ID: 1032492193

View in Genome Browser
Species Human (GRCh38)
Location 7:132331935-132331957
Sequence GCCTTATCTGAGCAGGGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032492193_1032492197 -7 Left 1032492193 7:132331935-132331957 CCTAGACCCTGCTCAGATAAGGC 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG 0: 1
1: 0
2: 0
3: 7
4: 115
1032492193_1032492200 15 Left 1032492193 7:132331935-132331957 CCTAGACCCTGCTCAGATAAGGC 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1032492200 7:132331973-132331995 GACAAGGCACTGAACTTTCATGG 0: 1
1: 0
2: 0
3: 14
4: 192
1032492193_1032492198 -1 Left 1032492193 7:132331935-132331957 CCTAGACCCTGCTCAGATAAGGC 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1032492198 7:132331957-132331979 CATCTGGACAACCTTGGACAAGG 0: 1
1: 0
2: 7
3: 30
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032492193 Original CRISPR GCCTTATCTGAGCAGGGTCT AGG (reversed) Intronic
900735788 1:4298662-4298684 GCATTATCTGTGCAGGACCTGGG + Intergenic
904788721 1:33001695-33001717 GCCTTATCTTTGCTGGGCCTGGG - Intergenic
907555169 1:55337106-55337128 CCCTGAACTGAGCAGGGGCTAGG - Intergenic
909660370 1:78075605-78075627 GCCTTATCTGTGTGTGGTCTAGG - Intronic
911168522 1:94746219-94746241 ACCTGATGTGAGCAGAGTCTAGG - Intergenic
915259073 1:154662865-154662887 GCATTCACTGAGCAGGGACTTGG - Intergenic
916055738 1:161068062-161068084 GGGTTATAGGAGCAGGGTCTGGG + Intronic
916993822 1:170274210-170274232 GCCTTTCGTGAGAAGGGTCTTGG - Intergenic
917724823 1:177818382-177818404 CCCTTATCTGGGCAGTGTTTAGG - Intergenic
919831936 1:201547437-201547459 GCCTTAACTGAGCAGGCTGTGGG - Intergenic
920814040 1:209314348-209314370 GCCTTTTCTGAGCTGAGGCTGGG + Intergenic
922455131 1:225768272-225768294 GACTTGTCTGAGCAGGGAGTGGG + Intergenic
922856693 1:228781004-228781026 TCCTTAACTGAGGAAGGTCTTGG + Intergenic
924497575 1:244604992-244605014 GCATTCTCTGAGCATGGGCTAGG + Intronic
1068877066 10:62008381-62008403 GCTCTTTCTGAGCAGGGTCTGGG - Intronic
1070832973 10:79431584-79431606 GCCGTTTCTGAGCAGGGTTTGGG + Intronic
1072362699 10:94675262-94675284 GAATTATCTCAGCAGGCTCTGGG - Intergenic
1074104776 10:110381182-110381204 GCCAGATGTGGGCAGGGTCTGGG + Intergenic
1074375593 10:112938635-112938657 CCCTTTTGTAAGCAGGGTCTAGG + Intergenic
1075680591 10:124328505-124328527 GCCTCATCTGAACAGAGACTGGG - Intergenic
1076907636 10:133371393-133371415 GCCTTGTCTCAGCAGAGTCCAGG - Intronic
1078895141 11:15591291-15591313 CCCTTATCAGAGCAAGGGCTGGG - Intergenic
1079016230 11:16871056-16871078 TCCTTATCTGGGCAGAGTATGGG - Intronic
1079031050 11:16986888-16986910 ACCTTCTCTGGGCAGGGGCTCGG - Intronic
1081430666 11:42973314-42973336 GCCTTATATGAGCAGGCACTTGG - Intergenic
1084587197 11:70069108-70069130 GCCATCTCTGAGCATGGGCTGGG + Intergenic
1088964288 11:114702401-114702423 GCCTTACCTGAGAAAGGTATGGG + Intronic
1090650608 11:128802744-128802766 GCCTTATCAGAGCAGTGGCTTGG - Intronic
1091382951 12:74624-74646 CCCTTCTCTGGGCAGGGACTTGG - Intronic
1091885681 12:4015492-4015514 GCCTTGTCTGTACAAGGTCTTGG - Intergenic
1093371947 12:18376218-18376240 GGCATAGCTGAGCAAGGTCTTGG + Intronic
