ID: 1032487645

View in Genome Browser
Species Human (GRCh38)
Location 7:132300037-132300059
Sequence TCCCAATGTCAGGCAGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032487645_1032487649 8 Left 1032487645 7:132300037-132300059 CCAAAGCCTGCCTGACATTGGGA 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1032487649 7:132300068-132300090 TTACTGCAGATATTTTCTTTAGG No data
1032487645_1032487650 25 Left 1032487645 7:132300037-132300059 CCAAAGCCTGCCTGACATTGGGA 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1032487650 7:132300085-132300107 TTTAGGTTAAAGTAATACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032487645 Original CRISPR TCCCAATGTCAGGCAGGCTT TGG (reversed) Intronic
900698192 1:4025975-4025997 TGCAAATGTCTGGCAGGCTGGGG + Intergenic
901701589 1:11047294-11047316 TCCCAGAGTCAGGGAGGCTGGGG - Intergenic
903052193 1:20609698-20609720 TCTCTATGTCAGGCAGGCATGGG - Intronic
903139729 1:21332266-21332288 TCCCAGTGTCTGGCAGGGATGGG - Intronic
904291755 1:29490706-29490728 TCCCAGTGTCAGGCGGGGCTTGG - Intergenic
906546633 1:46624108-46624130 TCTCAAGGTCAGGGAAGCTTGGG - Intergenic
908742368 1:67342034-67342056 TGCCACTCTCAGGCAGGCTTGGG + Intronic
909463402 1:75944748-75944770 TCCATATGTCAGGAAGTCTTTGG - Intergenic
911222260 1:95261641-95261663 GCCCAATCTCAGGAAGGTTTGGG + Intergenic
911301449 1:96179493-96179515 TGAAAGTGTCAGGCAGGCTTGGG + Intergenic
912491570 1:110065372-110065394 TCCCAGGGCCAGGCAGGCTGTGG + Intronic
913050565 1:115113637-115113659 TCCCATTGTAAGGAAGGCTGAGG - Intergenic
913333213 1:117684370-117684392 TCCAAATGACAGGCAGGCTGTGG - Intergenic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
916423379 1:164658005-164658027 TCCCACTGTCAGGCAGATTCTGG + Intronic
918285243 1:183047767-183047789 TCCAAAAGTTAGGCAGGATTTGG - Intronic
919620367 1:199858273-199858295 ACCCAATGGCAGCCAGGCTTTGG - Intergenic
920822593 1:209395356-209395378 ACCCAGTGTCAGGCAGGGTCAGG + Intergenic
922267958 1:224004727-224004749 TCCCACCTTCAGGCAGGTTTGGG + Intergenic
923469729 1:234279756-234279778 CTCCACTGTGAGGCAGGCTTTGG - Intronic
924613380 1:245591892-245591914 TGCTAATGGCCGGCAGGCTTGGG - Intronic
1063864391 10:10348134-10348156 CCCCACTGTCTGGCAGGCATTGG + Intergenic
1065260917 10:23922462-23922484 TCCCCATGTCACCCAGACTTAGG - Intronic
1066725744 10:38390882-38390904 TCCCACCTTCAGGCAGGATTGGG - Intergenic
1075933951 10:126323732-126323754 TCCCAAAGTCATGCATGGTTGGG + Intronic
1076836778 10:133025150-133025172 TCCCAAAGTCAGGCAGGAGCGGG - Intergenic
1078153885 11:8781519-8781541 TCCCAGAGTCAGGCAGGGTGTGG + Intronic
1079092838 11:17493036-17493058 TCCCAAGGGAAGGCAGTCTTAGG - Intergenic
