ID: 1032491976

View in Genome Browser
Species Human (GRCh38)
Location 7:132330598-132330620
Sequence ATGCAGACACAGTTGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 250}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032491976_1032491984 -7 Left 1032491976 7:132330598-132330620 CCAGGCCCCAACTGTGTCTGCAT 0: 1
1: 0
2: 1
3: 17
4: 250
Right 1032491984 7:132330614-132330636 TCTGCATCTGGCTGTAGGAGGGG No data
1032491976_1032491987 8 Left 1032491976 7:132330598-132330620 CCAGGCCCCAACTGTGTCTGCAT 0: 1
1: 0
2: 1
3: 17
4: 250
Right 1032491987 7:132330629-132330651 AGGAGGGGAGTGGCCCAAATGGG No data
1032491976_1032491992 30 Left 1032491976 7:132330598-132330620 CCAGGCCCCAACTGTGTCTGCAT 0: 1
1: 0
2: 1
3: 17
4: 250
Right 1032491992 7:132330651-132330673 GAACTCTTAGGGAAATGACATGG No data
1032491976_1032491983 -8 Left 1032491976 7:132330598-132330620 CCAGGCCCCAACTGTGTCTGCAT 0: 1
1: 0
2: 1
3: 17
4: 250
Right 1032491983 7:132330613-132330635 GTCTGCATCTGGCTGTAGGAGGG No data
1032491976_1032491989 19 Left 1032491976 7:132330598-132330620 CCAGGCCCCAACTGTGTCTGCAT 0: 1
1: 0
2: 1
3: 17
4: 250
Right 1032491989 7:132330640-132330662 GGCCCAAATGGGAACTCTTAGGG No data
1032491976_1032491986 7 Left 1032491976 7:132330598-132330620 CCAGGCCCCAACTGTGTCTGCAT 0: 1
1: 0
2: 1
3: 17
4: 250
Right 1032491986 7:132330628-132330650 TAGGAGGGGAGTGGCCCAAATGG 0: 1
1: 0
2: 0
3: 13
4: 175
1032491976_1032491985 -2 Left 1032491976 7:132330598-132330620 CCAGGCCCCAACTGTGTCTGCAT 0: 1
1: 0
2: 1
3: 17
4: 250
Right 1032491985 7:132330619-132330641 ATCTGGCTGTAGGAGGGGAGTGG No data
1032491976_1032491982 -9 Left 1032491976 7:132330598-132330620 CCAGGCCCCAACTGTGTCTGCAT 0: 1
1: 0
2: 1
3: 17
4: 250
Right 1032491982 7:132330612-132330634 TGTCTGCATCTGGCTGTAGGAGG 0: 1
1: 0
2: 1
3: 26
4: 209
1032491976_1032491988 18 Left 1032491976 7:132330598-132330620 CCAGGCCCCAACTGTGTCTGCAT 0: 1
1: 0
2: 1
3: 17
4: 250
Right 1032491988 7:132330639-132330661 TGGCCCAAATGGGAACTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032491976 Original CRISPR ATGCAGACACAGTTGGGGCC TGG (reversed) Intronic
900184437 1:1326314-1326336 AAGCAGAGACAGGTGGGGCCGGG - Intronic
901207524 1:7505510-7505532 GTGCAGGCCCAGATGGGGCCGGG + Intronic
902726129 1:18337448-18337470 AGGCAGACACAGTTGTGCCCAGG - Intronic
903610211 1:24605917-24605939 ATGTGGACACAGTTGGGGTAGGG - Exonic
906302841 1:44696124-44696146 TTGCTGCCATAGTTGGGGCCAGG - Intronic
907595201 1:55713243-55713265 ATCCAGCCACTGTTGGGACCTGG + Intergenic
908618188 1:65946756-65946778 ATGCAGACCCATTTGTTGCCTGG + Intronic
909056228 1:70824540-70824562 CTGGAGACATAGTCGGGGCCAGG - Intergenic
910794009 1:91080039-91080061 AAGAAGACACAGTTTTGGCCGGG + Intergenic
912420437 1:109539098-109539120 AAGGAGACAGAGTGGGGGCCAGG - Intergenic
912500992 1:110121739-110121761 TTGGTGACAGAGTTGGGGCCAGG + Intergenic
912779110 1:112527389-112527411 ATGCAGAGGCAGTTGGGGGTGGG - Intronic
913230511 1:116737045-116737067 CTGCAGATACAGATGGGGTCTGG + Intergenic
