ID: 1032494365

View in Genome Browser
Species Human (GRCh38)
Location 7:132349665-132349687
Sequence CTCCACGAAGGACATCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032494365_1032494369 -8 Left 1032494365 7:132349665-132349687 CCCTTCTGATGTCCTTCGTGGAG 0: 1
1: 0
2: 1
3: 9
4: 114
Right 1032494369 7:132349680-132349702 TCGTGGAGATCAGGAACAGCTGG No data
1032494365_1032494374 30 Left 1032494365 7:132349665-132349687 CCCTTCTGATGTCCTTCGTGGAG 0: 1
1: 0
2: 1
3: 9
4: 114
Right 1032494374 7:132349718-132349740 TGATAACCCCTCTTATATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032494365 Original CRISPR CTCCACGAAGGACATCAGAA GGG (reversed) Intronic
901445646 1:9306355-9306377 CTCCAGGCTGGACATCACAAAGG - Intronic
903598472 1:24515629-24515651 CTCCAAGAAAGTCATCGGAAGGG - Intronic
907196025 1:52687745-52687767 CTACACAAAGAACAGCAGAAAGG - Exonic
908214949 1:61942356-61942378 CTTCACCAAAGACATCTGAATGG + Intronic
910340821 1:86184856-86184878 CTAAACGAAGGATATTAGAATGG - Intergenic
912648280 1:111415588-111415610 TTCCATGAATGACCTCAGAAAGG + Intronic
915521070 1:156444336-156444358 CTCCAAAAAGGGCATAAGAAAGG - Intergenic
919525160 1:198638259-198638281 CTTAACTAAGAACATCAGAATGG + Intergenic
921807463 1:219472400-219472422 CTCCACCAAGTAAGTCAGAAAGG - Intergenic
1063968277 10:11363543-11363565 CCCCAGGCTGGACATCAGAAGGG - Intergenic
1065493152 10:26303042-26303064 CTCCACGAAGGACAGCAGGTTGG - Exonic
1067682872 10:48451312-48451334 CTCCAGGCAGGACAGCAGGATGG + Intronic
1071236954 10:83660359-83660381 CAGCAGAAAGGACATCAGAAAGG - Intergenic
1072496930 10:95971006-95971028 CTCTAAGAAGGAAATCAGAGGGG - Intronic
1072828028 10:98628270-98628292 GTCCAGGAAGGAAATCAGCATGG + Intronic
1072942867 10:99782721-99782743 CTTTACGGAGAACATCAGAATGG + Exonic
1073981815 10:109162881-109162903 CTCCACAAAGAAAATCAGAAGGG + Intergenic
1074894451 10:117762881-117762903 CTCCACGAAGCACAGGAAAATGG - Intergenic
1075674152 10:124284155-124284177 CTGCAGGAAGGAGAGCAGAAGGG - Intergenic
1080606046 11:33865538-33865560 TTACACGAAGGACATCAAATAGG + Intronic
1084798204 11:71523466-71523488 CTCCAAGAAGGACTTGAGAGAGG - Intronic
1090357958 11:126153142-126153164 TTCCATGAGGGACATCAGGATGG - Intergenic
1099937493 12:89144827-89144849 CTTCACGAAGGATATTAGGAAGG + Intergenic
1101632520 12:106509345-106509367 CTCCACGTAGGAAGTGAGAATGG - Intronic
1102982879 12:117256254-117256276 CTGCACAAAGAAAATCAGAAGGG + Intronic
1103187345 12:118970541-118970563 CTCCTTGAAGGAGATCAGACTGG + Intergenic
1104085112 12:125467181-125467203 CTCCATGTAGAACCTCAGAATGG + Intronic
1104601393 12:130156270-130156292 CTCCAGACAGGACAGCAGAACGG + Intergenic
1106181539 13:27373676-27373698 TTCCAGGCAGGACATCAGCAGGG + Intergenic
1106281120 13:28272501-28272523 CTACACTAAGTACATCATAATGG - Intronic
1107367408 13:39697659-39697681 CTCCAAGAAGGGTATCAGATAGG - Intronic