1079616309 11:22497742-22497764 TCACAATGTCAGGGATGGTTTGG + Intergenic
1080266286 11:30405308-30405330 TCCCCATGGCAAGCAGGCTCTGG + Intronic
1081765405 11:45606756-45606778 TCCCCAGCTCAGGCAGGTTTAGG - Intergenic
1081818699 11:45969508-45969530 CCCCACTGCCAGGCAGACTTTGG + Intronic
1084014358 11:66369863-66369885 GCCTACTGTCAGCCAGGCTTTGG + Intronic
1085171844 11:74456298-74456320 TCCCTATGTCACCCAGGCTGTGG - Exonic
1088467156 11:110153217-110153239 TCCCACTGTCACCCAGGCTGGGG + Intronic
1089812567 11:121143905-121143927 TCCCAGTGTCAGCCAGTCATTGG + Intronic
1090492816 11:127180097-127180119 TCCAAGTCTCAGGAAGGCTTGGG - Intergenic
1094051488 12:26226009-26226031 TGCCAATGTCAGCCAGGTTGAGG + Intronic
1096425311 12:51496609-51496631 TCCCACTGTGAGGAATGCTTGGG + Intronic
1096523402 12:52196772-52196794 TCCACATGCCAGGCAGGCTATGG + Intergenic
1096867851 12:54575836-54575858 TCCCAATGCAGGGCAGGCTTTGG - Intronic
1097160605 12:57044077-57044099 GCCCAGGGTGAGGCAGGCTTGGG - Intronic
1098404596 12:70110366-70110388 CCCAAATGTCACGAAGGCTTTGG - Intergenic
1100406718 12:94278243-94278265 TCACAAAGTCAGAAAGGCTTGGG - Intronic
1101826387 12:108223783-108223805 TTCCAATGTCAGTCAGTTTTTGG - Intronic
1104000209 12:124855367-124855389 TCCATATCTCACGCAGGCTTTGG + Intronic
1104658556 12:130592288-130592310 TCCCAGTGCCAGGGAGGCTGTGG + Intronic
1106908246 13:34432007-34432029 ACCCACTGTCAGACAGACTTGGG + Intergenic
1108308783 13:49165567-49165589 GCCCAAGGACAGGTAGGCTTGGG - Intronic
1109302056 13:60599862-60599884 ACACACTGTGAGGCAGGCTTGGG - Intergenic
1113592189 13:111508793-111508815 TCGCAATGTCTGGCCAGCTTCGG - Intergenic
1114742639 14:25113834-25113856 ATCCAATGTCAGGTAGGCTTTGG + Intergenic
1117459119 14:55927227-55927249 TCCCAATGAAAGGCTGCCTTTGG - Intergenic
1119166768 14:72501088-72501110 TGCCAATCTCAGGTGGGCTTTGG + Intronic
1121378041 14:93431445-93431467 TCAGAAGGCCAGGCAGGCTTTGG - Intronic
1126545692 15:49871734-49871756 TTCCAGTGTCTGGCATGCTTTGG - Intronic
1129773180 15:78215857-78215879 TTCCAAGATCAGGAAGGCTTGGG + Intronic
1129892658 15:79081766-79081788 TCCCAGTGCCAGGGAGGCATAGG + Intronic
1132581046 16:684756-684778 TCCCACTGTCCCGCAGGCTGCGG - Exonic
1134077697 16:11303652-11303674 TCCCAAGGACAGGCAGGCCACGG + Intronic
1134317113 16:13128701-13128723 TCCCACTGGGAGGCAGACTTGGG + Intronic
1136026739 16:27473576-27473598 TCACACTGTCAGGCAGGGGTGGG + Intronic
1138314691 16:56059858-56059880 TGCAAATGCCAGACAGGCTTAGG + Intergenic
1138354873 16:56369389-56369411 TCACAGTGTCTGGCAGGCTTTGG + Intronic
1138637369 16:58351852-58351874 CCCCTGTGTTAGGCAGGCTTTGG + Intronic
1141423543 16:83931807-83931829 TGCCTATCTCAGCCAGGCTTGGG + Intronic