915025092 1:152820565-152820587 ATTCAGTCAAATTTGGGGCCGGG - Intergenic
917737915 1:177937213-177937235 CTGCAGACACACCTGGGCCCTGG - Exonic
919561698 1:199127939-199127961 ATTCTGACACATTTGGGGGCAGG + Intergenic
919816402 1:201443514-201443536 ATGCAGGAAAAGTGGGGGCCAGG + Intergenic
1063358506 10:5426695-5426717 GTGAAGTCCCAGTTGGGGCCAGG - Exonic
1064354217 10:14603782-14603804 AGGCAGACAAAGCCGGGGCCGGG - Intronic
1064935772 10:20677676-20677698 ATGCCGACAGATTTGGTGCCTGG + Intergenic
1065211220 10:23405222-23405244 ATTCAGAATCAGTTGTGGCCAGG - Intergenic
1067080689 10:43210746-43210768 ATGTAGGCACAGACGGGGCCGGG + Intronic
1067467750 10:46513642-46513664 ATGCAGACACATATGGAACCAGG + Intergenic
1067619436 10:47870963-47870985 ATGCAGACACATATGGAACCAGG - Intergenic
1069583841 10:69583603-69583625 ATGAAGGCAGAGTTGAGGCCAGG + Intergenic
1070559262 10:77553557-77553579 ATGCACACCCAGTCAGGGCCTGG + Intronic
1071228991 10:83563680-83563702 AGGCAGACAGGATTGGGGCCTGG + Intergenic
1071901470 10:90124813-90124835 ATGCAGACACTGGTGGGGAAAGG - Intergenic
1071957407 10:90774223-90774245 ATTCAGACACATTTGGAGTCTGG - Intronic
1073106940 10:101037485-101037507 CTGGAGAGAGAGTTGGGGCCTGG - Intronic
1075013024 10:118891167-118891189 ATTCAGATCCAGTTGGGGCCAGG + Intergenic
1075342310 10:121657005-121657027 ATGAAGACACAGAGAGGGCCGGG - Intergenic
1075715669 10:124553834-124553856 CTGCAGACAGAGGAGGGGCCTGG - Intronic
1075810898 10:125224040-125224062 ATTCGGACCCATTTGGGGCCAGG - Intergenic
1075932926 10:126314383-126314405 ATGCAGACAGAGTAGGGCACAGG + Intronic
1077014798 11:394743-394765 CTCCAGGCACAGGTGGGGCCTGG - Intronic
1077076269 11:703600-703622 TTGGAAACACAGGTGGGGCCTGG - Intronic
1077522881 11:3046652-3046674 CTCCAGACTCCGTTGGGGCCTGG - Intronic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083482593 11:62959373-62959395 ATTCAGACAAAGTTGGGTCAAGG + Intronic
1084428089 11:69096532-69096554 AAGCAGAGAAGGTTGGGGCCGGG - Intergenic
1085625694 11:78070784-78070806 ATGCACAGACAGTGGGAGCCCGG - Intronic
1085657156 11:78326810-78326832 AAGCAGACACAGTTCTGACCCGG + Intronic
1090250425 11:125247112-125247134 AAGCAGAAACTGTTGGGGCCTGG - Intronic
1091121366 11:133060602-133060624 ATGCAGCCACAGTAGGAGCAGGG - Intronic
1091317894 11:134628289-134628311 ATGCAGAAACAGTATGGGGCAGG - Intergenic
1092141143 12:6184324-6184346 TTGCAGACAGAGGAGGGGCCAGG - Intergenic
1092991989 12:13911967-13911989 AAGCAGCCACACTCGGGGCCAGG + Intronic
1096277771 12:50225195-50225217 TTAAAGAGACAGTTGGGGCCAGG - Intronic
1096471219 12:51877333-51877355 ATACACACACACTTGAGGCCAGG - Intergenic
1097223622 12:57464221-57464243 AAGAAGTCACAGATGGGGCCGGG + Intronic
1099429899 12:82571152-82571174 AAGCTGTCATAGTTGGGGCCGGG + Intergenic
1101951128 12:109176045-109176067 ATGCAGAGCCTGTGGGGGCCAGG + Intronic
1102478545 12:113204623-113204645 TTGTAGAAAAAGTTGGGGCCAGG + Intronic
1102524457 12:113501389-113501411 ATGCAAACACAATTGGTGCATGG + Intergenic
