ID: 1032485541

View in Genome Browser
Species Human (GRCh38)
Location 7:132284582-132284604
Sequence TGTCCACTAGAACACCCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032485527_1032485541 20 Left 1032485527 7:132284539-132284561 CCTAGCCAAAGGCCACGTCTCAG 0: 1
1: 0
2: 0
3: 14
4: 152
Right 1032485541 7:132284582-132284604 TGTCCACTAGAACACCCAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 81
1032485530_1032485541 15 Left 1032485530 7:132284544-132284566 CCAAAGGCCACGTCTCAGGGAAG 0: 1
1: 0
2: 3
3: 31
4: 198
Right 1032485541 7:132284582-132284604 TGTCCACTAGAACACCCAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 81
1032485535_1032485541 8 Left 1032485535 7:132284551-132284573 CCACGTCTCAGGGAAGGGGGTTG 0: 1
1: 0
2: 2
3: 11
4: 189
Right 1032485541 7:132284582-132284604 TGTCCACTAGAACACCCAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 81
1032485526_1032485541 21 Left 1032485526 7:132284538-132284560 CCCTAGCCAAAGGCCACGTCTCA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 1032485541 7:132284582-132284604 TGTCCACTAGAACACCCAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032485541 Original CRISPR TGTCCACTAGAACACCCAAG GGG Intronic
901680311 1:10909336-10909358 TGCCCACTATGACAGCCAAGTGG - Intergenic
903963779 1:27073331-27073353 TGTCCTGTAGGACACCCAACAGG - Intergenic
905638371 1:39571289-39571311 TGTCCACTTCGAGACCCAAGAGG - Exonic
911869425 1:103075853-103075875 TTTCCACTAGAACATTCAACTGG + Intronic
916450032 1:164912058-164912080 TGTGCACAAGGACACCCAATGGG - Intergenic
916675874 1:167063996-167064018 TGTAAACTAGAACACACATGAGG - Intronic
1071355421 10:84789054-84789076 TGTGCACAGAAACACCCAAGTGG - Intergenic
1073323106 10:102627642-102627664 TGCCCACCAGAACTCCCCAGCGG - Intronic
1075976561 10:126701254-126701276 TGGCCACTGGAACACCCAGTAGG - Intergenic
1078658741 11:13267156-13267178 TGTACACAAGAAGACCCAAAGGG - Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1085690321 11:78658947-78658969 TGACCACCAGAACATCCAGGTGG + Intronic
1093781417 12:23141587-23141609 TGTCCACTGGAAAACCCAAAGGG - Intergenic
1097688018 12:62709288-62709310 TCTCCCCTAGAATCCCCAAGAGG + Intronic
1099117480 12:78645815-78645837 TATCCACTACAACACTCTAGTGG - Intergenic
1099160821 12:79239748-79239770 TGTCAACTAGACCACAGAAGAGG + Intronic
1101499840 12:105292934-105292956 TGCCAACTAGAACTCCAAAGTGG - Intronic
1106082857 13:26514962-26514984 TGTACAGAAGAACACCCGAGAGG + Intergenic
1106295093 13:28405533-28405555 TGTCCACTTGAACATCAAACTGG - Intronic
1112396167 13:99034304-99034326 TCTCCAGTAGCACACCCAAGAGG + Intronic
1118905415 14:70019809-70019831 TGTGCAAAAGAAGACCCAAGAGG - Intronic
1122034340 14:98936543-98936565 TCTCCCCTAGAACCTCCAAGAGG + Intergenic
1122320788 14:100854576-100854598 AGTCCACAAGCACACCCAGGAGG - Intergenic
1128605976 15:69037020-69037042 AGTCCAATAGAACACCTATGGGG - Exonic
1129647576 15:77450930-77450952 TGCCCACTTGATGACCCAAGAGG - Intronic
1130088115 15:80795494-80795516 TGTCCAGGAGAACTCCCAGGTGG + Intronic
1133391179 16:5411448-5411470 TCTCCACTAGAGCATCCAGGAGG + Intergenic
1139712468 16:68786760-68786782 TGTCCAATAGAGCTCACAAGAGG - Intronic
1139805823 16:69565255-69565277 TTTCCTCTAGAACAGCCAGGTGG + Intronic
1140738111 16:77916943-77916965 TGTCTATTAGAACTCCCAACTGG - Intronic
1142131031 16:88431556-88431578 TGGCAACTGGAACCCCCAAGGGG - Exonic
1148761916 17:50008335-50008357 TGTACATTAAAACACCCATGAGG + Intergenic
1149962933 17:61131951-61131973 TGAGAATTAGAACACCCAAGAGG - Intronic
1153819313 18:8819537-8819559 TGTCCCATAAAACACACAAGAGG + Intronic
1163867670 19:19787727-19787749 TGTCCACAAGAGCACACAAATGG - Intronic
1164830874 19:31319663-31319685 TTTCTACTAGAACACTGAAGAGG + Intronic
1165342635 19:35223834-35223856 TGTCCCCACGATCACCCAAGAGG - Intergenic
925556407 2:5135318-5135340 TGCCCCCTAAAACACCCAAAGGG - Intergenic