1141817840 16:86425106-86425128 TCCCACTGTTAGGAAGGCCTGGG - Intergenic
1141993549 16:87623240-87623262 TCCGAGTGTCAGCCAGGCCTTGG - Intronic
1142428996 16:90016396-90016418 GCTCAATGCCAGGCAGGCATGGG + Intronic
1142594368 17:1022384-1022406 CCCCAATGACAGGCCGGCTTCGG - Intronic
1143114350 17:4573926-4573948 TCCCAGTGCCAGCCAGGCTCAGG + Intergenic
1143853166 17:9828059-9828081 TCCCCATGTAGGGCAGGCTGTGG + Intronic
1149612881 17:57970516-57970538 TGCCAATGTCAGGCCAGCTGTGG + Intergenic
1150218418 17:63482797-63482819 GCCCCAGGTCAGGCAGGGTTCGG + Intergenic
1153830433 18:8917705-8917727 TCCCAAAGTCAGGCACCCTGCGG + Intergenic
1154269901 18:12910387-12910409 TCCCACTGTCACCCAGGCTGGGG + Intronic
1155372282 18:25114128-25114150 TCCCAATTTCAGGGAGGGGTGGG + Intronic
1159053346 18:63441980-63442002 TCCCAATTATAGGCAGACTTGGG - Intergenic
1161462604 19:4407384-4407406 TCCCAGAGTCTGCCAGGCTTCGG - Intronic
1161553515 19:4927812-4927834 CCCTAATGTCAGCCATGCTTAGG + Intronic
1163169594 19:15521700-15521722 TCCCTATGTCACCCAGGCTGGGG + Intronic
1165945492 19:39439473-39439495 CCCCAAAGTCAGGAGGGCTTAGG - Intronic
1168042896 19:53773043-53773065 TCCCACCTTCAGGCAGGATTGGG - Intergenic
1168423575 19:56221027-56221049 TCCCTCTGTCACGCAGGCTGAGG - Exonic
926043267 2:9691631-9691653 TCCCAGTGGCAGCCAGGCCTGGG - Intergenic
931040405 2:58291805-58291827 TCCCAATGCAAGGGAGGCTTGGG - Intergenic
932214424 2:69957769-69957791 TCCCAAAGTGCAGCAGGCTTGGG - Intergenic
932320687 2:70820142-70820164 TCCAAATCTCAAGGAGGCTTTGG + Intronic
938731941 2:134153430-134153452 TGCCAATGACAGGCAGCCTGAGG - Intronic
943677394 2:190729332-190729354 TGTCAATGGCAGGCAGGCATTGG - Intergenic
946616604 2:221517038-221517060 TCCCTATGTCAGGCACACGTAGG - Intronic
1168896769 20:1329042-1329064 TCCCAATCCCAGCCAGGATTGGG + Intronic
1170451432 20:16488101-16488123 CTCCAATGTCCGGCTGGCTTTGG - Intronic
1170570673 20:17630602-17630624 GCTCAGTGTCAGGCAGGCTCTGG + Intronic
1170987887 20:21274889-21274911 TCCCAATGTCACTCAAGTTTGGG - Intergenic
1171143574 20:22763517-22763539 TTCCCATGGCAGGCAGGCTGTGG - Intergenic
1171190831 20:23158155-23158177 TCCCATTCTCAGGCAGCCCTGGG + Intergenic
1174519320 20:51117517-51117539 TCCTTAAGTCAGACAGGCTTGGG + Intergenic
1174542058 20:51297450-51297472 CCCCAATGTCAGGCATTCTGTGG + Intergenic
1175129729 20:56780025-56780047 TCGTGATGTGAGGCAGGCTTGGG + Intergenic
1184968409 22:47997789-47997811 TCCCAGGGACAGGCAGGCCTGGG + Intergenic
950509369 3:13416432-13416454 ACCCACTGTCAGGCAGCCATTGG - Intronic
951640011 3:24826538-24826560 TCCCAATGTCAAGCCCTCTTGGG + Intergenic
951926565 3:27914519-27914541 TTCCAATGCCAGGCAGGCAGTGG - Intergenic
