ID: 1032484018

View in Genome Browser
Species Human (GRCh38)
Location 7:132269403-132269425
Sequence TCTCCACAGCTCCACCAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032484005_1032484018 15 Left 1032484005 7:132269365-132269387 CCCCGCCCCCACCATCTGCCCTC 0: 1
1: 0
2: 6
3: 126
4: 969
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data
1032484000_1032484018 25 Left 1032484000 7:132269355-132269377 CCCCTGCCTCCCCCGCCCCCACC 0: 1
1: 4
2: 68
3: 747
4: 5209
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data
1032484010_1032484018 8 Left 1032484010 7:132269372-132269394 CCCACCATCTGCCCTCCCATGAC 0: 1
1: 0
2: 2
3: 25
4: 327
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data
1032483999_1032484018 26 Left 1032483999 7:132269354-132269376 CCCCCTGCCTCCCCCGCCCCCAC 0: 1
1: 10
2: 87
3: 1834
4: 12343
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data
1032484007_1032484018 13 Left 1032484007 7:132269367-132269389 CCGCCCCCACCATCTGCCCTCCC 0: 1
1: 0
2: 26
3: 220
4: 1861
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data
1032484008_1032484018 10 Left 1032484008 7:132269370-132269392 CCCCCACCATCTGCCCTCCCATG 0: 1
1: 0
2: 7
3: 57
4: 529
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data
1032484013_1032484018 -3 Left 1032484013 7:132269383-132269405 CCCTCCCATGACGACAGCCTTCT 0: 1
1: 0
2: 1
3: 7
4: 152
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data
1032484009_1032484018 9 Left 1032484009 7:132269371-132269393 CCCCACCATCTGCCCTCCCATGA 0: 1
1: 0
2: 3
3: 21
4: 369
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data
1032484003_1032484018 19 Left 1032484003 7:132269361-132269383 CCTCCCCCGCCCCCACCATCTGC 0: 1
1: 0
2: 32
3: 268
4: 2224
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data
1032484006_1032484018 14 Left 1032484006 7:132269366-132269388 CCCGCCCCCACCATCTGCCCTCC 0: 1
1: 0
2: 8
3: 187
4: 1903
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data
1032484001_1032484018 24 Left 1032484001 7:132269356-132269378 CCCTGCCTCCCCCGCCCCCACCA 0: 1
1: 1
2: 31
3: 279
4: 2174
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data
1032484012_1032484018 4 Left 1032484012 7:132269376-132269398 CCATCTGCCCTCCCATGACGACA 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data
1032484015_1032484018 -7 Left 1032484015 7:132269387-132269409 CCCATGACGACAGCCTTCTCCAC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data
1032484016_1032484018 -8 Left 1032484016 7:132269388-132269410 CCATGACGACAGCCTTCTCCACA 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data
1032484002_1032484018 23 Left 1032484002 7:132269357-132269379 CCTGCCTCCCCCGCCCCCACCAT 0: 1
1: 0
2: 35
3: 1096
4: 3763
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data
1032484011_1032484018 7 Left 1032484011 7:132269373-132269395 CCACCATCTGCCCTCCCATGACG 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data
1032484014_1032484018 -4 Left 1032484014 7:132269384-132269406 CCTCCCATGACGACAGCCTTCTC 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data
1032484004_1032484018 16 Left 1032484004 7:132269364-132269386 CCCCCGCCCCCACCATCTGCCCT 0: 1
1: 0
2: 11
3: 128
4: 1117
Right 1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032484018 Original CRISPR TCTCCACAGCTCCACCAGAC CGG Intronic
No off target data available for this crispr