ID: 1032486593

View in Genome Browser
Species Human (GRCh38)
Location 7:132292265-132292287
Sequence CAGGTAAATCAGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 270}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032486588_1032486593 -10 Left 1032486588 7:132292252-132292274 CCCAGTGTGGTATCAGGTAAATC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 270
1032486587_1032486593 -9 Left 1032486587 7:132292251-132292273 CCCCAGTGTGGTATCAGGTAAAT 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 270
1032486580_1032486593 29 Left 1032486580 7:132292213-132292235 CCCTGACTGTCAAATGCCTCTTT 0: 1
1: 0
2: 0
3: 27
4: 251
Right 1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 270
1032486582_1032486593 13 Left 1032486582 7:132292229-132292251 CCTCTTTCCTGCACTCTGTGTCC 0: 1
1: 1
2: 2
3: 82
4: 862
Right 1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 270
1032486583_1032486593 6 Left 1032486583 7:132292236-132292258 CCTGCACTCTGTGTCCCCCAGTG 0: 1
1: 0
2: 2
3: 29
4: 297
Right 1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 270
1032486579_1032486593 30 Left 1032486579 7:132292212-132292234 CCCCTGACTGTCAAATGCCTCTT 0: 1
1: 0
2: 2
3: 15
4: 233
Right 1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 270
1032486586_1032486593 -8 Left 1032486586 7:132292250-132292272 CCCCCAGTGTGGTATCAGGTAAA 0: 1
1: 0
2: 0
3: 14
4: 103
Right 1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 270
1032486581_1032486593 28 Left 1032486581 7:132292214-132292236 CCTGACTGTCAAATGCCTCTTTC 0: 1
1: 0
2: 1
3: 24
4: 179
Right 1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032486593 Original CRISPR CAGGTAAATCAGAGGGAGGC TGG Intronic
901964979 1:12859194-12859216 CAGCGATACCAGAGGGAGGCAGG - Exonic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902841473 1:19076870-19076892 CCAGTAACACAGAGGGAGGCTGG - Exonic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
904899869 1:33848412-33848434 CAGGAGAATCAGTGGGAGACTGG - Intronic
905167266 1:36089987-36090009 CCGGTAATTAAGAGGGAGGGAGG + Intronic
906144467 1:43551630-43551652 CTGGCAAGTCAGAGGGATGCAGG - Intronic
906864614 1:49403962-49403984 CAGATAAATGGGAGGGAGACAGG - Intronic
907005870 1:50912256-50912278 CAGGTAAATCTGATGTAGGAAGG - Intronic
908151871 1:61310787-61310809 CAGGAAATTCAGAGGAAGGAAGG - Intronic
909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG + Intronic
910813555 1:91263943-91263965 TAGGTAAATCATAAGGAGGAAGG - Intronic
913115420 1:115692201-115692223 CAGGTAAAGCACAGGGAGAGAGG + Exonic
913454265 1:119015010-119015032 CAGGTAAATGAGAGGGAAAGTGG - Intergenic
913577664 1:120193485-120193507 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
913630506 1:120704855-120704877 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
914559577 1:148804916-148804938 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
914613256 1:149325307-149325329 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
915594644 1:156889224-156889246 CAGGTAAAGGAGATGAAGGCAGG - Intergenic
915594692 1:156889686-156889708 AAGTTAAATCAGTAGGAGGCTGG + Intergenic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