1095491844 12:42743253-42743275 GCATTTTCTGAGCAGGGATTGGG + Intergenic
1096500719 12:52062577-52062599 GCCTTGTGTGAGCTGGGCCTGGG + Intergenic
1096685019 12:53282545-53282567 GCCTACTCTGTGCAGGTTCTAGG - Intronic
1099595800 12:84664149-84664171 GCTTTTTCTGAGCATGGTTTTGG - Intergenic
1100354666 12:93818034-93818056 GCCTGATCTGCTCTGGGTCTGGG - Intronic
1102555585 12:113724557-113724579 GCTCTATTTGGGCAGGGTCTAGG - Intergenic
1103614816 12:122145427-122145449 ACTTTATCTGGGCAGGGACTGGG - Exonic
1104780610 12:131417627-131417649 GCCCCATCTGTGCAGGGTGTAGG + Intergenic
1109131929 13:58597865-58597887 GGCTTAATTAAGCAGGGTCTGGG - Intergenic
1110428527 13:75397044-75397066 GCCCTAGCTGAGGAGGATCTAGG + Intronic
1111278711 13:85989559-85989581 GCTGTAGCTGAGCAGGGCCTGGG - Intergenic
1113128545 13:107008359-107008381 GCTTTATCTGAGAAGTGTCATGG + Intergenic
1121002933 14:90465060-90465082 GTCATACCTGAGCAGGGTGTGGG + Intergenic
1121145721 14:91580337-91580359 GCGGTGTCTGAGCAGGGTATTGG - Intergenic
1124512140 15:30336508-30336530 TCCTGACCTGAGCAGGCTCTGGG - Intergenic
1124730774 15:32194243-32194265 TCCTGACCTGAGCAGGCTCTGGG + Intergenic
1126722835 15:51600327-51600349 GGCATATCTGTGCAGGGTTTGGG - Intronic
1127097969 15:55532987-55533009 GCCTTGGCTGAGCTGGGTTTGGG + Intergenic
1130678391 15:85974341-85974363 GCCTTTGCTGAGCAGGGGCAGGG + Intergenic
1130766339 15:86875212-86875234 GCCTGCCCTGAGCAGGGTGTGGG - Intronic
1132538718 16:497194-497216 GGCTTCTCAGAGCCGGGTCTGGG + Intronic
1132608328 16:802719-802741 TGCCTACCTGAGCAGGGTCTGGG + Intergenic
1138596079 16:58029667-58029689 TCCTTGTCTGAGCAGTGTATTGG + Intronic
1141922166 16:87143612-87143634 GCCCTAGCTGAGCAGGGCCCAGG + Intronic
1142348766 16:89570446-89570468 GCCCAAGCTGAGCAGGGCCTCGG - Intergenic
1144799426 17:17914770-17914792 GCTTTCTCAGAGCAGGGGCTTGG + Intronic
1147318665 17:39633131-39633153 GCCCTATCTGAGCAGGTCTTTGG + Intronic
1147457567 17:40547730-40547752 GCCTTGTCTGGGCAGAGTCTGGG - Intergenic
1148739031 17:49881350-49881372 GCATTCTCCCAGCAGGGTCTGGG + Intergenic
1151485186 17:74394578-74394600 ACCCTCTCTAAGCAGGGTCTGGG - Intergenic
1151603094 17:75118677-75118699 GCCTTTTCTGCCCAGGGTCCAGG + Intronic
1153230837 18:2933912-2933934 GCCTTTTCTGAACCGGGTCTGGG - Intronic
1155229045 18:23756278-23756300 GCCTTGTCTAAGAAGGCTCTTGG - Intronic
1159576376 18:70183333-70183355 ACCTAATCTCAGCATGGTCTGGG - Intronic
1160701339 19:508826-508848 CCCTTATCTGAGTATGATCTTGG - Intronic
1162033663 19:7927842-7927864 GCCTTCTCCTAGCAGGGCCTAGG - Intronic
1165117838 19:33539609-33539631 GAGTTCTCTAAGCAGGGTCTGGG - Intergenic
1166083177 19:40457957-40457979 GCCTTGTGTGAGCAGGGCCCAGG + Intronic
1166752865 19:45172994-45173016 CCCTTATCTGAGGAGGGTGTGGG - Intronic
1167597149 19:50433743-50433765 GCATCCTCTGGGCAGGGTCTGGG + Intronic
926808718 2:16737469-16737491 GTCTTATCTCAGTAGCGTCTTGG - Intergenic
928244565 2:29616056-29616078 GCCTCACCAGAGCAGGGTCTGGG - Intronic
928306197 2:30172221-30172243 GCCTGCTCTGAGCTGGTTCTTGG - Intergenic
932822359 2:74912248-74912270 GCTATCTCTCAGCAGGGTCTGGG - Intergenic
