ID: 1032491942

View in Genome Browser
Species Human (GRCh38)
Location 7:132330310-132330332
Sequence GGTCACTGCTGGTGTCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032491942_1032491944 -3 Left 1032491942 7:132330310-132330332 CCTCTGGGACACCAGCAGTGACC 0: 1
1: 0
2: 0
3: 21
4: 210
Right 1032491944 7:132330330-132330352 ACCTAATCAATTGCTCACAGTGG 0: 1
1: 0
2: 0
3: 13
4: 95
1032491942_1032491946 19 Left 1032491942 7:132330310-132330332 CCTCTGGGACACCAGCAGTGACC 0: 1
1: 0
2: 0
3: 21
4: 210
Right 1032491946 7:132330352-132330374 GCAGAGTAACCATCAGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032491942 Original CRISPR GGTCACTGCTGGTGTCCCAG AGG (reversed) Intronic
900598728 1:3494041-3494063 GGCCACTGATGGGGTCGCAGGGG + Exonic
901493268 1:9607433-9607455 GGCCTCAGCTGGGGTCCCAGAGG - Intronic
902374343 1:16023247-16023269 GGGCATTGCTGGGGACCCAGAGG + Intronic
902601849 1:17545278-17545300 GCTCATTGCTGGATTCCCAGTGG - Intronic
903332515 1:22603201-22603223 GCTCAGTGCTGGTGTCCCCGCGG - Exonic
904317589 1:29675763-29675785 TGTCACTGCTGGGGCCCCAGTGG + Intergenic
904409353 1:30315679-30315701 GGTGACTGCTGATGTCACACAGG - Intergenic
906706182 1:47896482-47896504 GGTCTCTGCTTGGGTTCCAGAGG - Intronic
907426042 1:54379961-54379983 GGGCACTCCTGGTCTCACAGTGG + Intronic
907800186 1:57757171-57757193 GGTCCATGCTGCTGGCCCAGGGG + Intronic
908080531 1:60573213-60573235 GGTCACTGCAAGTGTTCAAGTGG + Intergenic
912540650 1:110412472-110412494 TCTCACTGCTGCTGGCCCAGGGG + Intergenic
913549735 1:119906244-119906266 GGCCAGTCCTTGTGTCCCAGTGG + Intergenic
913978960 1:143490669-143490691 GGTAGCTGCTGTTGACCCAGAGG + Intergenic
914073365 1:144316318-144316340 GGTAGCTGCTGTTGACCCAGAGG + Intergenic
914105789 1:144650042-144650064 GGTAGCTGCTGTTGACCCAGAGG - Intergenic
915328481 1:155093643-155093665 GGGCAGTGCTGGTGTCCAGGTGG - Intergenic
917438384 1:175044137-175044159 GGTCACTCCTGTGGCCCCAGAGG - Intergenic
918003067 1:180515963-180515985 GGGCACTGCTGGAGTGCAAGTGG + Intergenic
918689890 1:187467037-187467059 GGTCACGGCTGGTATCCGAGAGG - Intergenic
922582466 1:226709094-226709116 GGAGACAGCTGGTGGCCCAGAGG - Intronic
923826114 1:237502630-237502652 GGCCACTGCTGATCTCACAGGGG + Intronic
924679734 1:246219877-246219899 GTTCACTGCTGGTGCCGTAGTGG + Intronic
1069692626 10:70363911-70363933 GGTCTGTGCTGCTCTCCCAGGGG - Intronic
1072791159 10:98318832-98318854 GGACAGTGCTGGTGACCCTGGGG + Intergenic
1073509494 10:104034425-104034447 GTTCACTTCTGGTCTCTCAGGGG - Intronic
1075589347 10:123680086-123680108 GCTCAGTGGTGGTGGCCCAGGGG + Intronic
1075847675 10:125558318-125558340 GGTCACTTCTGGCATCGCAGAGG - Intergenic
1076278628 10:129226044-129226066 GGTCTCTGCAGGAGGCCCAGCGG + Intergenic
1076357795 10:129865606-129865628 GGCCAGGGCTGCTGTCCCAGAGG - Intronic
