG + Intergenic
1185100837 22:48840135-48840157 ACTGCCAAACAGCCAAAAGGAGG - Intronic
949410956 3:3763783-3763805 CCTTCAAAGCCACCAAAACCTGG + Intronic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953632834 3:44634171-44634193 CATGAAAAACAAACAAAAGATGG - Intronic
954271143 3:49510397-49510419 CCTGAAAAAAAAAGAAAAGCAGG - Exonic
955074682 3:55602459-55602481 CCAGGAAAACAACCAAAAACAGG + Intronic
955377119 3:58407048-58407070 CATCCAAAAGAATCAAAAGCAGG - Intronic
955582169 3:60435573-60435595 CCTGAAAAGAAACCAAAAGAAGG - Intronic
960820666 3:121727411-121727433 ACTGGAGAGCAACCAAAAGCAGG + Intronic
961127146 3:124429927-124429949 CTTGCAAAATAACCAAGAGTAGG - Intronic
961422449 3:126817087-126817109 CTTGCAAAACAATCCACAGCAGG - Intronic
962234900 3:133699491-133699513 CCTGAACAACACCCAGAAGCTGG + Intergenic
963132461 3:141871445-141871467 TTTGAAAAACAACCAAAAGAAGG - Intergenic
964106571 3:153046641-153046663 CCTTAAGAAAAACCAAAAGCAGG - Intergenic
964144101 3:153437837-153437859 CATGCAAAACCACCAGAAACAGG - Intergenic
964651787 3:159019592-159019614 CCTCCAAAACAAACTAAAACAGG + Intronic
965608004 3:170515673-170515695 CATGAAAAACAACCAAGAGAGGG - Intronic
965717104 3:171616896-171616918 CCTTCAAAACAAACTAAAACGGG - Intronic
966142462 3:176771376-176771398 CCTTCATAAGAACCAAAAACAGG - Intergenic
966487415 3:180486693-180486715 AGTGGAAAACAAACAAAAGCAGG + Intergenic
970708537 4:18834356-18834378 CTTGCAGAACATACAAAAGCAGG - Intergenic
971539556 4:27798766-27798788 TCTTCAAAACAGCCAAAAACTGG + Intergenic
971996576 4:33973152-33973174 CTTGCAATACAAATAAAAGCAGG - Intergenic
972041080 4:34600507-34600529 CCTGGAAAACAACAAAACTCTGG - Intergenic
973318899 4:48789969-48789991 CCTGGAAAACAACTCAAAGTAGG + Intergenic
974546819 4:63322028-63322050 CCTGCAAAAGAACAAAAAATAGG - Intergenic
975766144 4:77669658-77669680 TATGCAAAATAACTAAAAGCGGG - Intergenic
977709109 4:100104458-100104480 CCTTCTAAGCAACCAAAAGCAGG + Intergenic
977831688 4:101601831-101601853 ACTGTAAAACAACCTCAAGCAGG + Intronic
979919992 4:126484456-126484478 CCTTCAAAACAAACAAAACAAGG + Intergenic
980026905 4:127778923-127778945 CAGGCAAGAAAACCAAAAGCTGG + Intergenic
980347856 4:131646298-131646320 CCTGAAAAAGAAGAAAAAGCTGG + Intergenic
980733714 4:136855261-136855283 CCTACAAAAAAAAAAAAAGCAGG - Intergenic
981378402 4:144042334-144042356 TCTGCAAAACAAGCAATAGTAGG + Intergenic
981576198 4:146208394-146208416 CCAGCAAACCTACCAGAAGCGGG - Intergenic
982344250 4:154339250-154339272 CCTGAAAAAGAACAAAAAGGTGG - Intronic
982405002 4:155009555-155009577 GCTGCAAATCAAACAAAAGGAGG + Intergenic
982858720 4:160419820-160419842 ACTGAAGAACAACCAAAAGTAGG + Intergenic
983194975 4:164797031-164797053 CCAGTAGAACAACCTAAAGCAGG - Intergenic