916873466 1:168942244-168942266 GAGGCTAATCTGAGGGAGGCTGG - Intergenic
917219009 1:172707405-172707427 CGGATACATCAGAGGGAGCCAGG + Intergenic
918180943 1:182085725-182085747 CAGGTGATTCTGATGGAGGCAGG + Intergenic
919846794 1:201647853-201647875 CAGGTAAAAGAGACGGAGGGAGG - Intronic
920144843 1:203851018-203851040 CAGGTAATTCAGTGAGAGTCAGG - Intronic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
921400091 1:214712560-214712582 CAAGTAAATCACAGGAAGGTAGG - Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
1063881679 10:10538254-10538276 CTGGCAGACCAGAGGGAGGCAGG - Intergenic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1069118578 10:64539062-64539084 TTGGTCAATCAGAGGGAGACAGG - Intergenic
1069162568 10:65109278-65109300 CAGGTAAATCAGTGGGAAACTGG + Intergenic
1069619044 10:69825001-69825023 CAGGTCAGTCAGAGAGAGGCAGG - Intronic
1071584996 10:86811456-86811478 CAGATAAATGAGAGGCAGGAAGG - Intronic
1072418702 10:95271138-95271160 CGTGAAAATCAGAGGGGGGCTGG + Intronic
1075779459 10:125007517-125007539 CAGGTAGATCTCAGGGAGGATGG + Intronic
1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG + Intergenic
1076768524 10:132650796-132650818 CATGAAAATAAGAGGGAGTCCGG + Intronic
1077248480 11:1550450-1550472 TGGGTAAATGAGAGGGAGGGAGG - Intergenic
1078153394 11:8777838-8777860 CAGGTAGATTACAGGGAGGATGG - Intronic
1078182314 11:9022392-9022414 CAGGTAAGTGAGATGGAAGCTGG - Intronic
1078328371 11:10398525-10398547 CAGGGAAATCAGGGGAAGGATGG + Intronic
1078375804 11:10792300-10792322 CAGGTAAGTCAGATAGAGCCTGG + Intergenic
1078427197 11:11261583-11261605 CAGGTAAACCAAAGGAAGGGAGG - Intergenic
1078707411 11:13758543-13758565 CAGCTAGATCAGAGGGAAGATGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083474011 11:62904032-62904054 CAGTTAAAGCAGAGAGAGGCCGG - Intergenic
1084701500 11:70789061-70789083 CTGGTAAATTAGAGAGTGGCTGG + Intronic
1085247367 11:75113958-75113980 CAGGTAACTCACAGGGAGACAGG + Intronic
1085782536 11:79422737-79422759 CTGGTAGAACAGAGGGAGGGAGG + Intronic
1086831360 11:91569003-91569025 CAGCTAACTCAGATGAAGGCAGG - Intergenic
1088735207 11:112723072-112723094 CAGGCAAGGCAGAGAGAGGCAGG + Intergenic
1089111736 11:116062704-116062726 CAGCTCACGCAGAGGGAGGCAGG + Intergenic
1089369375 11:117944146-117944168 GAGGTAAACCAGAGAAAGGCAGG + Intergenic
1090212553 11:124932596-124932618 AAGGTAAATCTTGGGGAGGCAGG + Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1091284779 11:134402521-134402543 CAGGTGTAACAGAGGGAGGTGGG - Intronic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1093925511 12:24904497-24904519 CAGTTAATACAGATGGAGGCCGG - Intronic
1095214987 12:39537920-39537942 CAGATGAATCAGAATGAGGCAGG + Intergenic
1095262689 12:40115513-40115535 AAGGTACATCATAGGGAGGGTGG + Intergenic
1095982641 12:47981842-47981864 CAGGTAGAGGTGAGGGAGGCAGG + Intronic
1096973925 12:55687784-55687806 AAGATAAATCAGATGCAGGCTGG - Intronic
1101732845 12:107440737-107440759 CAGGGAAATGGAAGGGAGGCAGG + Intronic
1102063560 12:109953762-109953784 CAGGTAGATGAGAGGAATGCTGG - Intronic
1102105246 12:110315825-110315847 CAGGTATTTGGGAGGGAGGCAGG + Intronic
1102287001 12:111665761-111665783 CAGGTCCATCACTGGGAGGCTGG + Exonic
