ID: 1032483522

View in Genome Browser
Species Human (GRCh38)
Location 7:132265493-132265515
Sequence AGCAATATGAAGGGTGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032483522 Original CRISPR AGCAATATGAAGGGTGTGTA TGG Intronic
903199809 1:21726012-21726034 AGCAATATGAAGGCTATCAAAGG + Intronic
903252540 1:22066616-22066638 GGTAATATGAAAGGAGTGTAAGG + Intronic
904846426 1:33421859-33421881 AGCAATGTGAAGGGTGGTTTGGG - Intronic
905730920 1:40299208-40299230 AGCAATTTGAAGGGGCTGAAAGG - Intergenic
907394889 1:54182421-54182443 AGCCATAAGATGGGTGTGTCTGG + Intronic
907897382 1:58704409-58704431 GACAATCTGAAGGGTGTGAAAGG + Intergenic
910147344 1:84097497-84097519 ACCAATAGGAGGGGTGTGTGTGG + Intronic
912209912 1:107546072-107546094 AGGAATATGTAGAGTGAGTAGGG - Intergenic
913030367 1:114896855-114896877 GACATTTTGAAGGGTGTGTAAGG + Intronic
916274679 1:162980864-162980886 GGTAATATGAGGGGTGGGTATGG - Intergenic
916819118 1:168381002-168381024 AGCCATTTGAAGGGTGTTTCGGG + Intergenic
920841917 1:209562327-209562349 AGCACAGTGCAGGGTGTGTAGGG + Intergenic
921400454 1:214716854-214716876 TGCAATATGAAAGATGTGTAGGG + Intergenic
922085048 1:222338507-222338529 AACAATCTGAAGGGTGTGGGTGG - Intergenic
922086877 1:222357582-222357604 AGACATTTGAAGGGTGAGTAAGG - Intergenic
1064051454 10:12063420-12063442 TACAAAATGAGGGGTGTGTATGG + Intergenic
1064768541 10:18699466-18699488 AGCATTATGAAGGCAGTGTGGGG + Intergenic
1067278812 10:44856030-44856052 AGCAATGTGAAGTGTTTGAAGGG - Intergenic
1068213425 10:53952275-53952297 AGCCATCTGAAGGGTGAGCAAGG + Intronic
1068384025 10:56299842-56299864 AGCAATATAATGTGTGTGTGTGG + Intergenic
1069048719 10:63769659-63769681 AGCAAGAGGAATGGTGTGTGAGG - Intergenic
1070427870 10:76307118-76307140 AGCAACATGAGGGGTGGGCAAGG - Intronic
1073647137 10:105316876-105316898 AGGAATATGAATGCTGTGCAGGG + Intergenic
1075245293 10:120817204-120817226 TGAAATGTGAAGGTTGTGTATGG - Intergenic
1077237593 11:1489212-1489234 AGCAATAGGAAGAGTGAGTGGGG - Intronic
1079593006 11:22204345-22204367 AGCAATATAAATTGTTTGTATGG - Intronic
1080065447 11:28006948-28006970 AGCAATATGAAAGTTTTGAAGGG - Intergenic
1080493678 11:32795061-32795083 AGCAATGGGAAGTGTGTGGATGG + Intergenic
1084893711 11:72250374-72250396 AGCAATGTGCAGGGAGTCTAAGG + Intergenic
1086974520 11:93116888-93116910 CGCAATTTGAAGGGTGAGCAGGG - Intergenic
1089204729 11:116750702-116750724 AGTAATATGAAGGATTTGAAAGG - Intronic
1092106729 12:5926581-5926603 AACTAGATGAAGAGTGTGTAGGG - Intronic
1097892168 12:64788170-64788192 AGAAGGAAGAAGGGTGTGTAGGG + Intronic
1101542353 12:105676717-105676739 AGAAATAAGGAGGGTGTGAATGG - Intergenic
1105708996 13:22987178-22987200 AGCAATATTAAGGCTGTACACGG - Intergenic
1107061569 13:36165157-36165179 GGTAATATCAAGGGTATGTAAGG - Intergenic
1107079380 13:36357924-36357946 GGCAATATGAAGGTTTTGGATGG + Intronic
1107507760 13:41052050-41052072 AGCTACTTGAAGGGTGTGTCAGG - Intronic
1111890273 13:94072905-94072927 AGCAAGATGAAAGGTGAATAAGG + Intronic