984000267 4:174232913-174232935 AATAGAAAACAACCAAAAGCAGG + Intergenic
986447419 5:7834080-7834102 ACTGTAAAACAACCTCAAGCAGG + Intronic
986796283 5:11215760-11215782 CCTGGAAGACTACCAAAAGGGGG + Intronic
988563023 5:32297996-32298018 CCTTCAACAGAACCAGAAGCAGG + Intronic
988910300 5:35833975-35833997 CCTGCAAAAAAAAAAAAAACGGG + Intergenic
990976421 5:61565379-61565401 GCCCCAAAACAACCAAAAGAAGG - Intergenic
990977024 5:61569320-61569342 CCTGCAGCACACCCAACAGCTGG - Intergenic
991603172 5:68373648-68373670 TCTTCAAAGCAAGCAAAAGCTGG - Intergenic
991944225 5:71883881-71883903 CCTGGAGAACAACCTCAAGCTGG + Intergenic
994827417 5:104732432-104732454 TATGCACAACAGCCAAAAGCTGG + Intergenic
995456282 5:112355970-112355992 ACTGCAAAATAACCATAAGAGGG - Intronic
997877572 5:137563085-137563107 TCTGTAAAACACACAAAAGCGGG + Intronic
998318684 5:141208949-141208971 CCAGCAAAACAAAGAAAAGCAGG - Exonic
998486230 5:142504912-142504934 TCTACAAAACAACCTAAAGGCGG - Intergenic
1001478253 5:172066244-172066266 TCTGAAAACCAAACAAAAGCAGG + Intronic
1003529314 6:6924800-6924822 CCTGCAAAATCACCAAGAACTGG + Intergenic
1004049132 6:12057440-12057462 CATGCAAAACTACCAAAAAAGGG - Intronic
1004809989 6:19249250-19249272 AATGGAAAACAAACAAAAGCAGG + Intergenic
1004831753 6:19484042-19484064 AATGGAAAACAAACAAAAGCAGG + Intergenic
1005105065 6:22215149-22215171 ACTGCAAAACAACCTCAGGCAGG + Intergenic
1005389966 6:25323041-25323063 TCTGCAAAACAACCAAGAATAGG - Intronic
1005725322 6:28641964-28641986 GCTTCAAAACAACCAAAATTGGG + Intergenic
1006990705 6:38212542-38212564 CCTGAAAAATAACAAAAACCAGG + Intronic
1013303686 6:108828519-108828541 TCTTCACAACAACCAAAAGCTGG + Intergenic
1014692305 6:124577226-124577248 CCTTCATAAGAACCAAAATCAGG + Intronic
1016153849 6:140779990-140780012 CCTTCATAAAAACCAAAATCAGG + Intergenic
1017341326 6:153325739-153325761 CATGCAAACAAACCAAAACCTGG + Intergenic
1017527436 6:155254039-155254061 CCTGCAACACAACTGAAAGATGG - Exonic
1018716974 6:166540858-166540880 CCTGCACAAAAAACAAAGGCAGG + Intronic
1021308104 7:19056204-19056226 TCTTCAAAAGAACCAAAATCTGG - Intronic
1022666080 7:32412085-32412107 CCTGTAAAACAGCCTCAAGCAGG - Intergenic
1024088494 7:45916743-45916765 GCTGCACAACTACCAAAAGTGGG + Intronic
1025272103 7:57532121-57532143 TATTCAAAACAACCAAAAGGTGG - Intergenic
1025950345 7:66140323-66140345 TCTGAAAAGCAAACAAAAGCAGG - Intronic
1026240555 7:68571128-68571150 TTTGTAAAGCAACCAAAAGCAGG + Intergenic
1026915837 7:74120027-74120049 AATGCAAAACAACCAGAAGGTGG - Intronic
1027565236 7:79783680-79783702 ACTGCAAAATAACCAAAAATTGG - Intergenic
1029643951 7:101839696-101839718 CTTGCAAATCAACAAAAAGATGG - Intronic
1030222308 7:107109936-107109958 CCTTCATAAGAACCAAAATCAGG + Intronic
