ID: 1032492197

View in Genome Browser
Species Human (GRCh38)
Location 7:132331951-132331973
Sequence ATAAGGCATCTGGACAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032492193_1032492197 -7 Left 1032492193 7:132331935-132331957 CCTAGACCCTGCTCAGATAAGGC 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG 0: 1
1: 0
2: 0
3: 7
4: 115
1032492190_1032492197 16 Left 1032492190 7:132331912-132331934 CCCTTGAGTGTTGAGATCTGGGT 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG 0: 1
1: 0
2: 0
3: 7
4: 115
1032492191_1032492197 15 Left 1032492191 7:132331913-132331935 CCTTGAGTGTTGAGATCTGGGTC 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032492197 Original CRISPR ATAAGGCATCTGGACAACCT TGG Intronic
900202865 1:1419175-1419197 CTCAGGCATCTGGGCCACCTCGG + Exonic
902788354 1:18747463-18747485 TTAACGCATCTGGCCAACTTGGG + Intronic
903426999 1:23261170-23261192 ATAAGGGGTCTGTACAGCCTGGG + Intergenic
905470058 1:38185102-38185124 AGAAGGCATCTGGGGAAACTGGG + Intergenic
907424301 1:54369416-54369438 AAAAGGCATCTTGAAAACCAAGG + Intronic
908379695 1:63584793-63584815 ATAAGGCTTCTGGTCAACATAGG + Intronic
918117324 1:181508531-181508553 ATAAGCCTTCTGAACAGCCTAGG - Intronic
919010464 1:191954749-191954771 ATAAGGCCTCTGGTCAACTCAGG + Intergenic
1063738253 10:8787120-8787142 ATCAGGTATCTGGGCATCCTTGG + Intergenic
1066619470 10:37329788-37329810 ATAAGACATCATGACAACGTAGG + Intronic
1073006848 10:100330915-100330937 ACAAGGAATATAGACAACCTAGG - Intergenic
1074199869 10:111225197-111225219 AGAAGGAATCTAGAGAACCTAGG - Intergenic
1078512577 11:11996683-11996705 AGCAGGCATCAAGACAACCTTGG + Intronic
1079385970 11:19980074-19980096 AGAAGGCATTTGAACAACTTGGG + Intronic
1079804641 11:24914293-24914315 GTCAGACCTCTGGACAACCTAGG - Intronic
1080610897 11:33902614-33902636 ATAAGGCATCAGGAAAAACCTGG - Intergenic
1082954724 11:58857610-58857632 ATAAGACATCAACACAACCTGGG - Intronic
1082971782 11:59030307-59030329 ATAAGACATCAACACAACCTAGG - Intronic
1084823300 11:71709374-71709396 ATCAGGCCTTTGGACAACTTCGG - Intergenic
1086512319 11:87572374-87572396 ATCAGGCATATGTACAAACTGGG + Intergenic
1087863848 11:103198435-103198457 CTTAGACATCTGGACTACCTGGG - Intronic
1089709500 11:120305025-120305047 ATCAGGCATTTGGGCACCCTGGG + Exonic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1091743109 12:2974098-2974120 CTAAGGCACCTTGAAAACCTGGG - Intronic
1094469918 12:30794323-30794345 AAAAGGCATTTGGACAGCCCTGG - Intergenic
1095884786 12:47177574-47177596 CTAAGGCATCAGTACAACATAGG - Intronic
1096076936 12:48811808-48811830 ATCAGGCCTCTGGACAGACTGGG - Intergenic
1101589214 12:106111364-106111386 ATAAGACACCAGGACACCCTGGG - Intronic
1106915772 13:34512547-34512569 ATAAGAAAACTGGACAACCAAGG - Intergenic
1108033077 13:46257164-46257186 ATGAGGCAGCTTGAAAACCTGGG + Intronic
1108848274 13:54700379-54700401 CAAAGCCATCTGGACTACCTGGG + Intergenic
1108868546 13:54952536-54952558 GTAAGGCTTCTGGTCAACATAGG + Intergenic
1113715214 13:112500246-112500268 ATAAGGCATCTAAGCAAACTAGG + Intronic
1121896932 14:97657454-97657476 AGAAGGGGTCTGCACAACCTTGG + Intergenic