1111895449 13:94136359-94136381 GGCGATAAGAAGGGTGTGCATGG + Intronic
1113236081 13:108276648-108276670 AGGAATGTGAAGGGTGAGGAAGG + Intronic
1115768104 14:36644626-36644648 AGAAATTTGAAGGCTGGGTATGG - Intergenic
1118338245 14:64873146-64873168 AGCAATATGAAGGGAAAGAAGGG - Intronic
1121880747 14:97498416-97498438 AGCAAAAGGAAGGGTGTGTTGGG - Intergenic
1122009820 14:98736870-98736892 GGCAATGTGAAGGGTGTGGGTGG - Intergenic
1127258645 15:57311575-57311597 AGCAATAAGAAGTGTGTTTTGGG - Intergenic
1129061862 15:72866918-72866940 AGCAAGGTGAAGGGGCTGTACGG - Intergenic
1131516903 15:93084903-93084925 AGTAATGTGAGGGATGTGTAGGG + Intronic
1133418460 16:5624927-5624949 AGCAAAATGCACGGTCTGTAGGG + Intergenic
1137763405 16:50958971-50958993 AGCCATATGAGGGTTGTCTAAGG - Intergenic
1137994738 16:53198118-53198140 AGCAATATGAACAGAGTGTTTGG + Intronic
1140416749 16:74779285-74779307 AACAACAGGAATGGTGTGTATGG + Intergenic
1143989752 17:10946798-10946820 AAGAATGAGAAGGGTGTGTATGG - Intergenic
1144664546 17:17092997-17093019 AGTAATTTGAAGGGTGGGGAGGG + Intronic
1145997287 17:29111934-29111956 AGCATTCTGTAGGGTGTGTTTGG - Intronic
1151521306 17:74632284-74632306 GGCATTTTGAAGGATGTGTAGGG - Intergenic
1159295499 18:66481543-66481565 ACCAATATTAAGTGTGTGTGTGG + Intergenic
1160617483 18:80143082-80143104 AGCAATATAGAGGTTATGTAGGG + Intronic
1165207395 19:34202094-34202116 AGCAATAATAAGGGTGGGCATGG - Intronic
1167956340 19:53067531-53067553 AGCACCATGGAAGGTGTGTAAGG + Exonic
928912461 2:36436285-36436307 AGGAAGATGCAGGGTGAGTAGGG + Intronic
930731349 2:54731075-54731097 AGAAACCTGAAGGGTGTGAAGGG + Intronic
934908753 2:98230669-98230691 AGCTGTAGGAAGGGTGTGCAAGG - Intronic
935863904 2:107364012-107364034 GGCAATATGAAGTCTGTGTAAGG - Intergenic
938487512 2:131726495-131726517 AGCAATATGAAGGATCTGTTTGG + Intronic
939362034 2:141184823-141184845 ATAAAGATGAAGGGTATGTAAGG - Intronic
940170869 2:150828826-150828848 AGCAATATAAAGACTGTTTAGGG - Intergenic
941060316 2:160839980-160840002 AGCACTAGGAAGAGAGTGTAAGG + Intergenic
944450822 2:199840673-199840695 AGGAAATTGAAGTGTGTGTATGG + Intronic
945241889 2:207683771-207683793 AGCAATATGAAGAGAGTTTGTGG + Intergenic
946135857 2:217646399-217646421 ATCATGATAAAGGGTGTGTATGG - Intronic
946885406 2:224217535-224217557 GACAATTTGAAGGGTGAGTAAGG - Intergenic
1168951621 20:1805773-1805795 ACCAATATCAAGAGTGTGTTTGG + Intergenic
1174906545 20:54557820-54557842 AGCAATAAGAGGGATGTGGAAGG - Intronic
1177429013 21:20965211-20965233 AGCAATATTAAGTGTGGGCAAGG + Intergenic
1183470162 22:38000967-38000989 GGCAAGATGAAGGGTATGAACGG + Intronic
1185132669 22:49048531-49048553 GTCAATATGAAGGGTGTATCTGG + Intergenic
1185257719 22:49845314-49845336 AGTCAGATGAAGGGTGCGTAAGG + Intergenic
950199771 3:11034705-11034727 GGCAATTTGAAGGGTGGGGAAGG - Intronic
953790446 3:45943293-45943315 AGCAGAATGAAGGGAGTGTGGGG + Intronic
957549867 3:81689960-81689982 GACAATTTGAAGGGTGAGTAAGG - Intronic