1102894666 12:116589153-116589175 ATGATGAAACAGTTTGGGCCAGG + Intergenic
1103942661 12:124509396-124509418 CTTCAGGCACAGTTGGGTCCAGG - Intronic
1105278243 13:18948504-18948526 ATGCAGTGACAGATGTGGCCGGG - Intergenic
1105294601 13:19076701-19076723 AAGCAGGCACAGCTGGTGCCAGG - Intergenic
1106433990 13:29707992-29708014 TTGCAGACAGAGGTGGAGCCGGG - Intergenic
1107282817 13:38755945-38755967 ATGTAGACACAGCTGTGGCTTGG - Intronic
1107389691 13:39951355-39951377 ATTCAGACACAGCTCGGGGCTGG - Intergenic
1108368776 13:49746165-49746187 ATGAAAACACAATTTGGGCCAGG + Intronic
1110766881 13:79290418-79290440 AGACATACACAGTTGGGGCAGGG - Intergenic
1112222920 13:97509371-97509393 ATGTATACACTGTTGGGGGCGGG - Intergenic
1112784170 13:102933571-102933593 ATCCAGACACAGTGGATGCCTGG + Intergenic
1113945731 13:114043110-114043132 TTGCAGACAAAGGAGGGGCCTGG - Intronic
1115123799 14:29969800-29969822 ATGCTGGCACATTTGGTGCCTGG + Intronic
1116706408 14:48307808-48307830 CTGCAGAAACATTTGGGGCTGGG + Intergenic
1117694097 14:58340778-58340800 CTTAAGACACAGGTGGGGCCGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119514454 14:75237024-75237046 TTCCAGACAAAGTGGGGGCCCGG + Intergenic
1119583894 14:75813596-75813618 ATTCAAAAACAGTTTGGGCCAGG - Intronic
1119705366 14:76779726-76779748 AAGTAGACGCAGTTAGGGCCTGG - Exonic
1119828391 14:77677913-77677935 ATGCAGAGACAGTTTGGACAGGG - Intronic
1121292859 14:92791804-92791826 ATGCATACATTATTGGGGCCAGG - Intergenic
1121678023 14:95770226-95770248 ATAGAGACACACTGGGGGCCAGG - Intergenic
1122183186 14:99970823-99970845 AAGAAGACACAGTTCCGGCCCGG - Intergenic
1122783703 14:104154423-104154445 CTGCGGCCACAGGTGGGGCCTGG + Intronic
1122795894 14:104206060-104206082 GTGCAGTCGCAGTCGGGGCCTGG - Intergenic
1202829218 14_GL000009v2_random:8170-8192 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1202900930 14_GL000194v1_random:38022-38044 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1124930670 15:34116201-34116223 ATGCAGAACCTGTTTGGGCCAGG - Intergenic
1125827593 15:42689489-42689511 CTGCAGACAGAGATGTGGCCTGG - Exonic
1127257314 15:57303234-57303256 ATGAAGACAGAGGTGGGTCCTGG - Intergenic
1127725534 15:61745607-61745629 AGGCAGATACAGTGGGAGCCAGG - Intergenic
1128532519 15:68464421-68464443 TTGCAGACACAGGTGAGGCCAGG + Intergenic
1129540164 15:76342134-76342156 ATGGGGACACAGGTGGGGCGTGG - Exonic
1129821425 15:78604629-78604651 ATGCAGACCCAGCTGGAGACTGG + Intronic
1131396815 15:92092772-92092794 AAGCACACAAAGTTGGGGGCAGG - Intronic
1131951274 15:97683965-97683987 ATGCAGAAAAAGTTGGGGTGGGG + Intergenic
1132256996 15:100384525-100384547 TTGCTGTCACAGCTGGGGCCTGG - Intergenic
1132810621 16:1795014-1795036 ACGCAGACTCAGCAGGGGCCTGG + Intergenic
1132883873 16:2173877-2173899 GTGAAGGCCCAGTTGGGGCCCGG - Intronic
1132941613 16:2511359-2511381 ATGCAGACACGTTGGGGGGCTGG + Intronic
1134103442 16:11469139-11469161 GTGCAGACACAGGTGGGCCTAGG + Intronic
1134108418 16:11499727-11499749 GTGAAGACACAGCTGGTGCCAGG - Intronic
