ID: 1032490081

View in Genome Browser
Species Human (GRCh38)
Location 7:132318014-132318036
Sequence ACTCGGGTCTTCAGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032490081_1032490089 8 Left 1032490081 7:132318014-132318036 CCATTTTCCCTGAAGACCCGAGT 0: 1
1: 0
2: 0
3: 20
4: 121
Right 1032490089 7:132318045-132318067 CAAAGAAACTCAATCCCAAGTGG No data
1032490081_1032490090 21 Left 1032490081 7:132318014-132318036 CCATTTTCCCTGAAGACCCGAGT 0: 1
1: 0
2: 0
3: 20
4: 121
Right 1032490090 7:132318058-132318080 TCCCAAGTGGTTTTGACATAAGG 0: 1
1: 0
2: 1
3: 7
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032490081 Original CRISPR ACTCGGGTCTTCAGGGAAAA TGG (reversed) Intronic
908206080 1:61851314-61851336 GCTTGGGTCTTCAGGGAGTAAGG + Intronic
908310835 1:62881310-62881332 GCTGGTGCCTTCAGGGAAAAGGG - Intergenic
909077817 1:71073928-71073950 TCTCAGGTATTCAGTGAAAATGG - Intronic
909147983 1:71962167-71962189 ACTCTTGTCTTCAGGAAAGAGGG - Intronic
909765778 1:79354276-79354298 ACTCGGGCCTCCAGGGTTAATGG + Intergenic
913297966 1:117340106-117340128 CCTCTGTTCTTGAGGGAAAATGG + Intergenic
917320105 1:173771966-173771988 ACTCTGGTTTTCAAGGACAAAGG - Intronic
921764105 1:218950448-218950470 AAGGGGGTCTTAAGGGAAAAAGG - Intergenic
1067163838 10:43849081-43849103 AGGTGGGTCTTCAGGGATAAAGG + Intergenic
1067461887 10:46464487-46464509 ACTATGGTCTTCGGGCAAAAAGG + Intronic
1067625308 10:47920111-47920133 ACTATGGTCTTCGGGCAAAAAGG - Intergenic
1068579762 10:58725815-58725837 AATCATGTTTTCAGGGAAAAGGG + Intronic
1068876741 10:62005117-62005139 GCTCTGATCTTCAGGGAGAAGGG + Intronic
1069673856 10:70233272-70233294 ACTCGGTACTCCAGGGAGAAGGG + Exonic
1069925455 10:71847319-71847341 ACCCGAGTGTTCAGGGAAGAGGG + Intronic
1070486245 10:76934580-76934602 AATGGGGTCTACAGGCAAAAGGG - Intronic
1078800829 11:14643393-14643415 ACTGGGGTCTTCGGGAAAGAGGG - Intronic
1083173235 11:60934989-60935011 GACCGGGTCTTGAGGGAAAAGGG + Intronic
1087122117 11:94585964-94585986 ATTCGAGGCTTCAGGGAAAGTGG + Intronic
1087423962 11:97966748-97966770 ACTGGGGTCTCCAGGCACAATGG + Intergenic
1088560966 11:111115987-111116009 ACATGGCTCTCCAGGGAAAAGGG - Intergenic
1089584748 11:119503069-119503091 AATCGGCTCTTCACAGAAAAGGG + Intergenic
1091095394 11:132816605-132816627 ACCTGGGTGTTCAGGGAACAAGG + Intronic
1091195103 11:133724115-133724137 TCTCCTGTCCTCAGGGAAAAAGG - Intergenic
1091741038 12:2960212-2960234 ACTCGGGACTTTGGGGGAAAGGG + Intronic
1095569729 12:43670918-43670940 ACTCAGGGCATCAGGAAAAAGGG + Intergenic
1096800537 12:54107438-54107460 ACTCGGGTCTCCAGGCAAGTCGG - Intergenic
1097459375 12:59841977-59841999 ATTCGGGCCTTTATGGAAAAAGG - Intergenic