933812719 2:86043070-86043092 GCCTCTTCTCAGCAGGGTGTTGG + Exonic
937454796 2:122031971-122031993 GCTGTATCTGAGCAGTATCTAGG - Intergenic
939844864 2:147230619-147230641 GCAAGATTTGAGCAGGGTCTGGG + Intergenic
940342994 2:152600814-152600836 ACGTTATCTGTGCAGGGTATGGG + Intronic
941625001 2:167821755-167821777 GCTCTATCTGAGCAGTGTCAAGG - Intergenic
941849823 2:170168488-170168510 GCATTATCTGGGTAGGCTCTAGG + Intergenic
944272000 2:197794679-197794701 CCTTTATCGTAGCAGGGTCTGGG + Intergenic
946403698 2:219482082-219482104 GCTTCATGTGAGCAGGTTCTCGG + Intronic
946500161 2:220238679-220238701 TCCTTAAATGAGCAGGGCCTTGG + Intergenic
948771947 2:240255819-240255841 GGCTTAGCTGAGCTGGGACTGGG + Intergenic
1170471987 20:16676916-16676938 TCCTTGTCTAAGCAGTGTCTTGG + Intergenic
1171782903 20:29437371-29437393 TCCTTATGTGAGCAGGCCCTAGG + Intergenic
1176255067 20:64147384-64147406 ACTTTCTCTGAGCAGGCTCTGGG + Intergenic
1176282229 20:64320135-64320157 CCCTTCTCTGGGCAGGGACTTGG + Intergenic
1176337270 21:5610733-5610755 TCCTTATGTGAGCAGGCCCTAGG - Intergenic
1176470932 21:7105959-7105981 TCCTTATGTGAGCAGGCCCTAGG - Intergenic
1176494493 21:7487737-7487759 TCCTTATGTGAGCAGGCCCTAGG - Intergenic
1176506149 21:7650646-7650668 TCCTTATGTGAGCAGGCCCTAGG + Intergenic
1181309664 22:21937765-21937787 GCCTTTCCTGAGCAGAGTCTAGG - Intronic
1181543441 22:23587141-23587163 GCCTTTTCTGTGCAGTATCTGGG + Intergenic
1181823956 22:25498360-25498382 GACATTTCTGAGCAGGGGCTGGG + Intergenic
1182291105 22:29280530-29280552 GGTTCATCTGAGCAGGGACTTGG + Intronic
1182641168 22:31768884-31768906 GCCTTATCTGTGCAGTAACTGGG + Intronic
1184246016 22:43236128-43236150 CCCTGATCTTGGCAGGGTCTGGG - Intronic
1185006658 22:48281179-48281201 GCCATATCTGAGTTGGGTTTTGG - Intergenic
1185155256 22:49189768-49189790 GCCCCATCTCAGCAGGGGCTGGG + Intergenic
950764802 3:15265847-15265869 GGCTGATATGAGCAGGGTCCGGG - Intronic
952849981 3:37719832-37719854 CCCTTATCTGAGCAGACTTTGGG - Intronic
955377852 3:58412889-58412911 GTTTTATCTTAGCAGGATCTGGG + Exonic
955994844 3:64669113-64669135 GCCTTTTCTGAGCTGGGCCAGGG - Intronic
956786903 3:72650477-72650499 CCCTTCTCTGGGAAGGGTCTGGG - Intergenic
957082582 3:75649221-75649243 TCCTTATGTGAGCAGGCCCTAGG - Intergenic
963044523 3:141092967-141092989 GCCTCCTCTGAGCAAGGCCTGGG - Intronic
971301099 4:25442989-25443011 GCCTTACCTGAGAAGGGGTTAGG + Intergenic
971834121 4:31739724-31739746 GACTTTTCTGAGCAAAGTCTTGG + Intergenic
973955637 4:56060435-56060457 GTGATATCTGAGCTGGGTCTTGG + Intergenic
974842368 4:67312527-67312549 GCCATATATGAGCAGGTTTTGGG - Intergenic
977286803 4:95117865-95117887 GCATTATCTGAGGAGGATGTAGG + Intronic
982283944 4:153715256-153715278 GCAGTATCTGAGCAGGGTGCTGG - Intronic
982526546 4:156485820-156485842 GCCTTATCTGTGCTGCATCTGGG + Intergenic
984073600 4:175147498-175147520 GCCCTCTCTGTGCAGGGCCTAGG - Intergenic
998819694 5:146047527-146047549 ACCCTATCTGAGCAGGCTTTTGG + Intronic
999722296 5:154407749-154407771 GCCTTTTCTGTGCAGGGGCCTGG + Intronic
1000157328 5:158564451-158564473 GCCTTGGCCGAGCAGGGCCTTGG + Intergenic