953921549 3:46955420-46955442 TCCCAGTGGCATTCAGGCTTTGG - Intronic
954158181 3:48699651-48699673 TCCAAATGTGAGGCAGAATTAGG + Intronic
954682868 3:52355351-52355373 TCCCAAGCTCAGGCAGCCCTGGG - Intronic
955214163 3:56971298-56971320 GCCCCATGTCAGGCTTGCTTCGG - Intronic
955753936 3:62209016-62209038 TCCCCATGTGATGCTGGCTTTGG + Intronic
956949632 3:74266830-74266852 TCTCAAAATCAGGGAGGCTTGGG + Intronic
957631816 3:82725426-82725448 TCCCAATGTAATGCAGGATATGG - Intergenic
958990257 3:100835091-100835113 TCCCAAAAGCAGGCAGGCCTGGG - Intronic
959863029 3:111236722-111236744 TCCCAAAGTGAGCCACGCTTTGG - Intronic
961244612 3:125440588-125440610 CTCCAATGTCAGGCAGGATTGGG + Intergenic
961497493 3:127304989-127305011 TCCCTTTGGCAGGCAGGCTTTGG + Intergenic
961767812 3:129225802-129225824 TCCCAATTTTAGGTAGGCTGAGG + Intergenic
969298931 4:6285846-6285868 TCCCGTTGTCAGCCAGCCTTGGG + Intronic
973099959 4:46254213-46254235 TTCGAATATCATGCAGGCTTTGG + Intronic
975325612 4:73055512-73055534 TCCTAAGCTCAGGAAGGCTTAGG - Intergenic
978196165 4:105974498-105974520 TAGCAAGGTCAAGCAGGCTTCGG - Intronic
979335942 4:119462916-119462938 TCCCACCTTCAGGCAGGATTGGG + Intergenic
980495865 4:133587109-133587131 TCCCAATGTTAGTTAGGGTTTGG - Intergenic
981423343 4:144576734-144576756 GTCCAAAGTAAGGCAGGCTTTGG + Intergenic
984989876 4:185369719-185369741 TTCCAATGTCAGGTAAGTTTGGG - Intronic
985472201 5:53390-53412 TCCCCTTCTCAGGCAGGCTGTGG + Intergenic
985639723 5:1058020-1058042 TCCCCGTCTCAGGGAGGCTTGGG + Intronic
987258900 5:16183815-16183837 TCCAGATGTCAGGCAGGTGTAGG - Intergenic
987456273 5:18150986-18151008 TCCCCATATCAGCCAGGCCTGGG - Intergenic
988184917 5:27847539-27847561 TCCTAATTTTAGGCAGGTTTAGG + Intergenic
990023760 5:51160105-51160127 TCCCAATGTCTGCCCTGCTTTGG - Intergenic
990277657 5:54215296-54215318 TGTCAATGACAGGAAGGCTTTGG + Intronic
992158085 5:73974229-73974251 AGCCAAAGGCAGGCAGGCTTAGG + Intergenic
992391882 5:76337181-76337203 TCCAAGTGTCAGGGAGGGTTGGG + Intronic
994172168 5:96669733-96669755 TCCCAGGGTCAGGCAGACTGGGG - Intronic
994681323 5:102891188-102891210 TTCCTATGTCAGGTAGTCTTTGG + Intronic
995543764 5:113209504-113209526 TCCTGATTTCCGGCAGGCTTTGG + Intronic
996098521 5:119423944-119423966 GCCCAATGCCAGGCAGGTCTAGG + Intergenic
997969782 5:138391774-138391796 TCCCCATGGCAGAGAGGCTTGGG - Exonic
1001605354 5:172955878-172955900 TCCCAGAGTCAGGCAGACCTGGG - Intergenic
1003731109 6:8825634-8825656 TCCAAATGTCTGGAGGGCTTGGG + Intergenic
1015502834 6:133952079-133952101 TCCCACTCTCAGGCCGGCATCGG - Intergenic
1017737829 6:157380638-157380660 TCCCGAAGTCAGGCCGGCCTAGG + Intergenic
1018367527 6:163137236-163137258 TTCCAATGTCACACAGACTTTGG + Intronic