1134818601 16:17227284-17227306 AGGCAGACACACTTGGGGAAGGG + Intronic
1135194191 16:20381060-20381082 ATGCAGCCACAGTCTGTGCCTGG - Intronic
1136997021 16:35197685-35197707 ATGCAGCCACGGTCAGGGCCTGG + Intergenic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1138608659 16:58105737-58105759 CTGCAGACAGAGGAGGGGCCAGG - Intergenic
1140710152 16:77670267-77670289 ATACAGTCACAGTGGGGGCTGGG - Intergenic
1141859528 16:86706930-86706952 ATGGAGAGACAGTCTGGGCCTGG + Intergenic
1142194234 16:88732229-88732251 AGGCAAACCCAGGTGGGGCCAGG + Intronic
1142274228 16:89107816-89107838 ATGCAGCCACATTTGGGGCTGGG - Intronic
1144956062 17:19019528-19019550 CTGCAGTCACTGGTGGGGCCAGG - Exonic
1145061518 17:19737228-19737250 GAGCAGGCACAGGTGGGGCCAGG + Intergenic
1146770776 17:35567218-35567240 ATCTAAACACAGTTGAGGCCGGG + Intergenic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1148070852 17:44907717-44907739 TAGCAGACACAGTTGGGGATGGG - Intronic
1149488058 17:57059882-57059904 CTTCAGACACAGTTGGATCCAGG - Intergenic
1151783545 17:76263806-76263828 ATACAAACAAATTTGGGGCCAGG + Intergenic
1152244139 17:79176462-79176484 AAGGAGACCCAGTTGGGGCTGGG - Intronic
1152896531 17:82914470-82914492 GTGCAGACACAGCTGGAGGCCGG - Intronic
1154105374 18:11518224-11518246 GTGCAGACACAGTAGGGCCATGG + Intergenic
1154272591 18:12932876-12932898 AAGCAGCAACAGTTGGGGCAGGG - Intergenic
1155329799 18:24703571-24703593 ATGGTGACACAGTTGGCTCCTGG - Intergenic
1157713280 18:49864529-49864551 AAGCAGTCAAAGCTGGGGCCTGG + Intronic
1158152567 18:54388939-54388961 ATGCAGAAAGAGTTGGGGGAGGG + Intergenic
1159924000 18:74250569-74250591 GTGCAGACACAGATGGCGTCCGG - Intergenic
1161475039 19:4480018-4480040 TAGCAGTGACAGTTGGGGCCAGG + Intronic
1163638767 19:18450136-18450158 CTGCAGTCAGAGCTGGGGCCTGG + Intronic
1163803467 19:19382279-19382301 GTGCAAACACAGTTGGGGCTGGG + Intergenic
1164599400 19:29550784-29550806 ATGAAGACACATTTGAGGTCTGG - Intronic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1167114952 19:47483777-47483799 GGGCAGGCATAGTTGGGGCCCGG - Intronic
1167549618 19:50151168-50151190 AGCAAGTCACAGTTGGGGCCAGG - Intergenic
1202643478 1_KI270706v1_random:119619-119641 ATGCAGAGATAGATGTGGCCTGG - Intergenic
927014399 2:18942708-18942730 ATGCAGACAGACTTGAGGCAGGG + Intergenic
928272358 2:29867888-29867910 CTACAGACACAGTTGGGGATGGG + Intronic
931128014 2:59299036-59299058 ATGCAGTCACAGTGGGGGTTAGG - Intergenic
932128655 2:69168025-69168047 ATGCTGACACACATGTGGCCAGG + Intronic
932504948 2:72219907-72219929 ATGGAGACACAGTTGAAGACGGG + Intronic
932804950 2:74775627-74775649 ATAAAAACAGAGTTGGGGCCAGG + Intergenic
934735364 2:96687263-96687285 GGGCAGGTACAGTTGGGGCCAGG - Intergenic
939126492 2:138183901-138183923 ATTCACACACAGTGGGAGCCAGG - Intergenic
940804380 2:158169546-158169568 ATGCAGAGACAGTTGGGAGTAGG - Intergenic
942342197 2:174960545-174960567 ATTAAAACACAGCTGGGGCCGGG + Intronic
945092979 2:206193381-206193403 AAGAAAACACAGCTGGGGCCAGG - Intronic