1102605305 12:114063875-114063897 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605354 12:114064019-114064041 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605452 12:114064380-114064402 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605462 12:114064416-114064438 CTGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605480 12:114064488-114064510 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605498 12:114064560-114064582 CTGGTAAACCAGAGGGAGTCAGG - Intergenic
1103147744 12:118610245-118610267 CAGGTGATGCAGAGTGAGGCAGG - Intergenic
1103318765 12:120077951-120077973 GAGGGAAACCAGAGGGACGCAGG - Intronic
1103344772 12:120241866-120241888 AGGGGAGATCAGAGGGAGGCAGG + Intronic
1104337235 12:127910793-127910815 AAGGTAAATGAGATGGAGACAGG - Intergenic
1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG + Intergenic
1104905947 12:132213631-132213653 CAGGTACATCAGAGGCTGACAGG - Intronic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1106845444 13:33733120-33733142 CAGGTGAAACAGAGGTAGACAGG + Intergenic
1107401974 13:40077970-40077992 CAGGTAGAAGAGAGGGAGGCAGG + Intergenic
1112880846 13:104104716-104104738 CAGGGAAATCAGAGGGAAAGGGG - Intergenic
1115080370 14:29443709-29443731 CAGGCAAAGCAGAGGGAATCGGG - Intergenic
1115753252 14:36510670-36510692 CAGGTAAATCAGTAGCACGCGGG + Intronic
1119667389 14:76494780-76494802 CAGTTAAAGCAGAGGAAGCCAGG + Intronic
1119865034 14:77966298-77966320 CAGGCAAAGGGGAGGGAGGCAGG - Intergenic
1120129291 14:80786187-80786209 CATGTAAATCTTAGAGAGGCTGG - Intronic
1120312909 14:82854287-82854309 CAAGGAAGTCAGAGGGAGTCTGG - Intergenic
1120613391 14:86671183-86671205 TATGTATATCAGAGGGATGCAGG - Intergenic
1127215755 15:56821588-56821610 CAGGTAGGTCAGGGGAAGGCAGG + Intronic
1127782189 15:62326926-62326948 CTGGTAAATCAAATTGAGGCTGG + Intergenic
1127841832 15:62838472-62838494 GTGCTAAATCAGATGGAGGCAGG + Intronic
1129771377 15:78205424-78205446 CAGTTAGATGAAAGGGAGGCAGG + Intronic
1130891443 15:88137118-88137140 CAGGTAACTCACAGGGAGAAAGG + Intronic
1132065328 15:98726255-98726277 CAGGAAAATCATAGGAAAGCAGG - Intronic
1133346698 16:5075910-5075932 CAGGCAGATCAGAGGAAGGCAGG - Intronic
1133544156 16:6788769-6788791 CAGAAAAATCAGTGGGGGGCCGG - Intronic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1135973874 16:27092797-27092819 CAGGTAACCCAGAGGAAGGCAGG + Intergenic
1136536545 16:30902970-30902992 CAGGCAAAGCAAAGAGAGGCTGG - Exonic
1137317100 16:47337050-47337072 CAGGAGAATCACAGGGAGGCGGG + Intronic
1137766179 16:50979395-50979417 CAGGTAAGTCAGAGGCTGGTGGG - Intergenic
1138993581 16:62421224-62421246 CAGCAAAATCAGAGAGAGACTGG + Intergenic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1139391301 16:66607665-66607687 GAGGGAAATCAAAGCGAGGCAGG - Intronic
1139606814 16:68024658-68024680 CAGATAAATCAGAGGAAGAGAGG + Intronic
1139680551 16:68558566-68558588 CAGGTAAATGAGTGAGAGTCAGG + Exonic
1140970890 16:80011118-80011140 GAGGTGAATCCCAGGGAGGCTGG + Intergenic
1142549667 17:731164-731186 CCGTGAAATGAGAGGGAGGCTGG - Intergenic
1142597653 17:1037331-1037353 GAGGTCAGGCAGAGGGAGGCTGG - Intronic
1142905787 17:3040958-3040980 CAGGGAAACCAGAGAGAGCCAGG - Intergenic