1030263228 7:107588552-107588574 CTTGTAGAGCAACCAAAAGCAGG + Intronic
1030513254 7:110511283-110511305 CCTTCAAAACCAGCAAAAGTTGG + Intergenic
1030932670 7:115544419-115544441 ACTCCAAATCACCCAAAAGCTGG - Intergenic
1032480850 7:132245587-132245609 CCTGCAAAACAACCAAAAGCAGG + Intronic
1034990329 7:155543990-155544012 CCTCCAAGACAACAGAAAGCAGG + Intergenic
1035114309 7:156509976-156509998 ACTGGAAAACAACCAAAGGCAGG + Intergenic
1035430056 7:158812662-158812684 CATTCAAAACAGCCAAAAGGTGG + Intronic
1035825627 8:2641656-2641678 CTTGCAGAACATCCAAATGCTGG - Intergenic
1035925117 8:3719794-3719816 CCTGTTAAAGATCCAAAAGCTGG - Intronic
1036786220 8:11689506-11689528 CCTTCAAAATAAACAAAAGAAGG - Intronic
1038688798 8:29742564-29742586 CCTGCCAAGAAACCATAAGCCGG + Intergenic
1041193755 8:55379676-55379698 CCTGCAACAAAACCAGAAGCAGG - Intronic
1042687112 8:71454088-71454110 CATGGAAAACAAAAAAAAGCAGG + Intronic
1043925692 8:86034083-86034105 CCTGCAAAACAAACAAAGCAAGG - Intronic
1045418972 8:101995298-101995320 CATGCAAAACAAACTAAACCCGG + Intronic
1047035482 8:120933814-120933836 CCTGCCAGACATCCACAAGCAGG - Intergenic
1048744696 8:137601016-137601038 CCTGCAAAACAAGCAGAAATCGG - Intergenic
1050069033 9:1791305-1791327 CCTGCTAAACAACCTAAAGTAGG - Intergenic
1050582019 9:7068619-7068641 CCAGCAAAGAAACCAAAACCAGG - Intronic
1052356442 9:27509715-27509737 CCTCCAAAAAAACAAAAAACAGG - Intronic
1057500614 9:95594364-95594386 CCTTAAAAACAACCTGAAGCTGG - Intergenic
1058126006 9:101195722-101195744 TCTGGAAAACAACACAAAGCAGG - Intronic
1058264655 9:102883360-102883382 CCTTCATAAGAACCAAAAACAGG - Intergenic
1060066821 9:120509329-120509351 CCTGCCACACAATTAAAAGCAGG + Intronic
1061468465 9:130802683-130802705 CCTGCAGATCAACAAAATGCTGG - Intronic
1061583609 9:131553019-131553041 ACTGAAAGACAAACAAAAGCAGG - Intergenic
1062402024 9:136376932-136376954 CCTGAGAAACCACCAGAAGCAGG - Intronic
1187680166 X:21759839-21759861 TCTGCACATCATCCAAAAGCAGG + Intergenic
1188225654 X:27593486-27593508 ACTCCACAACAACCAAAAGGTGG - Intronic
1189159981 X:38801522-38801544 CCTGCAAAACTTCCCAAACCGGG - Intronic
1190705774 X:53026955-53026977 CAAGCAAACCAACCAAATGCCGG - Intergenic
1192091215 X:68158488-68158510 CCAGCAAAACAACCACAACTGGG + Intronic
1194761545 X:97801738-97801760 AATGGAAAACAACAAAAAGCAGG - Intergenic
1195674452 X:107497206-107497228 CCTAAAATAAAACCAAAAGCTGG - Intergenic
1196004776 X:110823937-110823959 ACTGGAAAACAACAGAAAGCAGG + Intergenic
1196279295 X:113804037-113804059 CATGCAAAAGAAAAAAAAGCTGG - Intergenic
1199660488 X:150044932-150044954 CCTTCATAAGAACCAAAATCAGG - Intergenic
1200380474 X:155832278-155832300 CATGCTAAACAGTCAAAAGCAGG + Intergenic
1201942477 Y:19474649-19474671 CCTAAAAAACAAGCAAAAACAGG - Intergenic