ID: 1032492190

View in Genome Browser
Species Human (GRCh38)
Location 7:132331912-132331934
Sequence ACCCAGATCTCAACACTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032492190_1032492192 -1 Left 1032492190 7:132331912-132331934 CCCTTGAGTGTTGAGATCTGGGT 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1032492192 7:132331934-132331956 TCCTAGACCCTGCTCAGATAAGG 0: 1
1: 0
2: 0
3: 22
4: 112
1032492190_1032492198 22 Left 1032492190 7:132331912-132331934 CCCTTGAGTGTTGAGATCTGGGT 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1032492198 7:132331957-132331979 CATCTGGACAACCTTGGACAAGG 0: 1
1: 0
2: 7
3: 30
4: 171
1032492190_1032492197 16 Left 1032492190 7:132331912-132331934 CCCTTGAGTGTTGAGATCTGGGT 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG 0: 1
1: 0
2: 0
3: 7
4: 115
1032492190_1032492195 6 Left 1032492190 7:132331912-132331934 CCCTTGAGTGTTGAGATCTGGGT 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1032492195 7:132331941-132331963 CCCTGCTCAGATAAGGCATCTGG 0: 1
1: 0
2: 2
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032492190 Original CRISPR ACCCAGATCTCAACACTCAA GGG (reversed) Intronic
900235278 1:1586422-1586444 GCCAAGAGCTCAACACTCACCGG + Intergenic
902071954 1:13748010-13748032 AACCAGTTCTCAAAACTGAAAGG - Intronic
902946628 1:19845387-19845409 ACCTAGGTCTCAGCACTCACTGG - Intergenic
903315169 1:22497932-22497954 ACCCAGCCCTCAGCAGTCAAGGG + Intronic
905891442 1:41520980-41521002 ACCCAGGTCTCAAGACTCGGGGG + Intronic
907766613 1:57418861-57418883 TCCCACATCTCAAAACTAAATGG + Intronic
909991692 1:82231004-82231026 TCCCAGATTTCAAAACTAAAAGG - Intergenic
911103329 1:94110884-94110906 TCCGAGATCTCACCACTCCAGGG + Intronic
912210632 1:107553019-107553041 CCCCAGATCACAACAAGCAAGGG - Intergenic
912775922 1:112506532-112506554 ACCCAGGTCTAAACACACAGGGG + Intronic
921491667 1:215784199-215784221 ACTCAGATCTCAATACTTGAAGG + Intronic
922743352 1:228029287-228029309 ACACAGATCCCACCACTCGATGG + Intronic
924060918 1:240173396-240173418 CCCCACATTTCAACACTTAATGG - Intronic
1065498027 10:26349990-26350012 ACCCACCTCTCAACCCTCATGGG + Intergenic
1068319555 10:55393717-55393739 ACCCAGATCACAACTCTGATTGG + Intronic
1069423483 10:68268803-68268825 AAGAAGATCTCAAGACTCAAAGG + Intergenic
1071158813 10:82722609-82722631 ACCCTGAGCTCAACACACACAGG + Intronic
1072257973 10:93638920-93638942 ACACAGATTTCAACACCGAATGG - Intronic
1075876010 10:125806338-125806360 ATCCTGATCTCACCACCCAAGGG + Intronic
1076206463 10:128608475-128608497 ACCAACAGCTCAACACACAATGG - Intergenic
1078703844 11:13718607-13718629 ACACAGATCTCAACACTGGGAGG - Intronic
1080921348 11:36712521-36712543 ACACTGATCTCAGAACTCAAGGG - Intergenic
1082948677 11:58788052-58788074 ACCCAGATCTCTTCACAGAAAGG - Intergenic
1083620854 11:64048744-64048766 ACCCAGATCCCATAACTCTAAGG + Intronic
1085329511 11:75636257-75636279 GCCCAGCTCTCATCACTCATTGG - Intronic
1085546706 11:77325756-77325778 ACCCAGATCTCATAACTAATAGG + Intronic
1086446142 11:86872973-86872995 ACTCAGTTCTCATCATTCAATGG + Intronic
1089580477 11:119478848-119478870 ACCCAGGTCTCCACACTCTCAGG + Intergenic