1102417857 12:112780060-112780082 GCTGAGGTCTTCAGTGAAAATGG + Intronic
1113204487 13:107899631-107899653 ACTTGTGTATTCAGGGAACATGG + Intergenic
1115906507 14:38208709-38208731 GCTGGGGTCTCCAGAGAAAAGGG + Intronic
1121258151 14:92546598-92546620 ACGCGGGTGTTCAGGGAATGGGG + Intronic
1122115423 14:99525116-99525138 ACTCCGGTCCTCAGTGGAAAAGG - Intronic
1123194575 14:106604263-106604285 ACTGGGGACATCAGTGAAAAGGG + Intergenic
1202927438 14_KI270725v1_random:1616-1638 ACACAGCTCTGCAGGGAAAAAGG + Intergenic
1127306048 15:57706709-57706731 ACCCCGTTCTTCCGGGAAAATGG + Exonic
1133572148 16:7051727-7051749 GCTGGGGTTTTCAGGGAAAAGGG + Intronic
1137615437 16:49843694-49843716 ACTCAGACCTTCAGGGAGAATGG + Intronic
1139129482 16:64123825-64123847 AATCTGGTATTCAGGAAAAATGG + Intergenic
1140242173 16:73213069-73213091 ACACAGATCTTCAGGGACAAAGG - Intergenic
1142080488 16:88146430-88146452 ACCCGGGTCCACAGGGAAGAAGG - Intergenic
1142473110 17:174065-174087 TCTTGGGTCTGCAGGGAAATTGG + Intronic
1142839172 17:2613622-2613644 ACTCAGGTCTTCAGGGAGCAGGG - Intronic
1143117831 17:4590685-4590707 ACTCGGAGCTTTGGGGAAAAGGG - Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144596448 17:16574126-16574148 ACTCAGGTATACAGGAAAAAGGG + Intergenic
1148103279 17:45105534-45105556 ACTCGGAACTTCAGGGATAGGGG + Intronic
1148254874 17:46121534-46121556 AATAGGGTCATCAGGGAAAAAGG - Intronic
1149512385 17:57254804-57254826 ACTCAGGTTTACAGTGAAAAAGG + Intergenic
1151956067 17:77380808-77380830 ACTCAGGTCTTGAGGGACAGCGG + Intronic
1152231927 17:79118081-79118103 ACTGGGGGCTTCAGGGAGCAGGG - Intronic
1154353951 18:13610718-13610740 CCTCGGGGCTCCAGGGACAAGGG + Intronic
1155152528 18:23134689-23134711 ACCTGGGTCTTCACAGAAAATGG + Intronic
1161727372 19:5937561-5937583 AATGGGGTCTTCAGACAAAAGGG + Intronic
1164761273 19:30730151-30730173 ACTAGGGGCTTCTGGGAAAAGGG - Intergenic
1166357726 19:42236934-42236956 TCTCGGTTCTTGAGGGCAAAGGG + Exonic
1166609901 19:44181870-44181892 ACTCGGGTCTTCACAGACAATGG + Intergenic
1167306988 19:48715094-48715116 ACTCGGGTCTGAAGGGCGAAGGG + Intronic
1167700134 19:51038522-51038544 ATGAGGGTCTTCAGGGGAAAAGG - Intergenic
1168589650 19:57622307-57622329 ATTCAGGCCTTCAGGGAATATGG - Exonic
925310182 2:2876308-2876330 ACTCAAGTCTGGAGGGAAAAGGG - Intergenic
928036678 2:27830615-27830637 ACTCTGGTCTTTAAGGAAACTGG - Intronic
928059990 2:28102251-28102273 TCTCTGGTATTGAGGGAAAAAGG - Intronic
930853857 2:55991235-55991257 ACACTAGTCTTCAGGGAAATAGG - Intergenic
931579768 2:63760010-63760032 TCTCTGGGCTTCAGGGAATAGGG + Intronic
931646490 2:64426411-64426433 ACTAAGGCCTCCAGGGAAAAGGG - Intergenic