958921393 3:100109958-100109980 AACAGTTTGAAGGGTGGGTATGG - Intronic
960714400 3:120560796-120560818 AGCAACAGGAAAGGTGAGTAGGG - Intergenic
960724062 3:120652558-120652580 AGCAGTAGGGAGGGTGTGGATGG + Intronic
962629618 3:137263174-137263196 AGGAATATGGAGGGTGGGAATGG - Intergenic
963598646 3:147358750-147358772 AGCAATGTGAAGGGGCTGTGGGG - Intergenic
964312280 3:155407285-155407307 AACAATATGAACTGTGTATAAGG - Intronic
966200995 3:177359521-177359543 AGCAATTTGCAGGGTGAGAACGG + Intergenic
967307853 3:188076344-188076366 AGCATTATGGAGGGTGTCTCTGG + Intergenic
971397957 4:26247698-26247720 AGTATTATGAAGGCTGGGTACGG - Intronic
972981500 4:44709217-44709239 ACCATTATGAAGGGAGTGGAGGG + Intronic
976177924 4:82373436-82373458 AGGAGGATGAAGGGTGAGTAAGG - Exonic
978371050 4:108029831-108029853 AGCAATAGGAAGAGTGAGGACGG - Intronic
978750983 4:112247180-112247202 AGTAACATGAAGTGTATGTATGG + Intronic
983643273 4:169963694-169963716 ATAAATATGAAGTGTGTGTGTGG - Intergenic
984159539 4:176234341-176234363 AGCAAACAGAAGGTTGTGTAAGG - Intronic
984244989 4:177264157-177264179 AGAAAATTGAAGGGTGAGTAAGG - Intergenic
987048731 5:14131444-14131466 ATATATTTGAAGGGTGTGTAAGG + Intergenic
989257608 5:39382223-39382245 TGCAACATGATGGGTGTGCAGGG + Intronic
991390995 5:66143782-66143804 AGTAAGATGAAGGCTGTGCAGGG - Intronic
992126404 5:73646601-73646623 AGCAAGATGAAGAGTGTTTGGGG - Intronic
996093769 5:119376954-119376976 AGAAAAATGAAATGTGTGTATGG - Intronic
998142078 5:139705688-139705710 CCCAATCAGAAGGGTGTGTAGGG + Intergenic
1000163721 5:158626692-158626714 AGGAAGATGAGGGGTGTGTGAGG - Intergenic
1003821298 6:9900093-9900115 ATCAATATCCAGGGTGGGTAAGG + Intronic
1003966971 6:11261975-11261997 AGGAATTTGAAAGGTGTTTAAGG - Intronic
1004642972 6:17533264-17533286 ACCAATATGCAGTGTGTGGAAGG - Intronic
1007511869 6:42380210-42380232 AGCAATGTGAGGGGTGGGTGGGG + Intronic
1008546660 6:52589387-52589409 AGCAATATGATGACTCTGTAGGG + Intergenic
1010004637 6:70981694-70981716 AGCAATATGAAGCCTGAGTGAGG - Intergenic
1011401251 6:86964297-86964319 AGCAATATGTAGGATTTTTAAGG - Intronic
1012890287 6:104889478-104889500 AGCAAAATGAAGTGGGTATATGG - Intergenic
1013685473 6:112576293-112576315 TGCAATATGAAGTGTGCTTAAGG + Intergenic
1014965531 6:127743426-127743448 AGAAATATGACTGGTGTTTAAGG + Intronic
1015234959 6:130960170-130960192 TGCATTATGAAGTGTGTGTGAGG - Intronic
1016689643 6:146922225-146922247 AGCAATGTGAAGGGTGTCGTGGG + Intergenic
1020851717 7:13361814-13361836 AACAAGATGAAGGGGGTGCAAGG - Intergenic
1023004239 7:35846058-35846080 AGTAATATGAAGGAAGTATATGG + Intronic
1023206337 7:37754196-37754218 AGCTATTTGAAGGATGTGTGTGG + Intronic
1023288861 7:38648040-38648062 ACCAATATGAATTTTGTGTATGG + Intergenic
1023577416 7:41643237-41643259 TGCAATATGAAGGGAATCTAGGG - Intergenic
1024632854 7:51263409-51263431 AGCAATATGGGGGGTGGATAAGG + Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1031068483 7:117134903-117134925 AGCCTTAGGAAGGGTCTGTAAGG - Intronic