1142984554 17:3688097-3688119 CTGGCAAATCTGAGGGAGACAGG + Exonic
1144274522 17:13652826-13652848 CAAGTAAATCAGAGAAAGACTGG + Intergenic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1148181026 17:45604997-45605019 CAGGTATTTGAGAGGGAGGCAGG - Intergenic
1148267883 17:46240931-46240953 CAGGTATTTGAGAGGGAGGCAGG + Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1151442544 17:74140813-74140835 AAAGTAAATAAGAGAGAGGCTGG + Intergenic
1151471115 17:74318337-74318359 CCGGTACACCAGTGGGAGGCAGG + Intergenic
1155680852 18:28483698-28483720 CAGGGAAAGAAGTGGGAGGCAGG + Intergenic
1156093818 18:33505101-33505123 CAGGTCAAGCAGTGGGGGGCGGG - Intergenic
1156409581 18:36815056-36815078 CAGGTACACCAGATGGAGGCTGG + Intronic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1165012913 19:32861857-32861879 CAGCCAAATCAGAGGCAGCCAGG - Intronic
1165786970 19:38467428-38467450 CAGAAAAGTCAGAGAGAGGCAGG - Intronic
1167230494 19:48279888-48279910 CAGGTAAAGCACATGGAGCCAGG + Intronic
1167474888 19:49694328-49694350 CAGTTAAATAAGGGGGTGGCAGG + Intronic
925302774 2:2828792-2828814 CAGGCAGACCAGAGGGAGACAGG + Intergenic
925841357 2:7995181-7995203 CAGGTAGATCACAGGGAAGGTGG - Intergenic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
927149824 2:20189120-20189142 CAGGTTACACAGTGGGAGGCAGG + Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927483373 2:23471800-23471822 CCAGGAAATCACAGGGAGGCAGG - Intronic
928143287 2:28749605-28749627 CAAGTGAGGCAGAGGGAGGCCGG - Intergenic
928189915 2:29154631-29154653 CAGGGAAATCATAGAGAGGAGGG + Intronic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
929611914 2:43277055-43277077 CAGGGAAATCAGCTGGGGGCTGG - Intronic
929824936 2:45302670-45302692 CTGGGAAATCAGTGGGAAGCAGG + Intergenic
930106087 2:47640563-47640585 AAGGGAAATCAGCGTGAGGCAGG + Intergenic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
932587509 2:73040834-73040856 CAGGTAACTCTGTGGGAGGTGGG - Exonic
933694622 2:85208430-85208452 CAGATAAAGCAGAGTAAGGCAGG + Intronic
933912239 2:86951850-86951872 CAGGAAATTAAGAGGGAGGCAGG + Intronic
933919487 2:87030320-87030342 CAGGTAAATCAGCACGAGGGAGG + Intergenic
934003507 2:87739587-87739609 CAGGTAAATCAGCACGAGGGAGG - Intergenic
934010755 2:87818047-87818069 CAGGAAATTAAGAGGGAGGCAGG - Intronic
934516869 2:94993835-94993857 CAAGTAGAGCTGAGGGAGGCTGG + Intergenic
934928621 2:98400731-98400753 CAGGAAGATCAGAGAGAGGAAGG + Intergenic
935774323 2:106458748-106458770 CAGGAAATTAAGAGGGAGGCAGG - Intronic
935905745 2:107837165-107837187 CAGGAAATTAAGAGGGAGGCAGG + Intronic
935957279 2:108389828-108389850 CAGGAAAGTAAGAGGTAGGCTGG - Intergenic
935992225 2:108729694-108729716 CAGGAAATTAAGAGGGAGTCAGG + Intronic
936127542 2:109802346-109802368 CAGGAAATTAAGAGGGAGGCAGG + Intronic
936217155 2:110569139-110569161 CAGGAAATTAAGAGGGAGGCAGG - Intronic
936426295 2:112423722-112423744 CAGGAAATTAAGAGGGAGGCAGG - Intronic
937067440 2:119028568-119028590 CAGGTAGATTAGAGAGAGGAAGG - Intergenic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938616085 2:133000305-133000327 CAGTTAAATTAGAAAGAGGCAGG + Intronic
939656009 2:144826229-144826251 CAAGTAAATGTGAGAGAGGCTGG - Intergenic
