ID: 1032492191

View in Genome Browser
Species Human (GRCh38)
Location 7:132331913-132331935
Sequence GACCCAGATCTCAACACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032492191_1032492192 -2 Left 1032492191 7:132331913-132331935 CCTTGAGTGTTGAGATCTGGGTC 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1032492192 7:132331934-132331956 TCCTAGACCCTGCTCAGATAAGG 0: 1
1: 0
2: 0
3: 22
4: 112
1032492191_1032492195 5 Left 1032492191 7:132331913-132331935 CCTTGAGTGTTGAGATCTGGGTC 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1032492195 7:132331941-132331963 CCCTGCTCAGATAAGGCATCTGG 0: 1
1: 0
2: 2
3: 13
4: 140
1032492191_1032492197 15 Left 1032492191 7:132331913-132331935 CCTTGAGTGTTGAGATCTGGGTC 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG 0: 1
1: 0
2: 0
3: 7
4: 115
1032492191_1032492198 21 Left 1032492191 7:132331913-132331935 CCTTGAGTGTTGAGATCTGGGTC 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1032492198 7:132331957-132331979 CATCTGGACAACCTTGGACAAGG 0: 1
1: 0
2: 7
3: 30
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032492191 Original CRISPR GACCCAGATCTCAACACTCA AGG (reversed) Intronic
903246468 1:22019456-22019478 GACCCAGTTCTCTCCACACATGG + Intergenic
905891441 1:41520979-41521001 GACCCAGGTCTCAAGACTCGGGG + Intronic
912210634 1:107553020-107553042 GCCCCAGATCACAACAAGCAAGG - Intergenic
912775921 1:112506531-112506553 CACCCAGGTCTAAACACACAGGG + Intronic
915128788 1:153683114-153683136 GAACCCGATCTCTACACTCAGGG - Intronic
916585572 1:166147017-166147039 GACCCAGAACTCAAAGCTCTGGG - Intronic
917608116 1:176656998-176657020 GACCCTGTGCTGAACACTCAAGG + Intronic
920948879 1:210554451-210554473 AACCCAAATCTCAACCTTCAAGG - Intronic
1065498026 10:26349989-26350011 TACCCACCTCTCAACCCTCATGG + Intergenic
1066103094 10:32135190-32135212 GCATCAGATCTCATCACTCAGGG - Intergenic
1074766222 10:116702006-116702028 GAAACAGATCTCAGCACTCTGGG + Intronic
1075320502 10:121487900-121487922 CACCCAGCTCTCAACATTGACGG + Intronic
1076700080 10:132266983-132267005 GGCCGAGCTCCCAACACTCACGG - Intronic
1078595751 11:12685063-12685085 GGCCCAGATCTAAAAACACAGGG - Intronic
1082068022 11:47916553-47916575 GATCCATATCTCTGCACTCAAGG - Intergenic
1086055364 11:82640210-82640232 GACCCAGAGCTCAGGACTCCTGG - Intergenic
1091861197 12:3785770-3785792 GACCCAGATTTCAACTCTTCTGG + Intergenic
1096605940 12:52766546-52766568 GACCCAGCTATCAACACACATGG + Intergenic
1101284697 12:103298689-103298711 GATCCAGATCTCAAGAGCCAAGG - Intronic
1106465555 13:30011296-30011318 GACCCAAAAATCAACAGTCAAGG - Intergenic
1110946881 13:81432861-81432883 GAAGCTGATCCCAACACTCATGG + Intergenic
1113040203 13:106096558-106096580 GACACAGATCTCTGCTCTCAAGG - Intergenic
1116173664 14:41436221-41436243 AACCTAGATATCATCACTCATGG - Intergenic
1118821842 14:69350881-69350903 GACCCAGGTTTCAAGGCTCAGGG - Intronic
1119559966 14:75582127-75582149 GCATCAGATCTCATCACTCAGGG - Intronic
1119752752 14:77091908-77091930 TACCCAGAACTCAGCACACAAGG - Intergenic
1120199487 14:81520922-81520944 AGCCCAGAGTTCAACACTCAAGG - Intronic
1121728098 14:96167460-96167482 GACCAAGATCTCAGAAGTCAGGG - Intergenic
1122009230 14:98732081-98732103 AACCCAGATCTGAACAGACAAGG - Intergenic
1124396323 15:29305066-29305088 GACCAAGATCTCAGCCCTCATGG - Intronic
1128446295 15:67764281-67764303 GACCCAGACTACAACATTCAAGG + Intronic
1132630914 16:916945-916967 GACCCGGAGCTCAATATTCAGGG - Intronic