1076547775 10:131257295-131257317 GGTCCCTGCTGCCCTCCCAGGGG - Intronic
1079082670 11:17424770-17424792 GGTCACTGCTGGGGCCCCCAGGG - Intronic
1080862168 11:36159497-36159519 GCTCACTGCTGTAATCCCAGGGG + Intronic
1081296210 11:41392800-41392822 GGGAACTGCTAGTGGCCCAGAGG + Intronic
1081717752 11:45262972-45262994 GGTGACTGCTGGATTTCCAGGGG - Intronic
1082693444 11:56332050-56332072 GGACAGCGCTGCTGTCCCAGTGG - Intergenic
1084325383 11:68397087-68397109 TGTGGCTGCAGGTGTCCCAGGGG - Intronic
1084526212 11:69699660-69699682 GGTCACTGCTGGTGGCCACCAGG - Intronic
1086454555 11:86948258-86948280 GGTCCCTGCTCCTTTCCCAGAGG + Exonic
1090716583 11:129436878-129436900 GGTCTCTGCTGAGGCCCCAGGGG + Exonic
1092217985 12:6695644-6695666 GGTCCCAGCTGGGGTACCAGAGG + Exonic
1093684821 12:22044397-22044419 GCTCAGTGCTGGTGTCTCTGAGG + Intergenic
1097282248 12:57852322-57852344 GGGCACTGCTGATCTCCCTGGGG + Intergenic
1099179000 12:79456248-79456270 TGTTACTCCTGGTGTCACAGTGG - Intergenic
1101143674 12:101821255-101821277 GTTCACTGCTGGATCCCCAGGGG + Intronic
1105220372 13:18320725-18320747 GGTAGCTGCTGTTGACCCAGAGG - Intergenic
1113432417 13:110262197-110262219 GGTCACTGCCTGAGTCCCACAGG + Intronic
1113835478 13:113325955-113325977 GGACGCTGCTGGTGTCCCGCTGG - Exonic
1114408956 14:22482831-22482853 GGTGAGTGCTGGAGTTCCAGAGG - Intergenic
1114794674 14:25700090-25700112 GGTCACTGCCAGTTTTCCAGTGG + Intergenic
1117257865 14:53998784-53998806 GGCCATTGCTGGTGTCCCTGGGG + Intergenic
1117733169 14:58744323-58744345 GGTCACAGCTGGTATGCCATTGG + Intergenic
1119259908 14:73231959-73231981 GGTCCCTGGTGCTGTCCCTGGGG - Intergenic
1119420894 14:74507353-74507375 GGTCACTGCTGTGGTCCCACAGG + Intronic
1119537985 14:75418611-75418633 GGTAACTGCTCCTGTGCCAGTGG + Intergenic
1120587069 14:86325301-86325323 TGTCACTGGTGGTGTCACAGGGG + Intergenic
1122303866 14:100749097-100749119 GGTCTCTGCTGGTGGCCCATCGG - Intergenic
1123138431 14:106051958-106051980 AGTCATTGCTGGAGTCACAGGGG + Intergenic
1202869973 14_GL000225v1_random:153368-153390 GGTAGCTGCTGTTGACCCAGAGG - Intergenic
1127910406 15:63411623-63411645 GGCCACAGCTGGGGGCCCAGGGG + Intergenic
1129538563 15:76333512-76333534 TGTCAGTGCTGGTCTCTCAGGGG + Intergenic
1130990323 15:88872100-88872122 AGGCACAGCTGGTGGCCCAGGGG + Intronic
1132545238 16:529984-530006 GGGCACTCCTGCTGTGCCAGGGG - Intronic
1132978513 16:2722189-2722211 GGTCACTGATGGGATCTCAGAGG + Intergenic
1133078228 16:3295903-3295925 GGTCAAGGCTAGTGTCCCTGGGG - Intronic
1134452363 16:14371315-14371337 GGTCACTCCTGGTCGCACAGAGG - Intergenic
1135074275 16:19380011-19380033 GGTCACTGCTGTATCCCCAGAGG - Intergenic
1136293157 16:29287844-29287866 GTTCCCTGCTGGTGGCACAGAGG + Intergenic
1136557214 16:31014480-31014502 GTTCACTGCTGGTTCTCCAGTGG + Intergenic
1137931078 16:52588282-52588304 GATCAAGGCTGGTGTCTCAGAGG - Intergenic