941778367 2:169417329-169417351 CAGAAAATTCAGAGGGAGGGAGG + Intergenic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
943763125 2:191631544-191631566 TTGGTAAATAAGAAGGAGGCTGG - Intergenic
945557950 2:211302249-211302271 CAGGTAAATAACAAGGTGGCTGG - Intergenic
947732221 2:232437559-232437581 CTGGTAAAAGAGACGGAGGCTGG + Intergenic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
1168848000 20:958615-958637 CAGGGAAGTCAGAGAGAGGGTGG + Exonic
1169595291 20:7191637-7191659 CAGGTAAACCAGAACAAGGCAGG + Intergenic
1170907517 20:20529072-20529094 CACGGAAACTAGAGGGAGGCAGG + Intronic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171462718 20:25308059-25308081 CAGGGAACTGAGAGGTAGGCAGG + Intronic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1173148223 20:40543806-40543828 AAGGTGAATCAGATGCAGGCAGG - Intergenic
1173260844 20:41433983-41434005 CATGTAAACCAGAGGAAGGCAGG + Intronic
1173265485 20:41475768-41475790 CACATAGATCAGAGTGAGGCTGG + Intronic
1175663377 20:60836824-60836846 GAGGTAAGGCAGAGAGAGGCTGG - Intergenic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1179296314 21:40065956-40065978 CAGGAAACTCAGAGAGAGGTTGG - Intronic
1181579681 22:23821118-23821140 CAGGTAAGTCAGAGGGTCACTGG - Intronic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1182282281 22:29224538-29224560 AATGAAAACCAGAGGGAGGCTGG - Intronic
1182453061 22:30432623-30432645 CAGGGAAATAAGGGGGGGGCGGG - Intergenic
1183002033 22:34868578-34868600 CAGGTGAAGCAGAGGGAGTGAGG - Intergenic
1184261949 22:43322664-43322686 CAGGTGATTCAGGGGGAAGCTGG + Intronic
1185290584 22:50024538-50024560 CAAGTAATTCAGTGGGAGGAAGG + Intronic
949205480 3:1433175-1433197 CAGGAAAAACAGAGAGAGGGAGG - Intergenic
949725643 3:7041268-7041290 CAGGAGAATTAGAGGGAGACAGG - Intronic
949729933 3:7097152-7097174 CAGGTAAAGCAGATGGAGAGTGG + Intronic
950161952 3:10766894-10766916 CAGATAAACCACAGGGAAGCAGG - Intergenic
950464327 3:13144380-13144402 CACCCACATCAGAGGGAGGCAGG + Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
950942373 3:16905844-16905866 GAGGTAATTGAGAGGGAGGCAGG + Intronic
950982039 3:17317325-17317347 CAGGTAACTCACAAGAAGGCAGG + Intronic
951894784 3:27600437-27600459 CAGGTAAAAGAAAGAGAGGCTGG - Intergenic
952655073 3:35776420-35776442 CAGGGAAAGCAGAGGAAGGGTGG + Intronic
953261803 3:41346527-41346549 GAGGTAAGTCAGACCGAGGCAGG + Intronic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954115311 3:48463879-48463901 CAGGTAAAGCAGGGTGGGGCGGG + Exonic
955105838 3:55897191-55897213 CAGATAACTGAGAGAGAGGCTGG - Intronic
955732093 3:61997792-61997814 CAGGGAAATTAGTGGAAGGCTGG + Intronic
956578976 3:70788757-70788779 CAGGTAACCCATAGGAAGGCAGG - Intergenic
956815404 3:72903768-72903790 CAGGTGAATATGAGCGAGGCAGG + Intronic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
960630413 3:119725153-119725175 CAGGTAAAGGAAAGGGAGGCTGG - Intronic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
965314503 3:167175421-167175443 CAGTAAAATCTGAGGTAGGCTGG + Intergenic
966175383 3:177132801-177132823 AAATTAAATCAGAGGCAGGCAGG + Intronic
967843316 3:194024474-194024496 GAGGTAGGTGAGAGGGAGGCTGG - Intergenic
969519230 4:7666128-7666150 CAGGAGACTCAGGGGGAGGCAGG + Intronic