948434415 2:237943627-237943649 CTGCCGACTCAGTAGGGGCCGGG - Intergenic
948830645 2:240596853-240596875 ATGCGGACGCAGCGGGGGCCAGG - Exonic
1169778537 20:9283227-9283249 ATGCAGCCTCAGCTGGGGGCAGG - Intronic
1171879181 20:30604045-30604067 AAGCAGGCACAGCTGGTGCCAGG - Intergenic
1173303762 20:41828669-41828691 AGGCAGACAGAGATGGGTCCTGG + Intergenic
1176608402 21:8853010-8853032 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1176620304 21:9052800-9052822 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1177827384 21:26099183-26099205 ATGCAGACACAATTTGGATCTGG - Intronic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179227490 21:39467936-39467958 AGCCAGGCACAGTTGAGGCCAGG + Intronic
1180018626 21:45104453-45104475 GTGGAGACACAGTGGGGGTCAGG + Intronic
1180056686 21:45362522-45362544 CTGCAGTCACTGTTGGGCCCTGG - Intergenic
1180076760 21:45467093-45467115 TTGCAGCCACAGTCTGGGCCAGG - Intronic
1180332196 22:11492160-11492182 AAGAAAACACAGTTGGGCCCGGG + Intergenic
1180358485 22:11862814-11862836 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1180379777 22:12129516-12129538 ATGCAGAGATAGATGTGGCCTGG - Intergenic
1180641405 22:17302373-17302395 ATGCAGTCACATTGAGGGCCAGG - Intergenic
1181043298 22:20203036-20203058 AGCCAGGCACAGATGGGGCCAGG + Intergenic
1181167764 22:20992628-20992650 GTACAGACACAGGTGGGACCTGG - Intronic
1181830725 22:25558395-25558417 ATGCAGATCCAGTTGGAGGCAGG - Intergenic
1182121166 22:27787820-27787842 ATGAAGACCCAGATGGGCCCTGG - Intronic
1182330656 22:29549483-29549505 ATGGAGACACACATGGTGCCTGG - Intronic
1182551728 22:31104377-31104399 GTGAAGACACACTTGGGGTCAGG - Exonic
1182805693 22:33068348-33068370 AGACAGACAGAGTTGGGGCCGGG + Intergenic
1183526406 22:38325842-38325864 ATGCAAACCTAGTTGGGCCCAGG + Intronic
1183711020 22:39503179-39503201 AGGCAGGCAGAGTTGGGGTCAGG + Intronic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
950065113 3:10106049-10106071 ATGCAGAGGCCTTTGGGGCCAGG - Intronic
951045330 3:18031389-18031411 AGGCAGACACAGCTGGGAACTGG - Intronic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
954720819 3:52561279-52561301 ATACAGACACAGTATAGGCCAGG + Intronic
959620837 3:108397232-108397254 ATGCTGAGATAGGTGGGGCCAGG - Intronic
961524775 3:127489749-127489771 ATGCAGTCACAGTGGAGGCAAGG - Intergenic
961671564 3:128535760-128535782 ATGGACCCACAGATGGGGCCAGG - Intergenic
961782056 3:129326173-129326195 TTGCAGACACAGCCTGGGCCAGG - Intergenic
962343431 3:134603477-134603499 ATGCAGACTCAGTGGTGTCCAGG + Exonic
962627597 3:137241935-137241957 TTGGAGACACAGTAAGGGCCAGG - Intergenic
962912569 3:139866858-139866880 ATGCAGACACAGGAGGACCCAGG + Intergenic
966971975 3:185052495-185052517 GAGCAGACACTGTGGGGGCCAGG + Exonic
967019355 3:185508859-185508881 ATACCGACACAGCTGAGGCCTGG + Exonic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968540282 4:1164796-1164818 ATGCTGACCCAGTTGGGACAAGG + Intergenic
968962113 4:3750918-3750940 ATCCAGTCACAGCTGGAGCCAGG + Intergenic