1138344072 16:56309205-56309227 GGTAACTTCTGGTCTCCTAGTGG - Intronic
1138457388 16:57129212-57129234 GGTCCCTGCAGGGGTCCCCGTGG - Intronic
1139776412 16:69319581-69319603 CGGCACTGCTAGTGACCCAGCGG + Intronic
1140471725 16:75219059-75219081 GGTGAGTGCTGGTGCCCGAGGGG + Exonic
1140507880 16:75485815-75485837 GGGACCTGATGGTGTCCCAGTGG + Intronic
1140895820 16:79323299-79323321 TGTCACGAATGGTGTCCCAGGGG + Intergenic
1140903032 16:79387444-79387466 GGTCAATGCATGAGTCCCAGTGG + Intergenic
1141675907 16:85517223-85517245 GGTCCCTCCTGGTGTCTCTGTGG + Intergenic
1142006639 16:87692455-87692477 AGACCCTGCTGGTGGCCCAGGGG - Intronic
1142099041 16:88261851-88261873 GTTCCCTGCTGGTGGCACAGAGG + Intergenic
1142177777 16:88652812-88652834 GGGCACTGCTTCTGTCACAGGGG + Intronic
1145797398 17:27663863-27663885 GGTCACTGCTGCTCTCCCTCAGG - Intergenic
1147882002 17:43660294-43660316 AGTCCGTGCTGGAGTCCCAGAGG - Intronic
1148026840 17:44594474-44594496 GGGAACTCCTGGTGTACCAGTGG + Intergenic
1148186765 17:45650044-45650066 GGTCAGTGCTCTTGTCCCATGGG + Intergenic
1148243194 17:46013242-46013264 GGCCACTGCTGGAGGCCCTGGGG + Intronic
1150704930 17:67477973-67477995 TGTCACTGCTGGCTTCCCCGAGG + Intronic
1151711504 17:75809624-75809646 GGTCTCTCCTGGTGTTCCAGTGG + Intronic
1151851648 17:76694144-76694166 GCTCACTGCTCTGGTCCCAGAGG - Intronic
1152578799 17:81156986-81157008 GGGCACCGTTGCTGTCCCAGAGG - Intronic
1152788901 17:82267506-82267528 GGTCACTGGCGGTGACCCGGTGG - Intronic
1156463100 18:37332651-37332673 GCACACTGCTGGTTTCCCAGGGG + Intronic
1160159280 18:76459261-76459283 GGTCACTGCTGGAGGCACACTGG + Intronic
1160235011 18:77078845-77078867 GGTCCCTGCCTGTGACCCAGTGG + Intronic
1160685796 19:436118-436140 GGTCACTGGGGGTGTCCCCAGGG + Intronic
1160770139 19:827493-827515 GGGCAGTGCTGGAGCCCCAGTGG + Intronic
1161709821 19:5841653-5841675 GGGCAGTGCTGGGGTTCCAGAGG + Intergenic
1161716028 19:5876805-5876827 GGGCAGTGCTGGTGTTCCAGAGG + Intronic
1163021372 19:14482640-14482662 GGTCCCTGATGGTGGACCAGAGG - Intronic
1166368258 19:42287953-42287975 GGGCACTGCTGCTGCCCCTGGGG + Exonic
1166822422 19:45588627-45588649 GGTGACTGCAGGAGTCCAAGAGG - Intronic
1166991109 19:46693287-46693309 GGACAGTGCTGGGGACCCAGTGG - Intronic
1168080243 19:54004834-54004856 GGTCAGTGCTGGTCTCTCTGAGG - Intronic
925213107 2:2068140-2068162 GGTGATTGCTGACGTCCCAGGGG + Intronic
927774496 2:25891916-25891938 GGTCACTGCTATTGACCCATGGG - Intergenic
931257506 2:60585939-60585961 GGTCACTGCTGGACACCCAGTGG - Intergenic
932435124 2:71698861-71698883 TGACACTGCTGATGACCCAGAGG + Intergenic
934183681 2:89651750-89651772 GGTAGCTGCTGTTGACCCAGAGG + Intergenic
934293968 2:91725921-91725943 GGTAGCTGCTGTTGACCCAGAGG + Intergenic
935689425 2:105717262-105717284 GGCCACTGCTGGTTTGCCACTGG + Intergenic
937000163 2:118458506-118458528 AGACACTGCTTGTGTCCCAAAGG + Intergenic