1121912738 14:97806738-97806760 TTAAGGCATCTGGAGATGCTGGG + Intergenic
1129969439 15:79764612-79764634 ACAAGGGATCTGGACAACAAAGG + Intergenic
1131112733 15:89775880-89775902 ATAAGGCATCAAGACAAGCCCGG - Intronic
1132180579 15:99749934-99749956 GTATGGCATCTTGACAAGCTAGG + Intergenic
1137934225 16:52618324-52618346 ATAGGTCATCTGGAGAACCAGGG - Intergenic
1138858456 16:60724539-60724561 AGAAGGCATCTGGAAGATCTAGG + Intergenic
1138953995 16:61949221-61949243 AGAAGGCAGCTGGACTTCCTGGG + Intronic
1140750419 16:78018458-78018480 ACAAGGCATTTGGCCAACCAAGG - Intergenic
1142336797 16:89494574-89494596 AGATGGCACCTGGACCACCTTGG - Intronic
1142871348 17:2823188-2823210 AAACAGCATCTGGACATCCTGGG - Intronic
1145398732 17:22514879-22514901 AGAAGCCATCTGGACACCCAAGG + Intergenic
1147363757 17:39946936-39946958 GTGAGGCAGCTGGACAGCCTCGG + Intergenic
1151955032 17:77375923-77375945 ATATGGGAGTTGGACAACCTTGG + Intronic
1156183113 18:34629444-34629466 ATTAGGAATCTGGACAACAATGG - Intronic
1157341577 18:46783072-46783094 ATAAGGGCTCTTGACAAACTAGG - Intergenic
1162350414 19:10145458-10145480 GGAAGGCATCTGGAAAACGTTGG + Intronic
1163270483 19:16250329-16250351 ATAAGGCCCCTGGCCAAACTGGG + Intergenic
1163722058 19:18903043-18903065 ATGGGGCATCTGGGCAGCCTGGG - Intronic
931088678 2:58862791-58862813 TTAAGTCATGTGGAGAACCTGGG + Intergenic
932943328 2:76195798-76195820 ATAAGACAGCAAGACAACCTGGG - Intergenic
942808505 2:179966133-179966155 ATAATGCTTTTTGACAACCTAGG - Intronic
943504521 2:188737218-188737240 ATCATGCATTTGGACAAACTAGG + Intronic
945668260 2:212769215-212769237 ATAAAGCACCTGTACAACTTTGG + Intergenic
948427003 2:237894718-237894740 AAAAGCCACCTGGACAGCCTGGG - Intronic
1169082853 20:2807697-2807719 TTAATGCATCTGATCAACCTAGG - Intergenic
1170207588 20:13815336-13815358 ATGAAGCAGCTGGATAACCTTGG - Intronic
1170817389 20:19725640-19725662 GTAAGCCATCTGAACAACTTTGG - Intergenic
1171114055 20:22509213-22509235 AGAAGGCAGGTGGACAACATAGG - Intergenic
1171722664 20:28579766-28579788 ACATGGCATCTGTACAAGCTAGG - Intergenic
1171755414 20:29103680-29103702 ACATGGCATCTGTACAAGCTAGG + Intergenic
1171787263 20:29479204-29479226 ACATGGCATCTGTACAAGCTAGG - Intergenic
1171860690 20:30400182-30400204 ACATGGCATCTGTACAATCTGGG + Intergenic
1172845300 20:37926657-37926679 ACAAGGCATTTGGACACTCTGGG + Intronic
1173139445 20:40469573-40469595 AGAAGGTGTCTGGTCAACCTAGG - Intergenic
1174086206 20:48009572-48009594 ATAAGTCATCTGCACAAGCCTGG - Intergenic
1179155301 21:38845168-38845190 ATAAGGCCTATGGTCCACCTTGG + Intergenic
1179963357 21:44784713-44784735 ATGAGCCAGCTGGAGAACCTGGG + Intronic
1180296218 22:10938444-10938466 ACATGGCATCTGTACAAGCTAGG - Intergenic
1181171664 22:21013390-21013412 AAAAGAAAGCTGGACAACCTGGG + Intronic
1181177689 22:21047129-21047151 AAAAGAAAGCTGGACAACCTGGG - Intronic
951131418 3:19049781-19049803 ATAAGGCTTCTGGTCAACAGTGG + Intergenic
961055270 3:123782515-123782537 AGAAGGAATCTGAACATCCTGGG + Intronic
963281632 3:143390139-143390161 AAATGGCATATGGGCAACCTTGG - Intronic
963698009 3:148586399-148586421 ATAAGGTAGGTGGAAAACCTAGG - Intergenic