969166628 4:5321802-5321824 AGGCAGAGGCAGTTGGGGGCAGG - Intronic
969872270 4:10111976-10111998 ATGCAGGCAAGTTTGGGGCCTGG - Intronic
970469267 4:16360516-16360538 ATGTAGACAGAGTTGGAGCTGGG - Intergenic
972600398 4:40566941-40566963 ATGAAGACACAGAATGGGCCGGG - Intronic
977241255 4:94572715-94572737 ATACAGACACAGATGGGGCATGG + Intronic
981231405 4:142360446-142360468 AAGCAAACACAGTTGAGACCTGG + Intronic
982364128 4:154556651-154556673 ATGCAAACAATTTTGGGGCCAGG - Intergenic
985010374 4:185576262-185576284 ATAAAAACACAGTTAGGGCCAGG - Intergenic
1202770848 4_GL000008v2_random:205533-205555 ATGCAGAGATAGATGTGGCCTGG - Intergenic
985558424 5:569464-569486 GTGCACACCCAGGTGGGGCCAGG + Intergenic
989234700 5:39133233-39133255 ATGCAGACACAGTTTTACCCAGG + Intronic
989238579 5:39177468-39177490 AAGCTGACAGAGTTGGGCCCAGG + Intronic
993526283 5:88969724-88969746 ATGCAGTCACAGTTTTGGCAAGG + Intergenic
993877854 5:93329056-93329078 ATGTAGACACATTTGATGCCAGG - Intergenic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
997394800 5:133550484-133550506 ATTCACCCACAGTTGGGGCTGGG - Intronic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
999090932 5:148935337-148935359 AAGCAGACACAGTCAGGGCTGGG + Intronic
1000997074 5:167970085-167970107 AGGCAGACACAGTCCCGGCCAGG + Intronic
1001298153 5:170513809-170513831 AAACAGACACAGGTAGGGCCTGG + Intronic
1001547332 5:172578831-172578853 GTGCAGACACAGGCAGGGCCTGG + Intergenic
1001862086 5:175066071-175066093 TTCCAGACACAGCTGAGGCCAGG - Intergenic
1002000004 5:176192117-176192139 ATGGAGACACAGGAGGGACCTGG + Intergenic
1003486163 6:6581415-6581437 GTGCAGACTCAGCTGGGGCCAGG - Intergenic
1004318348 6:14611987-14612009 AGGCAGGCACAGTTTGTGCCTGG + Intergenic
1006679709 6:35788155-35788177 CTGCCCACAGAGTTGGGGCCTGG + Intronic
1009649173 6:66451339-66451361 ATGCAGACACCGTTGGAGTAGGG - Intergenic
1015812878 6:137178921-137178943 ATGGAGACACAGTAGGTGCAGGG + Intergenic
1017048435 6:150368916-150368938 ATGCAGACACAGGTGTGCCAGGG - Exonic
1017384413 6:153866900-153866922 ACGCTGACACTGTAGGGGCCTGG - Intergenic
1018701562 6:166431369-166431391 CTGCAGACTGAGGTGGGGCCTGG + Intronic
1020917022 7:14207378-14207400 AGGCAGAAACAGTTCTGGCCAGG + Intronic
1021900573 7:25281064-25281086 ATGCAGAAACTGTTGGGCACTGG + Intergenic
1022091151 7:27108805-27108827 ATGCAGGAACCTTTGGGGCCTGG - Intronic
1022581629 7:31560919-31560941 ATGCAGACAAAGAAGAGGCCAGG + Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023934529 7:44730070-44730092 AGGAAGCCACAGTTGAGGCCAGG + Intergenic
1024047645 7:45596127-45596149 ATGCTGACACACATGAGGCCTGG - Intronic
1026616179 7:71906755-71906777 ATCCAGACAGAGTTAGGGCAGGG + Intronic
1028404287 7:90459476-90459498 TTTAAGAGACAGTTGGGGCCAGG + Intronic
1028722390 7:94048419-94048441 ATGTGGAGACAGTTGGGGCCAGG + Intergenic
1029067782 7:97869479-97869501 ATGCAGAGACAGATGTGGCATGG - Intronic
1029678969 7:102094552-102094574 AAGCAGATACAGTGGGGTCCTGG + Intronic
1029747706 7:102525586-102525608 ATGGAGCCACAGTGGGGGCATGG + Intergenic