937195937 2:120156400-120156422 GGGCACTGCTGTAGCCCCAGGGG - Intronic
938119803 2:128625519-128625541 GGGCACTGCTGGTGTCCTCCTGG - Intergenic
941138532 2:161747054-161747076 TGCCACAGCTGGTGTCTCAGTGG + Intronic
946185945 2:217980381-217980403 GGAGGCTGCTGGTGTCCAAGAGG - Intronic
946655795 2:221945751-221945773 TGTAACTGCTGCTGTCTCAGGGG - Intergenic
948587354 2:239027794-239027816 GGCCACTGCTGGGGGCCCTGTGG - Intergenic
949026842 2:241770333-241770355 GGTGGCTGCTGCTGGCCCAGGGG + Intergenic
1170500244 20:16968269-16968291 GGTCACAGCTGGTGTCAGGGAGG - Intergenic
1170588371 20:17752619-17752641 GGTCACTGCTGGTGCCCTAATGG + Intergenic
1170708029 20:18763551-18763573 GGGCACTGCCGGTGGGCCAGGGG + Exonic
1172093021 20:32446916-32446938 GGTGCCTGGTGGTGTCCCTGTGG + Exonic
1172845415 20:37927460-37927482 GGCCACTTCTGGTGTCCCGGTGG + Intronic
1173747897 20:45452108-45452130 GGTCAAGGCTGGCGTCGCAGAGG + Intergenic
1179396725 21:41046946-41046968 GGTCACTGCTGCTGGTCCAGCGG - Intergenic
1179973690 21:44850768-44850790 GTTGACTGCTCGTGTGCCAGCGG - Exonic
1181053196 22:20247263-20247285 GGACATGGCTGGTGTCCGAGAGG - Intronic
1181310749 22:21943593-21943615 GGTCAGTGCTGGGGGCGCAGGGG - Intronic
1183155188 22:36069500-36069522 TGTCACTGCTGCTGCCCCACTGG + Intergenic
1183241961 22:36664365-36664387 GTTCACTGCTGGAGCCCCAGTGG - Intronic
1185232947 22:49693785-49693807 GGTTAATGCTGGTTTCCTAGAGG - Intergenic
951768457 3:26227258-26227280 GGTCTCTGGTGGTGTTCCACAGG + Intergenic
951805104 3:26635234-26635256 AGCCACTGCAGGAGTCCCAGAGG + Intronic
953128166 3:40111608-40111630 GGACAGTGCAGGAGTCCCAGGGG + Intronic
954132214 3:48566601-48566623 GGTGACTTCTGTTGTCCCTGAGG - Intronic
955971801 3:64444721-64444743 GGGCACTGCCAGTGCCCCAGGGG + Intronic
956490641 3:69767803-69767825 GGCCAGGGCTGGTGTCACAGAGG + Intronic
961732172 3:128973729-128973751 GCTCACAGCCTGTGTCCCAGGGG + Intronic
962916429 3:139908361-139908383 AGTCAATCCTGGTATCCCAGTGG - Intergenic
965604633 3:170485956-170485978 GGTGTCTGCTGCTGCCCCAGGGG - Intronic
967121497 3:186386422-186386444 CTTCACTGGTGGTGTCTCAGTGG - Intergenic
968815489 4:2819578-2819600 GGTCACTCCTGTGGCCCCAGTGG - Intronic
968914596 4:3491937-3491959 GATCACTGCTTGTCCCCCAGAGG + Intronic
969147357 4:5135874-5135896 GGTCACTGCTGGCTGCACAGTGG + Intronic
969766840 4:9235955-9235977 GGGCTCTGCTTGTGTGCCAGTGG + Exonic
969867102 4:10083305-10083327 GGACACTGCAGGCTTCCCAGGGG - Intronic
969964719 4:10982460-10982482 GGTTACTGTTGGTGTCTCTGTGG + Intergenic
970145839 4:13034995-13035017 GGTCAATGCTGGTCTCTCAAAGG + Intergenic
972442009 4:39103602-39103624 GGTGACTGCTGCTGACGCAGTGG - Intronic
977021959 4:91770712-91770734 GGTCATTGAAAGTGTCCCAGTGG + Intergenic
984999849 4:185471821-185471843 GGTCCCTGGTGGGGTCCCGGTGG + Intronic