967001088 3:185335617-185335639 ATAAGGAATCTGAACATCCTTGG - Intronic
969518124 4:7660055-7660077 ATAAGGCAACTAGAGCACCTAGG + Intronic
970965878 4:21927331-21927353 ATAAGGAATATGGACATCTTTGG + Intronic
972059907 4:34856539-34856561 CTAAGGGATCTGAACTACCTTGG - Intergenic
973830890 4:54757617-54757639 ATTAGGATTCTGGATAACCTAGG + Intergenic
974672203 4:65046755-65046777 ATTAGACATCTGGACAAACTTGG + Intergenic
974896607 4:67947828-67947850 ATAAGGCACCTGGACAGAGTAGG + Intronic
976350878 4:84058559-84058581 ATAAAGTATCAGTACAACCTTGG - Intergenic
979323839 4:119355791-119355813 GTAAGGCATTTGAAAAACCTTGG + Intergenic
981614533 4:146633388-146633410 CTAAGGCATCCAGCCAACCTGGG + Intergenic
983241677 4:165240465-165240487 GTAAGGCATTTGAAAAACCTTGG + Intronic
991652665 5:68872055-68872077 ATGAGGCATCAGGATGACCTTGG - Intergenic
997665092 5:135624189-135624211 ATGAGGCATCCTGAGAACCTGGG + Intergenic
998232637 5:140371016-140371038 CTAGGGCATCTGGGCATCCTGGG + Intronic
999553346 5:152714656-152714678 ATATGCCCTATGGACAACCTAGG - Intergenic
1001906348 5:175476745-175476767 ATAAGACAACTGCAAAACCTTGG - Intergenic
1009187559 6:60591377-60591399 AAAAGGCATCTGCACAGCCAAGG + Intergenic
1009449978 6:63789436-63789458 ATGAGGGTTCTGGTCAACCTGGG + Intronic
1009787645 6:68359368-68359390 ATTGGGCATCTGAACAACCCAGG - Intergenic
1013876830 6:114841468-114841490 ACAAAGCATGTGGACAATCTTGG - Intergenic
1013982679 6:116150784-116150806 GTAAGGAAGCTGGAGAACCTTGG + Intronic
1019488763 7:1301390-1301412 ATAAGGTTTCTGGACAACTGGGG + Intergenic
1024024853 7:45401327-45401349 ATAAGCCATCTGTGTAACCTGGG + Intergenic
1026729036 7:72895183-72895205 AGGAGCCATCTGGACAACCCTGG - Intronic
1028777731 7:94698976-94698998 ATGAGGCATTTGCAAAACCTGGG + Intergenic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1036084910 8:5602758-5602780 ATAAAGCCTCTGGATTACCTAGG - Intergenic
1036612223 8:10360252-10360274 ATAGGGCATCTGGTGGACCTGGG - Intronic
1041136501 8:54764602-54764624 ATAAGACATCAGCCCAACCTTGG - Intergenic
1042736775 8:71998577-71998599 ATAATGCATTTGGAGAACTTGGG + Intronic
1047307272 8:123663033-123663055 AAAAGGCCTTTGGACAAGCTTGG - Intergenic
1047868030 8:129050531-129050553 GTAAGGCTTCTGGTCAACATAGG + Intergenic
1049134379 8:140881710-140881732 AGAAGGCAACTGGAGAAGCTGGG - Intronic
1050463175 9:5894375-5894397 AGAAGGCATCGGGGCAACCAAGG + Intronic
1052787923 9:32847029-32847051 CCAAGGCATATGGGCAACCTGGG - Intergenic
1053747875 9:41219332-41219354 ACATGGCATCTGTACAAGCTAGG + Intergenic
1054338509 9:63831184-63831206 ACATGGCATCTGTACAAGCTAGG - Intergenic
1054479411 9:65646039-65646061 ACATGGCATCTGTACAAGCTAGG - Intergenic
1202784009 9_KI270718v1_random:30103-30125 ACATGGCATCTGTACAAGCTAGG + Intergenic
1203447864 Un_GL000219v1:76691-76713 ACATGGCATCTGTACAAGCTAGG - Intergenic
1186743707 X:12544428-12544450 TTAAGGCATCTGCACAAACTTGG - Intronic
1186775255 X:12858089-12858111 TTAAGGCATCTGCACAAACTTGG + Intergenic
1193669136 X:84362344-84362366 ATAAGGCATCAGGAAAAGCTAGG + Intronic
1195666823 X:107439291-107439313 ATAAGGCCTCTGGAAACCCTAGG + Intergenic
1198703340 X:139420290-139420312 TATAGGCATCTGGATAACCTTGG + Intergenic