1140131901 16:72170087-72170109 GACAAAGATCTCTACTCTCATGG - Intronic
1140429255 16:74887694-74887716 GACCCAGGGCTCAACACTGGCGG - Exonic
1149317115 17:55448936-55448958 GGCCCAGATCTGAACACTTGGGG - Intergenic
1151615251 17:75205824-75205846 GACGCAGTTCTCAACCCGCAAGG - Intronic
1153620979 18:6977593-6977615 GACCCAGATCCCAATAATCTGGG - Intronic
1156571984 18:38266358-38266380 GAAATAGATATCAACACTCATGG - Intergenic
1162191461 19:8950289-8950311 CTCACAGATCTCCACACTCAGGG - Exonic
1163837038 19:19581384-19581406 GTCCCAGATCCAAACTCTCAGGG + Intronic
1165259981 19:34605279-34605301 GACAGAGTTCTCAAAACTCATGG - Intronic
1165272287 19:34721099-34721121 GACAGAGTTCTCAAAACTCACGG + Intergenic
1165494391 19:36143063-36143085 GACCCTGATCTGAAGACTGATGG + Exonic
1166423868 19:42658691-42658713 GATCCAGAGTTAAACACTCAGGG + Intronic
1167724033 19:51199104-51199126 AACCCAGATCACAACATTCAGGG + Intergenic
1168086754 19:54053361-54053383 GTCACAGATCTCCACACTCAAGG - Intronic
925433528 2:3817188-3817210 GCACCAGATCCCATCACTCAGGG - Intronic
925927010 2:8678029-8678051 GAACCAGATGCCAACACTCCCGG - Intergenic
927268344 2:21178724-21178746 GAGTCAGCTCTCAACTCTCATGG + Intergenic
933697521 2:85230967-85230989 GACCAAGATTTCAAGACACAGGG - Intronic
936260545 2:110956503-110956525 AACCCAGATCTCAGCTGTCACGG + Intronic
936626140 2:114151413-114151435 AACCCACATCTCAGTACTCATGG + Intergenic
943810126 2:192175095-192175117 GACACAGTTCTTTACACTCATGG - Intronic
945555008 2:211265782-211265804 GAATCAGATCTCATCACTCAGGG + Intergenic
945585097 2:211651591-211651613 GACCCAGATATGAAGGCTCATGG - Intronic
946047351 2:216832465-216832487 AACCAAGATCACACCACTCATGG - Intergenic
947618501 2:231574013-231574035 GTCCCAGCTCTCAGCTCTCAGGG - Intergenic
1168990538 20:2091729-2091751 GAGCCAGTTATCAACACTCACGG - Intergenic
1175676102 20:60948119-60948141 GCCCCAGAAGTCAGCACTCAGGG + Intergenic
1179433179 21:41339428-41339450 AACCAAGATCTAGACACTCATGG + Intronic
1180088971 21:45524209-45524231 GGCCCAGGTGTGAACACTCAGGG - Intronic
1180088981 21:45524247-45524269 GGCCCAGGTGTGAACACTCAGGG - Intronic
1180089051 21:45524512-45524534 GGCCCAGGTGTGAACACTCAGGG - Intronic
1180089061 21:45524550-45524572 GGCCCAGGTGTGAACACTCAGGG - Intronic
1180089131 21:45524815-45524837 GGCCCAGGTGTGAACACTCAGGG - Intronic
1180089152 21:45524891-45524913 GACCCAGGTGTGAACACTCAGGG - Intronic
1180102501 21:45595365-45595387 GACTCAGCTCTCAGCACTCATGG - Intergenic
1180165005 21:46020817-46020839 GACTCAGATCTCAGCCGTCAGGG + Intergenic
1181780268 22:25187324-25187346 TGCCCAGATATCAACAGTCATGG - Intronic
1182788620 22:32929776-32929798 GAGACAGAAATCAACACTCAGGG - Intronic
1184709301 22:46239057-46239079 AACCCAGAACTCAGCATTCAAGG + Exonic
1184979416 22:48085392-48085414 AACCCAGATCTAAGCCCTCATGG - Intergenic
950093984 3:10317531-10317553 GAACCAGAAGTCCACACTCAGGG - Intronic
951995439 3:28722691-28722713 GATACAGATCCCATCACTCAGGG - Intergenic
954412675 3:50377854-50377876 GTCCCTGCTCTGAACACTCAGGG - Intronic
955509162 3:59662179-59662201 GACTCAGACCTCTACACTTATGG - Intergenic
957928504 3:86846409-86846431 GAACAAGATCTCAACCCTGATGG - Intergenic
960362290 3:116728220-116728242 GGGCTAGATCTCAACACTGAAGG - Intronic
968153740 3:196360762-196360784 GAGCCAAATCTCAACACTTTGGG + Intronic
968486099 4:863135-863157 GAAGCTGATCTCAACCCTCAAGG + Intronic
969930336 4:10624885-10624907 GCCCCACATCTCTAAACTCATGG + Intronic
970534931 4:17021101-17021123 CACCCAGTTCTCCACCCTCACGG + Intergenic