1108224868 13:48278542-48278564 TTCCAATAAGGACATCAGACAGG + Intergenic
1108503340 13:51087590-51087612 CTCCAAGAAGGACAGCAATAGGG - Intergenic
1113289394 13:108888354-108888376 CTCCACTAAGGAAAACAGAGAGG - Exonic
1116190363 14:41657456-41657478 ATCTCAGAAGGACATCAGAAAGG + Intronic
1119169166 14:72519912-72519934 CTCCAAGCATGACATCAGGAGGG + Intronic
1121521956 14:94592178-94592200 ATCCACAATGAACATCAGAAAGG - Exonic
1121692648 14:95889033-95889055 CTTCAGAAAGGACATCTGAAGGG - Intergenic
1122398408 14:101451509-101451531 CTCCACGATTGGCACCAGAATGG + Intergenic
1124080208 15:26487113-26487135 CTCCAAGAAGGAGATGGGAAGGG + Intergenic
1125612194 15:40979206-40979228 CTCCACCAGGGACATCAGGCAGG + Exonic
1125826952 15:42684685-42684707 CTCCAAGCAGGGCATCAAAAAGG + Exonic
1131995866 15:98132197-98132219 CCCCACGGAGAATATCAGAAGGG + Intergenic
1138204673 16:55115786-55115808 CTCCACCAAGGCCATGAGGAAGG + Intergenic
1139482368 16:67237532-67237554 CTCCAGGATGGACACCAGATTGG + Exonic
1140634807 16:76899404-76899426 TTCCACGAAGGACTTCTAAAAGG - Intergenic
1147927044 17:43952693-43952715 CTCCACGAAGGAGAAAGGAAAGG + Intergenic
1152987854 18:335855-335877 CACCATGAAGGACATCAGTGGGG - Intronic
1153692444 18:7607069-7607091 CTTCACAAAAGACTTCAGAAAGG + Intronic
1156515296 18:37674145-37674167 CACCACGAACATCATCAGAATGG - Intergenic
1157606096 18:48926779-48926801 CTCCACAACGGACATCTCAAAGG + Intronic
1157954302 18:52079302-52079324 CTCCACAAAGTAAATCAGATTGG + Intergenic
1159633454 18:70777524-70777546 ATCCACCAAAGTCATCAGAAAGG - Intergenic
1160122550 18:76143711-76143733 CACCACGAGAGGCATCAGAATGG + Intergenic
1164729826 19:30494986-30495008 CTCTATGAAGCACATCAGATTGG + Intronic
1168279262 19:55295568-55295590 CTCCAGGAAGAACCCCAGAAAGG + Intronic
926961977 2:18367013-18367035 CTACCCAAAGGACCTCAGAAAGG - Intergenic
928365245 2:30695555-30695577 CTCCAGGCAGTAAATCAGAAAGG + Intergenic
929915407 2:46131524-46131546 CTCCACCAGGCCCATCAGAAGGG - Intronic
935525819 2:104165133-104165155 CTTCACAAAGGACTTCACAAAGG + Intergenic
935657898 2:105440642-105440664 CTCCAATCAGGACATTAGAAAGG + Intergenic
935935126 2:108174146-108174168 CTACACGAAGGACATCACTAGGG + Intergenic
939775652 2:146384408-146384430 CTCCAAGAAGCATATCAGGAGGG - Intergenic
940130582 2:150376897-150376919 CTCCAGGAAGTACATGGGAAAGG + Intergenic
943803970 2:192098732-192098754 CTCCAGGAAGGACAGCAGGATGG + Intronic
1168806350 20:674538-674560 CTCCACCAAGGGGATCACAAAGG - Intronic
1172190872 20:33061165-33061187 CTCCACGAGGGCCCTAAGAAAGG + Intronic
1173107844 20:40154587-40154609 CTCCACCGGGGAGATCAGAAGGG + Intergenic
1176053401 20:63132628-63132650 CTCCAGGATGTACAGCAGAAAGG + Intergenic
1178427284 21:32488891-32488913 CTCCAAGAAAGACATAAAAATGG - Intronic
949794897 3:7838591-7838613 CTACGTGAAGGACATAAGAAAGG + Intergenic
953474867 3:43196501-43196523 CTCCTCCAAGGCCATCAGCAGGG + Intergenic