1029765657 7:102624676-102624698 ATGGAGCCACAGTGGGGGCATGG + Intronic
1030957756 7:115876552-115876574 ATGCAGTCACTGCTGGAGCCTGG - Intergenic
1032246468 7:130217876-130217898 ATCCAGGCACAGTTGGGGCTAGG + Intergenic
1032403427 7:131639310-131639332 ATGCAGACAGGGGTGGGGCTAGG - Intergenic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1035317816 7:158007616-158007638 ATGAAGACACAGAAGGGGACAGG + Intronic
1035484698 7:159213654-159213676 AGGCAGATACTGGTGGGGCCTGG + Intergenic
1035568684 8:658587-658609 ATGCAGCCACATCGGGGGCCAGG - Intronic
1037516633 8:19638269-19638291 CAGCAGACACAGTTGAGGCAGGG - Intronic
1038276789 8:26127966-26127988 ATGAAGACACAGCTGTGGCCAGG + Intergenic
1039403929 8:37296639-37296661 ATGCAGACACAGTGAGGCTCAGG - Intergenic
1040355571 8:46614835-46614857 ATGCAGAGACAGATGTGGCCTGG - Intergenic
1040879309 8:52188345-52188367 ATGCAGAAACAGTGGGGCACAGG + Intronic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1046482932 8:114846858-114846880 TAGCAGACACTGTTGTGGCCTGG - Intergenic
1048461503 8:134625319-134625341 ATGCAGGCACATTTGAGGTCTGG - Intronic
1048777182 8:137960083-137960105 AAGCATACACACTTGGAGCCAGG + Intergenic
1049105636 8:140610709-140610731 GTGCAGAGACAGTGGGGCCCAGG - Intronic
1049540718 8:143207638-143207660 AGGGAGACACAGTTGGTCCCAGG - Intergenic
1049694679 8:143977398-143977420 AGGCGGCCACAGTTGGGGGCGGG + Exonic
1049837677 8:144748874-144748896 TAGAAAACACAGTTGGGGCCAGG + Intronic
1050815192 9:9802135-9802157 GTGCAGACACAGTCTGGTCCAGG + Intronic
1053314253 9:37037967-37037989 ATGCTGACACAGTTCAGGCCCGG - Intergenic
1054355191 9:64054154-64054176 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1056769133 9:89464382-89464404 AGGCAGCCACAGTTGGGGGTGGG + Intronic
1057386999 9:94613467-94613489 AGCCAGACACTGGTGGGGCCAGG + Intronic
1059440235 9:114302429-114302451 ATCCAAAGAGAGTTGGGGCCGGG + Intronic
1060299667 9:122367940-122367962 CTGCCTACACAGGTGGGGCCGGG + Intergenic
1061204080 9:129153005-129153027 ATACAGACACAGGAGGGGGCAGG + Intergenic
1061366196 9:130173303-130173325 TGGCAGACAGAGATGGGGCCAGG - Intronic
1062355715 9:136161073-136161095 ATGGGGACACAGTCTGGGCCAGG + Intergenic
1203703801 Un_KI270742v1:18220-18242 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1203566594 Un_KI270744v1:96260-96282 ATGCAGAGATAGATGTGGCCTGG - Intergenic
1186760078 X:12713952-12713974 ATGCATACATATGTGGGGCCAGG - Intronic
1187156919 X:16728740-16728762 ATAAAGACACAGTTGAGGCTGGG + Intronic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1189821895 X:44876634-44876656 GTGCAGACTAAATTGGGGCCGGG - Intronic
1193080868 X:77404767-77404789 AGGGAGACACTGCTGGGGCCAGG - Intergenic
1194687525 X:96940960-96940982 AGGAAAACACAGCTGGGGCCAGG - Intronic
1196619468 X:117806279-117806301 ATGCAGCCACAGATGGGGGTTGG - Intergenic
1198848989 X:140945010-140945032 ATCCAGACACAGATGGCCCCAGG + Intergenic
1201920260 Y:19226345-19226367 ATGAAAACACAGTGGGAGCCTGG - Intergenic