ID: 1032491966

View in Genome Browser
Species Human (GRCh38)
Location 7:132330544-132330566
Sequence ATGTGAAAATGTAAAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032491963_1032491966 18 Left 1032491963 7:132330503-132330525 CCTGTAGGAGTCCTGAGTACTTC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1032491966 7:132330544-132330566 ATGTGAAAATGTAAAGAAGTTGG No data
1032491964_1032491966 7 Left 1032491964 7:132330514-132330536 CCTGAGTACTTCTTTACCGCACA 0: 1
1: 0
2: 1
3: 2
4: 44
Right 1032491966 7:132330544-132330566 ATGTGAAAATGTAAAGAAGTTGG No data
1032491965_1032491966 -9 Left 1032491965 7:132330530-132330552 CCGCACACTTTAAAATGTGAAAA 0: 1
1: 1
2: 3
3: 56
4: 716
Right 1032491966 7:132330544-132330566 ATGTGAAAATGTAAAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032491966 Original CRISPR ATGTGAAAATGTAAAGAAGT TGG Intronic
No off target data available for this crispr