969620525 4:8276634-8276656 TTGGTAAATCACAGGCAGGCTGG + Intronic
969903400 4:10370903-10370925 CAGGTGAATCAGAGGTTGGGTGG - Intergenic
970014270 4:11495338-11495360 CAGGCAAATCAGAGAGAGCCAGG - Intergenic
970444876 4:16115230-16115252 AAGGCAATGCAGAGGGAGGCTGG + Intergenic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
970735781 4:19165870-19165892 CAGACAAATCAGAAGGAGTCTGG + Intergenic
970946369 4:21697784-21697806 CAGACCATTCAGAGGGAGGCGGG + Intronic
971866597 4:32180106-32180128 CAATTCAAACAGAGGGAGGCAGG + Intergenic
971867334 4:32189877-32189899 CACGTGCATGAGAGGGAGGCAGG + Intergenic
973707074 4:53591629-53591651 CAGGTAAATGACAGGTGGGCGGG - Intronic
977080666 4:92523707-92523729 CAGGTTCAGCAGAGGGACGCAGG + Intronic
980771630 4:137380568-137380590 CAGGAAAATCAGAGACAAGCAGG + Intergenic
981269543 4:142829015-142829037 TAGGTAGATCAGAGGGAGGAGGG + Intronic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
981310710 4:143295381-143295403 GAGGTACAGGAGAGGGAGGCTGG - Intergenic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
985424997 4:189821344-189821366 CAGGTACATCAGACTGAGACAGG - Intergenic
985425791 4:189828828-189828850 CAGGTAAGGTAGAGAGAGGCAGG - Intergenic
985425802 4:189828906-189828928 CAGGTAAGGGAGAGAGAGGCAGG - Intergenic
985425809 4:189828951-189828973 CAGGTAAGGGAGAGAGAGGCAGG - Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
988385804 5:30563543-30563565 CTGGCAAGTCAGATGGAGGCTGG + Intergenic
989236724 5:39156426-39156448 CAGCAAAACCAGAGGGAAGCAGG + Intronic
991017194 5:61944980-61945002 CAGGTAACACAGAGGAAAGCTGG + Intergenic
991085576 5:62645720-62645742 CAGGTGAATAAGAGGAAGGGAGG - Intergenic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
992880708 5:81106526-81106548 CAGAGAAATCAGTTGGAGGCAGG - Intronic
992950261 5:81851310-81851332 GAGGTGGATCAGAGGGAGGAAGG + Intergenic
1000222837 5:159230632-159230654 CAAGTAAGTCAGAGGGAGAGTGG + Intergenic
1000389536 5:160708807-160708829 CAGATAAATCAGAGTCAGGATGG - Intronic
1001167587 5:169384761-169384783 AAGCTGAATTAGAGGGAGGCAGG + Intergenic
1002294592 5:178223319-178223341 CAGGCAAATCTGCAGGAGGCAGG - Intronic
1002761507 6:205988-206010 CAGGTGACTCAGCAGGAGGCTGG - Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1006881394 6:37343088-37343110 CACCTAGATCTGAGGGAGGCTGG - Intergenic
1007403061 6:41615586-41615608 CAGCTAATCCAGAGGGAGGAGGG + Intergenic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1008850733 6:56017975-56017997 CCAGTAGATCAGATGGAGGCTGG - Intergenic
1013266227 6:108501744-108501766 CACTTAAATCTAAGGGAGGCTGG + Intronic
1014885009 6:126769334-126769356 CAGGTAATGCTGAGGGAGGGTGG - Intergenic
1015042142 6:128733890-128733912 CAGGAAATTCAGAGGAAGGCTGG + Intergenic
1017614679 6:156232284-156232306 CAGTTAAAACAGAAAGAGGCTGG - Intergenic
1019478628 7:1255956-1255978 CTGGCAGATCAGAGGCAGGCGGG + Intergenic
1019772325 7:2891478-2891500 CACGTAAAGAGGAGGGAGGCGGG - Intergenic
1021492973 7:21239939-21239961 CAGGTTAGTGAGAGGGAGGTTGG - Intergenic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1022944627 7:35270022-35270044 CAGGTCACTCAGAAGGAGCCAGG - Intergenic
1023723266 7:43116615-43116637 CAGGTAAATGGGAGAGAAGCAGG - Intronic