928047164 2:27947322-27947344 TGAACACTAGAACAGCCATGGGG - Intronic
928236357 2:29544978-29545000 TGTCCAGTAGAACACTCACTGGG + Intronic
934518394 2:95003854-95003876 TATCCACTACCACACTCAAGAGG - Intergenic
935688858 2:105712305-105712327 TGGCCACTGGAACCCCCAGGGGG - Intergenic
941128268 2:161613528-161613550 TTTCCACTAGAACATCCACTGGG - Intronic
941287568 2:163632720-163632742 TTTCTCCTAGAACACCAAAGAGG - Intronic
944091038 2:195912277-195912299 TGTGCTCTAGAAAATCCAAGGGG - Intronic
944235064 2:197435002-197435024 TGTCCACTCGAACACACAGACGG + Exonic
944922481 2:204429908-204429930 TGTCCAATAAATCACCAAAGGGG - Intergenic
946539221 2:220665607-220665629 TGTCCTATAGAATACCCAAGAGG - Intergenic
947345940 2:229189313-229189335 GGTCCATTAGATCACGCAAGTGG + Intronic
948754154 2:240149517-240149539 TGTCCATAAGAACGCCCAGGGGG + Intergenic
1171302639 20:24077125-24077147 TGTCCAATAGTCCACCCAAGAGG - Intergenic
1172611367 20:36255303-36255325 TGTCCAGTAGAACCCCCCAGGGG + Intronic
1181944325 22:26504042-26504064 TGTCCACTAAACAATCCAAGTGG - Intronic
1183096977 22:35558159-35558181 TGTCCGATAGAACACCCCAAAGG - Intergenic
1184430422 22:44438908-44438930 TGGACACTCGAACTCCCAAGAGG + Intergenic
1185287459 22:50008882-50008904 TGTCCACTTAAACGCACAAGTGG - Intronic
949374498 3:3373034-3373056 CGTCCACTACAACAGCCAAATGG - Intergenic
949558584 3:5182043-5182065 TTTCCCTAAGAACACCCAAGAGG - Intergenic
952731824 3:36645257-36645279 TGTCCCCAAGAACACACAATGGG - Intergenic
956119288 3:65950220-65950242 AGTAGACTAGACCACCCAAGTGG + Intronic
964291317 3:155184058-155184080 TGTCCACTTGACCAACCAAATGG - Intergenic
989765005 5:45072165-45072187 TGGCCATTAGCAAACCCAAGAGG + Intergenic
990333628 5:54751143-54751165 TGTTCACTGGAACACACACGTGG - Intergenic
993521939 5:88913729-88913751 AGTCCAATAGAACTCCAAAGAGG - Intergenic
1001034399 5:168287198-168287220 TGTCCACAAGACCCCCCAAGGGG - Intergenic
1004576966 6:16905862-16905884 AGTCCAGTAGAACACAGAAGAGG - Intergenic
1005841602 6:29747899-29747921 TCCCCTCTAGACCACCCAAGGGG - Intergenic
1007045537 6:38770151-38770173 TGACAATTAGAACTCCCAAGAGG - Intronic
1007175313 6:39892467-39892489 TGTCCCCTAGTACTCCCCAGGGG + Intronic
1013617739 6:111860364-111860386 TGCCCACCAAAACACCCATGGGG - Intronic
1014073425 6:117209415-117209437 TGTCCACTACAACATCCCAGAGG + Intergenic
1015689877 6:135910217-135910239 TACCCACTACAACATCCAAGGGG + Intronic
1018587984 6:165384258-165384280 TGACCACTACAGCTCCCAAGTGG - Intronic
1019821100 7:3243320-3243342 TGTCCACTAAAACGTCCATGTGG - Intergenic
1026093952 7:67325940-67325962 AGTCCAATAGAACTCCAAAGAGG + Intergenic
1032485541 7:132284582-132284604 TGTCCACTAGAACACCCAAGGGG + Intronic
1034973967 7:155437186-155437208 TGTCCACTTGGACCCCCAAGTGG - Intergenic
1038126169 8:24675242-24675264 GGTACACTAAAACTCCCAAGGGG + Intergenic
1042528528 8:69791229-69791251 TGTACCCTAGAACACCCAGGTGG - Intronic
1044759092 8:95498154-95498176 TGGCCACTAGCACATGCAAGTGG - Intergenic
1048166665 8:132067599-132067621 TGTCCACTCCCACAGCCAAGTGG - Intronic
1052262941 9:26539104-26539126 CTACAACTAGAACACCCAAGTGG + Intergenic
1053507555 9:38656084-38656106 ACTGCCCTAGAACACCCAAGTGG + Intergenic
1056538818 9:87553933-87553955 TGTTCACTAGAACAACAAAAGGG + Intronic
1060887503 9:127165686-127165708 TGTCCAGGAGAACACCCATTTGG - Intronic
1061288874 9:129639679-129639701 TGCCCACTAGAACACCCCGAGGG - Intronic
1186449765 X:9662277-9662299 TGTCCTTTAGAACACCTCAGCGG + Intronic
1189044269 X:37573843-37573865 TGACCACTAGATCACACAGGTGG + Intronic
1195012505 X:100746964-100746986 TGTACAGAAAAACACCCAAGTGG + Intergenic
1195713288 X:107792795-107792817 TTGCCACTACAACACCCAAGAGG - Intronic
1201503230 Y:14668887-14668909 TGACCACCGGAACAGCCAAGAGG + Intronic
1201850693 Y:18476725-18476747 TCTCCTCTAGAGCATCCAAGAGG - Intergenic
1201882625 Y:18843652-18843674 TCTCCTCTAGAGCATCCAAGAGG + Intergenic