1091682577 12:2537671-2537693 ACCCAGTTCTCACTACTAAAAGG - Intronic
1092851643 12:12633830-12633852 TCCCAGATAGCAAAACTCAAAGG - Intronic
1101284696 12:103298688-103298710 ATCCAGATCTCAAGAGCCAAGGG - Intronic
1102663821 12:114552455-114552477 ACACACATCTAAACACACAAGGG - Intergenic
1105526827 13:21185663-21185685 ACTCAGAACTCAACACTCCCTGG + Intergenic
1105623219 13:22088806-22088828 ACCCAGATGTCAGCACTGCAAGG - Intergenic
1108364495 13:49696347-49696369 GCCCAAATCTCAACACCCTATGG - Intergenic
1108584185 13:51853869-51853891 AACCATATCCCAATACTCAAAGG - Intergenic
1109029966 13:57179188-57179210 GCTGAGATCTTAACACTCAATGG - Intergenic
1111779798 13:92707923-92707945 TCCCAGATCTCAAAACTTCATGG + Intronic
1120272330 14:82328956-82328978 ACACAGCTCTGAACACTGAAAGG - Intergenic
1122009229 14:98732080-98732102 ACCCAGATCTGAACAGACAAGGG - Intergenic
1122211850 14:100178614-100178636 TCCCAGACCTCAACACTCCCAGG - Intergenic
1122259303 14:100503172-100503194 ACCCAGAGCTGAACACCCCAAGG + Intronic
1123969581 15:25494516-25494538 AGCCACATCTCAGCACTCCAGGG - Intergenic
1123991887 15:25689522-25689544 ACCCACAGCTCATCTCTCAAAGG + Intronic
1124889740 15:33721593-33721615 TCCCTGAACTCAATACTCAAAGG - Intronic
1130609104 15:85344482-85344504 GGCCAGTTCTCATCACTCAATGG + Intergenic
1132630904 16:916883-916905 ACCCGGAGCTCAACACTCAGAGG - Intronic
1134355027 16:13474283-13474305 TCCCCGATCTCAACACCCAGTGG + Intergenic
1134881922 16:17752482-17752504 ACCCACATCTCCTCACTGAAAGG - Intergenic
1134887945 16:17811016-17811038 ACCCAGATGTCAAATTTCAAAGG + Intergenic
1136052029 16:27658118-27658140 ACCCAGGTCTTACCACTCAGAGG + Intronic
1137771154 16:51016023-51016045 ACCCAGATCTTAACTTTCAGTGG - Intergenic
1142603355 17:1068305-1068327 ACGCCCACCTCAACACTCAAGGG - Intronic
1143276569 17:5715700-5715722 ATACTGATCTCACCACTCAATGG + Intergenic
1153456878 18:5292812-5292834 ATCTAGAACACAACACTCAATGG - Intronic
1157965186 18:52201117-52201139 ACCCAGATCCCTGCACTAAAAGG + Intergenic
1158477529 18:57793467-57793489 ACACAGATCACACCACTCCAAGG + Intronic
1159177654 18:64859015-64859037 ACCCATGACTCCACACTCAAAGG - Intergenic
1161983931 19:7643945-7643967 ACCCAGATCCCACCTCTCCATGG - Intronic
1163362545 19:16856262-16856284 TCCCAGGTCTCAGCACTCACAGG - Intronic
1164462290 19:28459217-28459239 CCCCAGATCCCAACCCTCCATGG - Intergenic
1167235530 19:48312324-48312346 ACCCAGGTCTGGACACTCACAGG + Intronic
1167724034 19:51199105-51199127 ACCCAGATCACAACATTCAGGGG + Intergenic
1168182217 19:54669642-54669664 ACCCAGACCTCCACACTCCATGG + Exonic
925662514 2:6217918-6217940 ACCCAGAACTCAGCAGGCAAAGG - Intergenic
925959960 2:9004446-9004468 GCCCAGCTCTCACCACCCAAAGG - Intergenic
928342584 2:30457799-30457821 ACCCAAATCGCAACAGTAAATGG - Intronic
935395368 2:102602649-102602671 ACCAATAGCTCAACAATCAAAGG + Intergenic
935736875 2:106112977-106112999 TCCCAGATCTCGCCACTGAAAGG + Intronic
936260546 2:110956504-110956526 ACCCAGATCTCAGCTGTCACGGG + Intronic
936831673 2:116654776-116654798 ACTTAGATTGCAACACTCAAGGG + Intergenic
937238809 2:120447155-120447177 ACACAGAACTGAAGACTCAAGGG - Intergenic