1025713212 7:63930781-63930803 CATGTAGATGAGAGGTAGGCTGG - Intergenic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1027775082 7:82454914-82454936 CAGGAAAATGAGACAGAGGCTGG + Intergenic
1028519311 7:91712250-91712272 CAGACAAAAAAGAGGGAGGCTGG + Intronic
1029171426 7:98631787-98631809 CAGCTAAATCAAAGGCAGGCTGG + Intergenic
1029182914 7:98717445-98717467 GTTGTAAATCAGAGGTAGGCTGG - Intergenic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032551404 7:132787489-132787511 CAGGGAAGTCAGTGGGAGCCTGG + Intronic
1032727837 7:134607602-134607624 GAGTTAAATCAGAGTGGGGCAGG - Intergenic
1033576652 7:142691714-142691736 CAGTTCCATCAGATGGAGGCTGG + Intergenic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1034037472 7:147839423-147839445 GAGGTAAATCACAGTGAGGCTGG + Intronic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035876463 8:3195228-3195250 CATGCACATCAGAGGGATGCGGG + Intronic
1036763620 8:11531241-11531263 TAGCTAAATCAGAGACAGGCAGG - Intronic
1038320244 8:26519126-26519148 CATGGAAATCAGGGTGAGGCTGG + Intronic
1038596001 8:28887182-28887204 CAGGCAAAAAAGAGTGAGGCAGG + Intronic
1039736281 8:40336313-40336335 CATGTAAAACAGAGAGAGGCAGG - Intergenic
1039871539 8:41549997-41550019 AAGGAAGCTCAGAGGGAGGCAGG - Intergenic
1039901793 8:41758016-41758038 CAGGTAAGTGGGATGGAGGCAGG - Exonic
1041178843 8:55226982-55227004 CAGGTAAGTAAGAGTGAGCCAGG - Intronic
1042807664 8:72789509-72789531 CAGGTAGAGAAGGGGGAGGCAGG + Intronic
1044467078 8:92520027-92520049 CAGGTTAATCACAGACAGGCTGG - Intergenic
1045985221 8:108242150-108242172 CATGTAAATCAGAAGTAGGTGGG - Intronic
1047812108 8:128422135-128422157 CCTGTAAAAAAGAGGGAGGCAGG + Intergenic
1048182891 8:132212749-132212771 GAGGTGAAGCAGAGTGAGGCGGG - Intronic
1048493892 8:134919766-134919788 CAGGTAAATCACTGGGATTCAGG - Intergenic
1048765104 8:137835055-137835077 TAGGTAGCTCAGAGGGAAGCAGG + Intergenic
1048790868 8:138102089-138102111 GAGGTAAATCAGAAGGATGGAGG + Intergenic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1055443350 9:76358207-76358229 TAGGAAAATCAGAGACAGGCCGG + Intronic
1056633408 9:88312335-88312357 CAGGTAAATAACAGGAAGGAAGG - Intergenic
1057179670 9:93022983-93023005 CAGATTAAACGGAGGGAGGCAGG - Intronic
1059778478 9:117501201-117501223 CAGGTAAATAAGTGAGAGGGGGG + Intergenic
1062533593 9:137012101-137012123 CAGGTAATCCAGGGAGAGGCTGG + Exonic
1186372399 X:8960521-8960543 CAGGTAATTGCGAGGGAGGGAGG - Intergenic
1189222460 X:39384046-39384068 TAGATAAATGACAGGGAGGCAGG - Intergenic
1190383951 X:49866267-49866289 CAAGTAACTCACAGGAAGGCAGG - Intergenic
1190451482 X:50585569-50585591 CAGGTCAATTAGAGGGAGCTGGG + Intergenic
1190817457 X:53940614-53940636 CAGGTAAGGGAGAGGGTGGCAGG - Intronic
1192204688 X:69088222-69088244 CAGGGAAATCAGAACCAGGCTGG - Intergenic
1193071616 X:77312124-77312146 TAGAAAAATAAGAGGGAGGCTGG + Intergenic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1195731829 X:107976246-107976268 GAGGGAAATGAGAGGGAGGGAGG + Intergenic
1198499931 X:137233749-137233771 GAGGGAAATCAGGGGAAGGCAGG - Intergenic
1200194752 X:154240186-154240208 CAGGGAAAGAAGAGGAAGGCAGG + Intergenic
1201621600 Y:15965105-15965127 AAAGGAAATCAGAGGGAGACAGG + Intergenic