934033603 2:88069316-88069338 ACTAAGACCTTCAGGGAAAAGGG + Intronic
934920389 2:98339759-98339781 ACACAGGTGTGCAGGGAAAATGG + Intronic
937036669 2:118787814-118787836 ACTCTGGTCTTGAAGGAAAAAGG + Intergenic
943420601 2:187663325-187663347 AGTGGGGTCTTAAGGGAAAATGG + Intergenic
944407499 2:199401594-199401616 AATCAGGTAGTCAGGGAAAATGG + Intronic
944663365 2:201939513-201939535 TCTAGGGTCTTCCGGGGAAAGGG - Intergenic
945189506 2:207172214-207172236 ACGAAGGTCTTCAGGGCAAAAGG - Intergenic
949066408 2:241993394-241993416 AATGGGGTCTTCATGGAAAGGGG - Intergenic
1172108231 20:32529244-32529266 ACTCAGTTCTTCATGGGAAAGGG - Intronic
1175613823 20:60375086-60375108 ACTCGGGTCTTTGGGGCCAAAGG + Intergenic
1176589465 21:8630296-8630318 ACACAGCTCTGCAGGGAAAAAGG + Intergenic
1176954150 21:15081337-15081359 ACTTGGGTCTTCATAGAGAATGG + Intergenic
1179567674 21:42259417-42259439 ATTCAGCTCTTCAGGGAAAAAGG + Intronic
1180272293 22:10607293-10607315 ACACAGCTCTGCAGGGAAAAAGG + Intergenic
1180726581 22:17951016-17951038 CCACGGGTCTTCCGGGAGAAGGG + Intronic
1183445252 22:37849346-37849368 ACTCGGGCCTGCCGGGAAACCGG - Exonic
1184020903 22:41820827-41820849 ACTCGAGACTTCAGGGAGGAAGG + Intronic
949137838 3:591427-591449 ACACAGCTCTGCAGGGAAAAAGG - Intergenic
951030153 3:17872543-17872565 ACTCGGTACTACAGGGAGAAGGG + Intronic
951831680 3:26936402-26936424 ACTTCGGTCTTCAGGAATAAAGG + Intergenic
954168560 3:48780919-48780941 ACTGGGGTATTCAGAGATAAAGG + Intronic
954337347 3:49927224-49927246 ACTCAGGTGTTCAGGAACAATGG + Intronic
955686697 3:61556460-61556482 ACTGGTGTCTTCATAGAAAAGGG - Intergenic
960758006 3:121039579-121039601 AAGAGGGTCTTCAGGCAAAAGGG - Intronic
961193259 3:124980294-124980316 ACTCTGGTCTTTAGGAAAAAAGG - Intronic
962329888 3:134468550-134468572 ACTTTGGTCTTCAGGAAAAGGGG - Intergenic
963637016 3:147810895-147810917 ATAAGGGTCTTCAGGGGAAAGGG + Intergenic
964565957 3:158052791-158052813 ATTAGGGTCTTCAGGCAAAATGG - Intergenic
965457688 3:168924344-168924366 ATTAGGGTCTTCAGGGGAGAAGG - Intergenic
966863325 3:184242485-184242507 ACTCAGGTCCTGAGGGAAAGGGG + Exonic
967157436 3:186706262-186706284 ACTCAGGTCTCCAGGGCAGAAGG + Intergenic
967158455 3:186714511-186714533 ACTCAGGTCTCCAGGGCAGAAGG + Intergenic
967286077 3:187871903-187871925 TCTCAGGTCTTCATGGAAATGGG - Intergenic
967512867 3:190333008-190333030 AGTCAGGTGTTTAGGGAAAAAGG + Intronic
969946822 4:10791574-10791596 ACTAGGGTCTTCAGGGGAACAGG + Intergenic
974583456 4:63837099-63837121 ACACAGGTCTTCAGGGAAGAAGG + Intergenic
978113932 4:104996407-104996429 ACTAGGGTATTGAGGGAAGAAGG + Intergenic
979079567 4:116317979-116318001 ACTCGTGTCTTCATGCAAAAGGG - Intergenic