985535409 5:462368-462390 GTTCACAGCCTGTGTCCCAGAGG - Intronic
985733533 5:1564550-1564572 GGCCGCTCCTGGTGTCACAGGGG + Intergenic
988408640 5:30857229-30857251 GGTCACTGTTGGTCACCCTGTGG - Intergenic
990652283 5:57915259-57915281 TGTCACTGTTGGTGCCCTAGAGG + Intergenic
992109763 5:73481946-73481968 GGTCTCTGCTGCTGGCACAGTGG + Intergenic
993031285 5:82708698-82708720 GGAGAGTGGTGGTGTCCCAGAGG - Intergenic
993178664 5:84520287-84520309 GGTCACTGCTGTTCCTCCAGTGG + Intergenic
994471332 5:100211778-100211800 GGTCACTTCTGTAGGCCCAGTGG - Intergenic
995066539 5:107869196-107869218 GCTGACTCCTGGTGGCCCAGAGG + Intronic
995549560 5:113267247-113267269 AGTCACTTTTGGTGTGCCAGTGG - Intronic
996884312 5:128338017-128338039 GGTGACAGCTCGTGTCCCAGTGG + Exonic
998149374 5:139748121-139748143 GGTCAGTGCTGGGGCCCCGGGGG - Intergenic
1000119038 5:158179304-158179326 GGTCAGTGCTGGTGTTTGAGGGG - Intergenic
1002076665 5:176712520-176712542 GGTCCCTGCTCATGTTCCAGTGG + Intergenic
1002103570 5:176869113-176869135 TGTGACTGCTGGGGGCCCAGGGG + Intronic
1002299345 5:178248563-178248585 GGACACTGGAAGTGTCCCAGTGG + Intronic
1003184046 6:3815192-3815214 AGTCACTGATGGACTCCCAGAGG - Intergenic
1004026822 6:11827233-11827255 TGCCACTGCTTGGGTCCCAGGGG + Intergenic
1004791872 6:19035489-19035511 TGTCACTGCTGGCTTCACAGAGG + Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1008844681 6:55949386-55949408 GGTTACTGCTGGTGTCTCTGAGG - Intergenic
1009853923 6:69235042-69235064 GGTAACTGAAGGTGTGCCAGAGG - Exonic
1011227822 6:85127135-85127157 TGTCACTGCTGGTTCCCCAGGGG + Intergenic
1013372271 6:109481585-109481607 GAACACTGCTGGTGCCCCAGTGG - Exonic
1014073497 6:117210587-117210609 GGTCACTCTTGGTGACCAAGTGG - Intergenic
1017037596 6:150280403-150280425 GAACACCGCTGGTGTCCCTGAGG - Intergenic
1017154561 6:151311486-151311508 GATCACAGCTGGTGTCACAGTGG - Intronic
1019137343 6:169918556-169918578 GGTCAGGGCTGGAATCCCAGAGG + Intergenic
1019408634 7:897223-897245 GGGCACTGCTGGTTTCCCCCGGG + Intergenic
1019710500 7:2516211-2516233 GGGCACTGCTACTGGCCCAGAGG + Intronic
1019884747 7:3893956-3893978 TGTCCCTGCTGGTTTCCCAATGG + Intronic
1021976045 7:26012161-26012183 GGTCATTGCTGGTGTTCTGGGGG - Intergenic
1023967985 7:44973177-44973199 GGACACTCCTTGTGTTCCAGAGG + Intronic
1026482459 7:70790414-70790436 GGTCCCGGATGGGGTCCCAGTGG - Exonic
1026841299 7:73671231-73671253 GGGCACTGCTGGTGGCCCCCGGG - Exonic
1029864771 7:103615578-103615600 GATCCCTGATGGTCTCCCAGAGG - Intronic
1030128032 7:106173165-106173187 GGTCTCTACTGGTGTGCCAAGGG - Intergenic
1032078685 7:128848138-128848160 GATCACTGCTGGAGTCCCCTGGG + Intronic
1032491942 7:132330310-132330332 GGTCACTGCTGGTGTCCCAGAGG - Intronic
1033053373 7:138027351-138027373 GGTGACTGCTGGTGTCTCCATGG - Intronic
1033929598 7:146506226-146506248 GGTCACTGCTGAGGTTGCAGGGG - Intronic