938218763 2:129546982-129547004 ACCCCCATCTCTTCACTCAATGG + Intergenic
940174081 2:150859783-150859805 CCCCAAAACTCAAAACTCAACGG + Intergenic
943870675 2:192992938-192992960 ATCAAAATATCAACACTCAATGG - Intergenic
944175243 2:196821513-196821535 ATCCAGATCACAACACAAAATGG + Intergenic
1169105812 20:2993462-2993484 AACCAGATCACAACACAGAAAGG + Intronic
1169246592 20:4030240-4030262 ACAGAGCTCTCAAAACTCAAGGG - Intergenic
1172602948 20:36196165-36196187 ACCCAGATCTCAGGACTCCAAGG - Intronic
1172615413 20:36280239-36280261 ACACAGACCTCACCTCTCAATGG + Intergenic
1174639912 20:52035076-52035098 ACCAAGATCTTAACAGTCAGTGG + Intergenic
1174812279 20:53656712-53656734 ACCCACATCTTAAGACTCATTGG + Intergenic
1175841053 20:62027783-62027805 ACCAAGCCCTCAACACACAACGG + Intronic
1175937301 20:62519679-62519701 CTCCAGACCCCAACACTCAAAGG - Intergenic
1176013593 20:62914991-62915013 AGTCACATCACAACACTCAAAGG + Intronic
1178735392 21:35144586-35144608 CCCCAAATCCCAACACCCAATGG - Intronic
1179433180 21:41339429-41339451 ACCAAGATCTAGACACTCATGGG + Intronic
1180102500 21:45595364-45595386 ACTCAGCTCTCAGCACTCATGGG - Intergenic
1181121163 22:20669349-20669371 ACCTGGATGTCACCACTCAAAGG + Intergenic
1183171073 22:36188653-36188675 GCCCATATATCAACACACAAAGG + Intergenic
1183596668 22:38816829-38816851 TCCCAGCTCTGCACACTCAAGGG - Intergenic
1185062341 22:48613624-48613646 CCCCAGAACCAAACACTCAATGG - Intronic
950850166 3:16054635-16054657 ATCCAGATCTAAACACTTAGAGG + Intergenic
950902754 3:16512735-16512757 ACCCACTTCTCTAGACTCAAGGG - Intronic
955720181 3:61872058-61872080 ACTGAGATTTCAACAGTCAATGG - Intronic
956029386 3:65020838-65020860 TCCCAGATCTCCTCATTCAAGGG - Intergenic
956758066 3:72409838-72409860 ACCCAGAACGAAACATTCAAAGG - Intronic
957080683 3:75633494-75633516 ATCCAGATGTATACACTCAAGGG - Intergenic
958893861 3:99808835-99808857 ACACAGATCCCACCACTCAATGG + Intergenic
960673051 3:120170390-120170412 ACCCAGACCTCACCACTCTGCGG - Intronic
962607805 3:137046894-137046916 ACCCAGAAGTCAGCACTCGAAGG + Intergenic
965444700 3:168760724-168760746 ACACCTATCTCAACAATCAATGG - Intergenic
965663774 3:171069753-171069775 TCCCAGATCTCAAGGCCCAAAGG - Intronic
969399180 4:6942625-6942647 ACCCAGATCTGAAACCTAAAAGG - Intronic
971518269 4:27516119-27516141 ACCCAGATCTCATCCCTGACAGG + Intergenic
976919389 4:90419491-90419513 ACCTAGATCTTAACATTAAATGG + Intronic
978841765 4:113222592-113222614 ACCAAGATCTGAACCCTAAAGGG - Intronic
980100815 4:128539678-128539700 ACTCAGAGCTCACCATTCAATGG - Intergenic
980970455 4:139562416-139562438 ACCAAAATCTGCACACTCAATGG - Intronic
983459971 4:168015645-168015667 AGCCAGAACTCAACACATAATGG + Intergenic
983491959 4:168398986-168399008 GCTAAGAGCTCAACACTCAATGG + Intronic
985915261 5:2913331-2913353 ACACAGAACTCCACACTCACTGG - Intergenic
985917196 5:2931253-2931275 AAGCAGATGTCAACTCTCAACGG - Intergenic
986937611 5:12909667-12909689 ACCCAGATCTAAACACTTTGTGG + Intergenic
988487405 5:31678313-31678335 TCTCAGATCACAACTCTCAAGGG - Intronic
989530123 5:42498317-42498339 AATCAGATCTCCAGACTCAAGGG - Intronic