983754675 4:171320164-171320186 ACACTGGTCTCCAGGGAAATGGG - Intergenic
987379531 5:17272217-17272239 ACTCAGGTGTTGAGGGAATAAGG - Intronic
987971379 5:24949379-24949401 ACTCGCATCTACAGAGAAAAGGG - Intergenic
992883896 5:81138440-81138462 AGCCAGCTCTTCAGGGAAAAAGG - Intronic
993707323 5:91185907-91185929 ACGAGGGTCTTCAGGAGAAAAGG - Intergenic
995416843 5:111922246-111922268 ACTGGGGTCTCCAGGCACAATGG + Intronic
1001607830 5:172975544-172975566 ACTCGGTACTTCAGGGAGAAGGG - Intergenic
1004263788 6:14131631-14131653 TTTCGGATCTTCAGGGAATAGGG - Exonic
1005010302 6:21329349-21329371 ATGAGGGTCTTCAGGGGAAAAGG - Intergenic
1007616831 6:43184785-43184807 ACTGGTGTCTTCAGGGAGACAGG + Exonic
1010539511 6:77073826-77073848 ACTCGCTTCTTCAGGGATAAGGG + Intergenic
1011545540 6:88478367-88478389 ACAGGGGACTTCAGGGAAAATGG + Intergenic
1011743813 6:90389397-90389419 GCTGGGGCCTTCAGGGAAACTGG + Intergenic
1012974296 6:105763512-105763534 ACCTGGGTCTTCAGGGGAAGTGG - Intergenic
1015036175 6:128657351-128657373 ACTGGGGTGTTCAGAGAAAGAGG + Intergenic
1017335575 6:153255521-153255543 TCCCGGGTCTTCAGAGATAAAGG - Intergenic
1019497553 7:1347546-1347568 ACTCGGGACAGCAGGGAAGAGGG + Intergenic
1024903347 7:54347601-54347623 ACTGGGGTTTTCAGAGAAGAAGG + Intergenic
1028849343 7:95518879-95518901 ACCTGTGCCTTCAGGGAAAATGG + Intronic
1032490081 7:132318014-132318036 ACTCGGGTCTTCAGGGAAAATGG - Intronic
1042284973 8:67099075-67099097 ACTCTTGTCTTCAAGGAAATAGG + Intronic
1044397684 8:91732476-91732498 ACTCAGAACTTTAGGGAAAATGG - Intergenic
1045173560 8:99696716-99696738 CCCCGGATCTTCTGGGAAAACGG - Intronic
1046863369 8:119119076-119119098 ATTCGGCTATTGAGGGAAAAAGG - Intergenic
1046930453 8:119836694-119836716 AATCTGGACCTCAGGGAAAAGGG + Intronic
1049703331 8:144024699-144024721 AAGAGGGCCTTCAGGGAAAAGGG - Intronic
1051922091 9:22278976-22278998 TCTCTGGACTTCAGGGAAAATGG - Intergenic
1058716970 9:107731074-107731096 ACACAGTTCTTCAGGGAAACTGG - Intergenic
1061547183 9:131311255-131311277 CCTTGGGTCTTCATGGAAAGGGG - Intergenic
1061951855 9:133940745-133940767 ACTCAGGTATTTAGGGATAAAGG - Intronic
1203619475 Un_KI270749v1:108925-108947 ACACAGCTCTGCAGGGAAAAAGG + Intergenic
1188001761 X:24989058-24989080 ACTGGAGTCTTCAGGAAGAATGG + Intronic
1190635356 X:52427340-52427362 ACTGAGGCCTTCAGGGAGAAAGG + Intergenic
1190639322 X:52467339-52467361 ACTGAGGTCTTCAGGGAGAAAGG + Intergenic
1193249487 X:79271988-79272010 ACTTGGGACTTCAGGGATAATGG - Intergenic
1194964774 X:100275167-100275189 ACCCAGGTCTGAAGGGAAAATGG - Intergenic
1196137740 X:112228227-112228249 ACTGGGGACTTCCAGGAAAAGGG - Intergenic
1200238223 X:154479339-154479361 ACTGGGGCCTCCAGGGACAAGGG - Intergenic