1034498966 7:151438025-151438047 GGTCACTGTGGCTGTTCCAGCGG + Exonic
1035234778 7:157489175-157489197 GGTCCCTGCTGGAGTCGCTGGGG - Intergenic
1035545023 8:473648-473670 AGGCACTGCTGGTGCCACAGGGG + Intergenic
1035669790 8:1408533-1408555 TGACAATGCTGGAGTCCCAGTGG - Intergenic
1036234526 8:7026811-7026833 GGTCGCTACCGGTGTCCCTGAGG - Intergenic
1037881132 8:22574021-22574043 GGTCACTGATGGAGTCACTGGGG - Intronic
1038779333 8:30557049-30557071 GGTACCTGCTGGTGGCCCTGAGG + Intronic
1042685439 8:71433750-71433772 GGTGACTGCTGAGGTCGCAGGGG + Intronic
1048965259 8:139610181-139610203 GGTGAGTGCTGGTGACCCAGAGG - Intronic
1049071420 8:140358717-140358739 CGTCACTGCTGCTGTCCAGGTGG - Intronic
1049800066 8:144513539-144513561 GGACAGAGCTGGTGTCCCCGTGG - Intronic
1051383989 9:16487044-16487066 TGTCACTTCTGGATTCCCAGTGG - Intronic
1055846500 9:80570065-80570087 GTCCACTGATGGTGTCCCACAGG - Intergenic
1056316644 9:85396793-85396815 AGTCACTACTTGTTTCCCAGAGG + Intergenic
1058097632 9:100880920-100880942 GGTCACTTCTGTAGGCCCAGAGG - Intergenic
1058699573 9:107589367-107589389 GGTCACTGCTGCTGGCCCTCTGG + Intergenic
1060028050 9:120189853-120189875 TGTCGCTGAAGGTGTCCCAGAGG + Intergenic
1060185703 9:121562895-121562917 GGTCACTGCTGTGGTCCCTAAGG - Intergenic
1060588643 9:124802321-124802343 GCTCTCTTCTGATGTCCCAGAGG + Intronic
1060904098 9:127289134-127289156 GGTCACTGCCGTTTTCACAGGGG - Intronic
1061140668 9:128764326-128764348 GGACACTGCTGGGCGCCCAGTGG + Intronic
1061264732 9:129498264-129498286 GGACACTGGTGCTGTCCCCGAGG + Intergenic
1062352955 9:136148117-136148139 GTTGGCTGCTGGTGCCCCAGAGG - Intergenic
1062383915 9:136301032-136301054 GCTCACTGCTGGTGGCTCCGCGG - Intronic
1062496944 9:136836396-136836418 GGTCCCTGCCTGGGTCCCAGGGG - Intronic
1062629082 9:137455578-137455600 GGGCACAGCTGTTGTCCCTGGGG - Intronic
1203734480 Un_GL000216v2:123177-123199 GGTAGCTGCTGTTGACCCAGAGG + Intergenic
1185931354 X:4206919-4206941 GCTTGCTGCAGGTGTCCCAGGGG + Intergenic
1186477113 X:9866057-9866079 GGCCCCTGCTGTGGTCCCAGAGG - Intronic
1186657757 X:11633448-11633470 GGTCACAGGAGGTCTCCCAGTGG - Intronic
1187245005 X:17546104-17546126 GGCTAGTGCTGGTGTCTCAGAGG + Intronic
1187295386 X:17994663-17994685 GGTCCCTGCTGCTGTGTCAGAGG - Intergenic
1188949509 X:36352188-36352210 TGTCACTGGTTGTGTCCTAGAGG - Intronic
1196932112 X:120692531-120692553 GCTCTCTGCTGGTGTGTCAGAGG + Intergenic
1197827910 X:130610545-130610567 GTTCACTGCTGTATTCCCAGCGG + Intergenic
1199339575 X:146661073-146661095 TGTCACTGCTGGTGTCAGTGGGG + Intergenic
1199962561 X:152789351-152789373 GTTGACTGCTGGTGTCATAGCGG + Intergenic
1200079390 X:153568368-153568390 GGCTACAGATGGTGTCCCAGTGG - Intronic
1200468818 Y:3556745-3556767 GGGCACTGCTGGTTTGCCAAGGG + Intergenic
1202626552 Y:56865422-56865444 GGTAGCTGCTGTTGACCCAGAGG - Intergenic