976463629 4:85342632-85342654 AGCCCAGATCACCACACTCAAGG + Intergenic
977152389 4:93529200-93529222 AACCCAGATATCAAGATTCACGG + Intronic
978841766 4:113222593-113222615 GACCAAGATCTGAACCCTAAAGG - Intronic
984402765 4:179287966-179287988 TCCCCACATCCCAACACTCATGG - Intergenic
986766119 5:10929213-10929235 AACATAGAACTCAACACTCAGGG - Intergenic
987609457 5:20182891-20182913 GCCCAAGATCTCTATACTCAAGG + Intronic
992199368 5:74368674-74368696 GACCCAGATATAAAATCTCAGGG + Intergenic
994116108 5:96062832-96062854 GACCCAGACCTCATCACTGCGGG - Intergenic
995174199 5:109155578-109155600 GATAGTGATCTCAACACTCATGG + Intronic
995974849 5:118021834-118021856 GACCAAGATGTCAGCACTCCAGG + Intergenic
996872057 5:128202796-128202818 GAACCAGAACTCAGAACTCAGGG - Intergenic
997603601 5:135156986-135157008 GACACAGATGTCAACTGTCAAGG - Intronic
997984649 5:138492518-138492540 GACCCACTTGTCAACTCTCAGGG - Intergenic
1001265544 5:170271768-170271790 AGCCCAGACCTCAACACTCAAGG + Intronic
1001856550 5:175015768-175015790 AACCAAGATCTCAACATTTATGG + Intergenic
1003332494 6:5141664-5141686 GACCAGCATCTCAACACTCACGG + Intronic
1004259616 6:14096645-14096667 GTCCCAGACCTCCAGACTCAGGG - Intergenic
1005118294 6:22362772-22362794 GACCCAGATCTCAGACCTCCGGG + Intergenic
1007642935 6:43357356-43357378 GATCCAGTTCTCGAAACTCAGGG + Exonic
1008112423 6:47507279-47507301 GAAACAGATCACAACACTAAAGG - Intronic
1011448974 6:87473011-87473033 GACCCAGTTCTCACCTCTCGGGG - Exonic
1014648523 6:124006244-124006266 GAGCAAGGTTTCAACACTCATGG + Intronic
1019655562 7:2193078-2193100 GACCCGGAGCTCAGCACTCGTGG + Intronic
1020016185 7:4833508-4833530 CACCCAGATTACAACACCCACGG + Intronic
1023874393 7:44278815-44278837 GACCCAGATTTCAACTCCAAGGG + Intronic
1032241508 7:130162802-130162824 GGCACAGATCTAATCACTCAAGG + Intergenic
1032492191 7:132331913-132331935 GACCCAGATCTCAACACTCAAGG - Intronic
1032753210 7:134863451-134863473 AACCCAGCACTCAACACTTAGGG - Intronic
1033358524 7:140620939-140620961 CACTCAGATATCAACATTCATGG + Intronic
1033460455 7:141542688-141542710 GACCCAGAACTCAATCCTCCAGG + Intergenic
1033576133 7:142686645-142686667 GGCCAAGAACTCAACATTCAAGG - Intergenic
1035775343 8:2183401-2183423 GACCCAGGTCTCCAAACTCTAGG + Intergenic
1041883218 8:62777866-62777888 AACTTAGATCTCAACAATCAAGG - Intronic
1043597149 8:81899935-81899957 GCATCAGATCTCATCACTCAGGG - Intergenic
1044188719 8:89287470-89287492 GACCTAGATCTGAATACACATGG - Intergenic
1046376212 8:113384597-113384619 GACCCAGTTCTCAAAAAACAGGG + Intronic
1053410517 9:37913562-37913584 GAGCCAGGCCTCAACACGCAGGG - Intronic
1055160176 9:73117166-73117188 GAAACAAATCTCAACACTCAGGG + Intergenic
1055940933 9:81648848-81648870 GATCCTGATCTAAAAACTCAAGG + Intronic
1056111646 9:83402296-83402318 TACCCTGAACTCAACAGTCAAGG + Intronic
1056300290 9:85233291-85233313 GAGACTGATCTCAACAGTCAAGG + Intergenic
1059176396 9:112173511-112173533 GACACAGATCTCTACTCTGAAGG + Intronic
1059413544 9:114149297-114149319 GGCCCAGAACTCATCACTAATGG + Intergenic
1060414729 9:123422114-123422136 GAGCCAGATGTGAACCCTCAAGG - Intronic
1060980832 9:127790747-127790769 GACCCAGACCACAACACAAAAGG + Exonic
1187037550 X:15557729-15557751 GCCCCAGATCCCCAAACTCAAGG - Intergenic
1197670553 X:129272857-129272879 GACTCAGGTCTCTACATTCAGGG + Intergenic
1201942768 Y:19477575-19477597 GTCCCAGTTCTCAACACTGTTGG - Intergenic
1202062723 Y:20904461-20904483 GCCCCAGATCCCATCTCTCAGGG - Intergenic