1032483522 7:132265493-132265515 AGCAATATGAAGGGTGTGTATGG + Intronic
1033571374 7:142632114-142632136 AGCAATATGCAGGGGGTGGTGGG + Intergenic
1037884002 8:22586779-22586801 AGGAAAATGAAGGGTGTGGGAGG + Intronic
1037925702 8:22842651-22842673 AGCCATAGGAAGGGTGTGCAGGG + Intronic
1037996562 8:23356742-23356764 AGGAAAATGCAGAGTGTGTAAGG + Intronic
1038300024 8:26335985-26336007 AGGAAGGTGAAGGGTGTGTGGGG - Intronic
1038405606 8:27320227-27320249 GACAATTTGAAGGGTGAGTAAGG - Intronic
1038599865 8:28929295-28929317 AGCAAGTTGAAGGGTATGTTTGG + Intronic
1039202273 8:35109035-35109057 AGGAATATGAAAGGTAAGTATGG + Intergenic
1040913754 8:52547048-52547070 AGTAATAAAAAGGGTGTGCATGG - Intronic
1041688312 8:60664723-60664745 AGCAATATGAATTGTGTGGTAGG - Intergenic
1042086776 8:65117884-65117906 AGACATAGGAAGGGTGTTTATGG - Intergenic
1044818014 8:96132674-96132696 AACAATATCAAGGATGTGGATGG + Intergenic
1045330090 8:101148148-101148170 GGCCCTATGAAGGCTGTGTAAGG - Intergenic
1048751512 8:137681983-137682005 AACAGGATGAAGGGTGTGTTAGG - Intergenic
1050853583 9:10321321-10321343 TGCAATATGAAGAGTGAGAAGGG + Intronic
1052883756 9:33623565-33623587 AGCAATATGCAGGGGGTGGGGGG + Intergenic
1053582789 9:39424609-39424631 AGCAATGTGAAGGGGGAGGAAGG - Intergenic
1054104368 9:60983352-60983374 AGCAATGTGAAGGGGGAGGAAGG - Intergenic
1054581976 9:66923498-66923520 AGCAATGTGAAGGGGGAGGAAGG + Intronic
1056322993 9:85454004-85454026 AACAATAGGAAGGGTGAGGAAGG - Intergenic
1056457498 9:86774900-86774922 GGTAATAGGAAGGGTGGGTAAGG + Intergenic
1056474960 9:86945343-86945365 AGCAATTTGAAGGGTTGGGAAGG - Exonic
1056967443 9:91177089-91177111 AACAATAAGAAGGTTGTTTATGG + Intergenic
1057429979 9:94984871-94984893 AGCAAATTGAAGGGTGTCTATGG - Intronic
1058731695 9:107856670-107856692 GACAATTTGAAGGGTGAGTAAGG + Intergenic
1059020080 9:110566933-110566955 AGCAATATAAAGTGTTTGGAAGG - Intronic
1060008752 9:120024885-120024907 AGCAAGATGAAAGCTGTGGAAGG + Intergenic
1061042168 9:128146506-128146528 AGCACTAGGAAGGTTGGGTAAGG - Intergenic
1186552431 X:10521097-10521119 AGCAAGAGAAAGAGTGTGTATGG + Intronic
1189116751 X:38350826-38350848 ACCAATATGAGTTGTGTGTATGG + Intronic
1189666412 X:43359538-43359560 ATCAATGTGAAGGGTATGTTTGG - Intergenic
1193254401 X:79330091-79330113 GGCAATTTGAAGGGTGAATAAGG + Intergenic
1195504747 X:105644259-105644281 ATCAATATTAAGGGTGTGTCAGG + Intronic
1196409917 X:115407480-115407502 GGCAATAGGATAGGTGTGTAGGG - Intergenic
1197961284 X:132008926-132008948 AGCATCGTGAAGGGTATGTATGG - Intergenic
1198074987 X:133185456-133185478 GACAATTTGAAGGGTGAGTAAGG - Intergenic
1198647340 X:138823493-138823515 GACAATTTGAAGGGTGAGTAAGG - Intronic
1200090826 X:153635179-153635201 AGCAATGTGAGGGGTGATTATGG + Intergenic
1200941162 Y:8783527-8783549 GGCAATATGAAAGGTGTCAAGGG - Intergenic
1201457667 Y:14187779-14187801 AGCAGTATGAAGGGTTGGTGAGG + Intergenic
1201903983 Y:19071085-19071107 AGCAATGGGAAGATTGTGTAGGG - Intergenic