1000493851 5:161952161-161952183 GCCTGAACTAAGCAGGGTTTGGG - Intergenic
1002340200 5:178511445-178511467 GTCTTATCTTAGCAGGGATTGGG - Intronic
1002901147 6:1410586-1410608 GCCCTATCTGAGAAGGGTGAGGG - Intergenic
1004478022 6:15992176-15992198 TCCTTATCTGAACAGGGGCGAGG + Intergenic
1008685304 6:53919782-53919804 GCCTCACCTGAGCTGGCTCTAGG - Intronic
1021905247 7:25326945-25326967 GCCTTGTGTCAGCAGGGTTTGGG - Intergenic
1023859138 7:44206681-44206703 CCCTCATGTGAGCTGGGTCTAGG + Intronic
1025202893 7:56972995-56973017 GCCTGAGATGAGCAGGCTCTGGG + Intergenic
1025669051 7:63603931-63603953 GCCTGAGATGAGCAGGCTCTGGG - Intergenic
1027257072 7:76437797-76437819 GCCTTTTAGAAGCAGGGTCTAGG - Intronic
1027281778 7:76614245-76614267 GCCTTTTAGAAGCAGGGTCTAGG + Intronic
1028165345 7:87532280-87532302 GCCTTTTCTGAAAAGGGGCTGGG + Intronic
1028323992 7:89499140-89499162 GCATTGTCTGAGCAGGGACATGG + Intergenic
1029130844 7:98329638-98329660 GCCTTATCTGACCAGGGAAAGGG + Intronic
1030119820 7:106098381-106098403 CCCTTATGTGAGAAGTGTCTAGG + Intronic
1032492193 7:132331935-132331957 GCCTTATCTGAGCAGGGTCTAGG - Intronic
1033194834 7:139318976-139318998 GCCTTTTCTCAGCAAGGTCAGGG + Intergenic
1034366300 7:150551501-150551523 GCAATGTCAGAGCAGGGTCTAGG - Intergenic
1034411657 7:150945383-150945405 GCCGTGTCTGTGCAGGGGCTGGG + Exonic
1035617036 8:1009764-1009786 GGATTATGTGAGCAAGGTCTAGG - Intergenic
1036976240 8:13416047-13416069 CCCTCAGCTGAGCAGTGTCTAGG - Intronic
1038602937 8:28966186-28966208 GCCTTATCCAAGAAGGGTTTAGG + Intronic
1039957888 8:42221322-42221344 GCTTTCTCTGAGCAGGGGGTTGG + Intergenic
1042577740 8:70239521-70239543 GCCTTATATCAGCAGGTTGTGGG - Intronic
1047086542 8:121523239-121523261 TCCTAATCTGAGCTGGGTTTGGG + Intergenic
1048876436 8:138840043-138840065 GGCATATCTGGGCTGGGTCTGGG - Intronic
1048906822 8:139096652-139096674 CCCTTTTCTCACCAGGGTCTTGG + Intergenic
1049393290 8:142382959-142382981 GCCCCAGCCGAGCAGGGTCTGGG + Intronic
1049436436 8:142588270-142588292 ACCTGACCTGAGCAGGGCCTGGG - Intergenic
1053274785 9:36775149-36775171 GCGTTGTCTGACCTGGGTCTGGG - Intergenic
1053392354 9:37744966-37744988 GCCTTGCCTGAGCAGTATCTGGG - Exonic
1060554526 9:124501494-124501516 GCCCTGTCTGAGCAGGGGCGGGG - Intronic
1061169801 9:128946015-128946037 CCCTTCTGTGTGCAGGGTCTGGG + Exonic
1062235286 9:135505071-135505093 GCCGTCTCTGGGCAGAGTCTGGG + Intergenic
1203424391 Un_GL000195v1:24173-24195 TCCTTATGTGAGCAGGCCCTAGG + Intergenic
1203442920 Un_GL000219v1:28206-28228 TCCTTATGTGAGCAGGCCCTAGG + Intergenic
1203513728 Un_KI270741v1:147115-147137 TCCTTATGTGAGCAGGCCCTAGG + Intergenic
1189301874 X:39958117-39958139 GCCTTGTCAGAGTAGGGACTTGG + Intergenic
1194553444 X:95330001-95330023 GCCAGAACTGTGCAGGGTCTTGG + Intergenic
1194992780 X:100562983-100563005 GCCATATATGAGCAGGTTCCAGG - Intergenic
1198480693 X:137037087-137037109 ATTTTATCTGAGCTGGGTCTGGG - Intergenic
1199659068 X:150029137-150029159 GCCTTATCTGAGCTGGGGAAGGG - Intergenic
1200868720 Y:8074435-8074457 GCCTTCTCTAGGCAGGGTATAGG + Intergenic
1200897278 Y:8389184-8389206 GCCTTTTCTAGGCAGGGCCTGGG + Intergenic