1018784698 6:167098885-167098907 GCCCCATGTCAGGCACCCTTGGG + Intergenic
1022036522 7:26539820-26539842 TCCCAAGGTCCTGCAGCCTTGGG + Intergenic
1022843835 7:34190612-34190634 GCCCAAGGTCAGGCAGCCTGAGG - Intergenic
1024067861 7:45756950-45756972 TCCCACCTTCAGGCAGGATTGGG - Intergenic
1026061118 7:67027166-67027188 TCACAATGTCATGCAGGCCGGGG - Intronic
1026649538 7:72203442-72203464 TCCCAAACTCCGGCAGGTTTGGG + Intronic
1026717243 7:72800227-72800249 TCCCAATGTCATGCAGGCCGGGG + Intronic
1028240863 7:88418836-88418858 GCCCATTGCCAGTCAGGCTTGGG + Intergenic
1028485311 7:91350950-91350972 TCCCAAGACCAGGAAGGCTTGGG + Intergenic
1029658119 7:101940820-101940842 TCCCACTGTGAGGCATCCTTGGG - Intronic
1029955359 7:104633193-104633215 TCTCAATGTCAGATAGCCTTTGG + Intronic
1030022675 7:105291349-105291371 TCCAAATGTCAGACAGAGTTAGG - Intronic
1032413289 7:131716063-131716085 TCCCCATGTTGGGCAGGCTTTGG + Intergenic
1032487645 7:132300037-132300059 TCCCAATGTCAGGCAGGCTTTGG - Intronic
1035567505 8:651268-651290 TCACAGTGTCAGGCAGGTTCGGG - Intronic
1037277248 8:17193588-17193610 TAGCAAAGTCAGCCAGGCTTGGG + Intronic
1039280498 8:35979134-35979156 TCCCAATTTTAGCCAGTCTTGGG + Intergenic
1043204539 8:77420529-77420551 TCTCCATGTCAGCCAGGCTTTGG + Intergenic
1044745649 8:95368051-95368073 ACAGAAGGTCAGGCAGGCTTGGG - Intergenic
1044939524 8:97326731-97326753 TCCCACTGTCACCCAGGCTGGGG + Intergenic
1048042069 8:130740327-130740349 TCATAAGGTCAGGCAGGCTGAGG + Intergenic
1049588969 8:143446956-143446978 TCCCAGGGCCAGGCTGGCTTGGG - Intronic
1053287535 9:36859552-36859574 TCCCACTCTCAGTCAGCCTTGGG - Intronic
1055939903 9:81639383-81639405 TCCAAATGACGGGCAGGTTTTGG - Intronic
1056256428 9:84803722-84803744 TCCCACTCTCAGGCAGAGTTGGG + Intronic
1059495695 9:114707374-114707396 TCCAAAGCTCAGGCAGGCATAGG - Intergenic
1060481693 9:124019955-124019977 CCCCAATGCCAGCCAGGCATTGG + Intronic
1061890105 9:133614826-133614848 TGCCATTGTTAGGCAGGCTTTGG - Intergenic
1062637121 9:137497372-137497394 TCCCAATGCCAGACAGACTCAGG + Intronic
1189338387 X:40185580-40185602 CCACAGTGTCAGGCATGCTTAGG + Intergenic
1195342894 X:103922111-103922133 TCCCACTGTCACCCAGGCTGGGG + Intronic
1196191253 X:112796952-112796974 TCCAAATGTCAGGAACGCTGAGG + Intronic
1197861611 X:130977284-130977306 TACCAATGTCTGGCTGGCCTGGG + Intergenic
1201097578 Y:10633147-10633169 TCACTATGTCACGCAGGCTGGGG + Intergenic
1201098290 Y:10651923-10651945 TCACTATGTCACGCAGGCTGGGG + Intergenic
1201241660 Y:11962631-11962653 TCCCAATGTCAGTTATGCTGAGG - Intergenic
1201681135 Y:16644645-16644667 AGCTAATGTCAGGCAGGCTCAGG + Intergenic
1202134043 Y:21642013-21642035 TCCAAATCTCAGGAAGACTTGGG - Intergenic