991009377 5:61867061-61867083 ACCCAGATGTCCTCACTCACAGG - Intergenic
995359630 5:111280631-111280653 ACCTAGATCTCCAAACTGAAAGG + Intronic
995522899 5:113027646-113027668 ACCAGGATGTCAACACTCAACGG + Intronic
997603600 5:135156985-135157007 ACACAGATGTCAACTGTCAAGGG - Intronic
997758292 5:136420976-136420998 ACCCAGATCTCATCAATAAAAGG + Intergenic
1001265545 5:170271769-170271791 GCCCAGACCTCAACACTCAAGGG + Intronic
1005632584 6:27722417-27722439 ACCCAGAGCCCAACAGCCAAAGG - Intergenic
1006034727 6:31202488-31202510 ACCCCGGACTCAAGACTCAAGGG + Exonic
1010185146 6:73135286-73135308 ACTGTGATCTCACCACTCAAAGG - Intronic
1018395386 6:163374272-163374294 AAACAGCTCTCAAGACTCAAAGG - Intergenic
1019387458 7:765662-765684 ACCCAGCTCTTGACACTGAACGG - Intronic
1022335582 7:29418616-29418638 GCCCAGAACACAATACTCAACGG - Intronic
1023664796 7:42511944-42511966 GTGCAGATCTGAACACTCAATGG - Intergenic
1024498457 7:50072885-50072907 ACTTAGATCACAACACCCAAGGG + Intronic
1026738978 7:72966671-72966693 ACCCAGAACTCTACACTTATAGG + Intronic
1026789994 7:73325304-73325326 ACCCAGAACTCTACACTTATAGG + Intronic
1027104755 7:75398402-75398424 ACCCAGAACTCTACACTTATAGG - Intronic
1028358067 7:89933698-89933720 ACTCACACCTCAACTCTCAATGG - Intergenic
1028564005 7:92207489-92207511 ACCCCACTCTCAACACTGAATGG + Intronic
1030890845 7:114997098-114997120 AGCCCGATCACAACACTAAAAGG - Intronic
1032241509 7:130162803-130162825 GCACAGATCTAATCACTCAAGGG + Intergenic
1032491885 7:132330001-132330023 AGCCAGCTCTCAACACACAACGG - Intronic
1032492190 7:132331912-132331934 ACCCAGATCTCAACACTCAAGGG - Intronic
1036804637 8:11821754-11821776 AGCCAGATTTCTAAACTCAAGGG - Exonic
1037790835 8:21940395-21940417 ACCCACATCTCTCCACTCAGTGG - Intronic
1040647320 8:49414415-49414437 ACCCAGTCCTCAAAACTTAAAGG + Intergenic
1041326634 8:56673542-56673564 ACCTAGATCTGAACCCTAAAGGG + Intergenic
1046224127 8:111254936-111254958 ACCCAGAGGTCAACAGTCTATGG + Intergenic
1046616963 8:116488429-116488451 TCCCAGATCTCAACCTTCCATGG - Intergenic
1047474109 8:125209308-125209330 ACCCAGTTGACATCACTCAATGG - Intronic
1049296953 8:141846065-141846087 ACACAGACCTCAAAACTGAAAGG + Intergenic
1051903762 9:22071242-22071264 ACCCAGATCTAATGACTCAGAGG + Intergenic
1052733903 9:32320628-32320650 TCCCAGTTATCAACACTGAAGGG + Intergenic
1056873213 9:90304312-90304334 ACACAGACCTCATCTCTCAATGG - Intergenic
1057917879 9:99071655-99071677 CCCCAGCCCTCATCACTCAACGG - Intergenic
1058210169 9:102158450-102158472 ACAAAGATCTCACCACTCAAAGG + Intergenic
1060204105 9:121672321-121672343 GCCCAGATCTTAATACTTAAAGG - Intronic
1060407587 9:123380540-123380562 ACCCAGATTTCAACCCAAAAAGG - Exonic
1060579415 9:124730928-124730950 ACCCAGTTCTCTAGACTCTAGGG - Intronic
1186940703 X:14504331-14504353 ACTCAGATCTCAGTGCTCAAGGG - Intergenic
1194701257 X:97117735-97117757 ACCAAAATGTCAACACTAAAGGG + Intronic
1198047044 X:132913480-132913502 ATCCAGATGTCAGCACACAAGGG + Intronic
1202380244 Y:24270639-24270661 GGCCAGTTCTCATCACTCAATGG + Intergenic
1202490539 Y:25399486-25399508 GGCCAGTTCTCATCACTCAATGG - Intergenic