957279454 3:78131113-78131135 CTGCACGAAGAACCTCAGCAGGG - Intergenic
957548534 3:81672822-81672844 CTCAACTAAGGACATAATAAAGG + Intronic
959887467 3:111519267-111519289 CCCCAGGAAGCACAGCAGAAGGG + Intronic
961205774 3:125080403-125080425 CTTCAGAAAGGACAGCAGAATGG - Intergenic
965754883 3:172015562-172015584 CTCCACAGAGGACATCAGCTTGG - Intergenic
966508239 3:180731215-180731237 ATCCACCAAGGACATCAGAAGGG - Intronic
967074252 3:185988044-185988066 CTCCACCAAAGTCATCAGCATGG - Intergenic
968686080 4:1959719-1959741 CGCCAAGAGGGACATCAGAAAGG + Exonic
971042974 4:22775820-22775842 CTGCAGGAAGAACAGCAGAAAGG - Intergenic
975482180 4:74893032-74893054 CTGGAAGAAGGAAATCAGAAGGG + Intergenic
980173598 4:129318562-129318584 CTCCAACAAAGACATCATAATGG - Intergenic
983102400 4:163641624-163641646 CTCCTCTTAGGACTTCAGAAAGG - Intronic
984006291 4:174314028-174314050 TTCCACGAAGGGAATCAGTAGGG - Intronic
987575588 5:19724107-19724129 CTCATTGAAGGACATCAGGATGG - Intronic
987729738 5:21753566-21753588 CCCCACAAAGGACATGAGAATGG + Intronic
988599512 5:32626415-32626437 CTCCAATAATGACATCAAAAGGG + Intergenic
989305299 5:39948319-39948341 CTCCCCGTAGGAAATCAGAAAGG + Intergenic
990076191 5:51848604-51848626 CACCATGAAGGACATCAGAGAGG + Intergenic
994432051 5:99678654-99678676 GTCACCGAAGGACAGCAGAAAGG - Intergenic
996098950 5:119428439-119428461 CACCACCAAAGCCATCAGAAGGG - Intergenic
998286895 5:140871091-140871113 CTCCACCAACGACACCAGCACGG - Exonic
1002357841 5:178645255-178645277 CTACAGGAAGGAGAACAGAAAGG - Intergenic
1002955306 6:1856836-1856858 CTCCAAGATGGACATAAGGAAGG - Intronic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1009633959 6:66239617-66239639 CTCCTCTAAGGAAATCAGGAAGG + Intergenic
1010120602 6:72371577-72371599 CTCTCCCAAGGACACCAGAAAGG + Intronic
1010891870 6:81322926-81322948 CTCCAAGAAGGACATACAAATGG + Intergenic
1017682152 6:156874786-156874808 CTCCACGAAGGAGAATGGAATGG - Intronic
1019428065 7:986703-986725 CTCCAGGAGGGTCCTCAGAATGG - Exonic
1021048583 7:15954210-15954232 CTCCACAATGGACATCATGAAGG + Intergenic
1021842382 7:24731405-24731427 CTCCACGGTGGAGTTCAGAATGG + Intronic
1024194667 7:47047295-47047317 CTTTACGAAAAACATCAGAAGGG + Intergenic
1028150498 7:87366110-87366132 CTCCAGAAAGTACAGCAGAAGGG - Intronic
1032494365 7:132349665-132349687 CTCCACGAAGGACATCAGAAGGG - Intronic
1032840052 7:135706210-135706232 CTCCACGATGGGCATCACCATGG + Exonic
1033706231 7:143887124-143887146 CTCCAGGCAGAACATTAGAAAGG - Intronic
1038514629 8:28176297-28176319 CTCCACGAAGGAAGTGAGATGGG + Intronic
1038639974 8:29315833-29315855 CTCCAAGAGGGACTTCGGAAGGG + Intergenic
1039578926 8:38648126-38648148 CTCCATAAAGGACAGCAGAGAGG + Intergenic
1040530963 8:48265953-48265975 GGCCAGGAAGGAGATCAGAAAGG - Intergenic
1041845780 8:62327102-62327124 CTCCACAAAAGACATACGAATGG - Intronic
1044853730 8:96453500-96453522 CTCCACGTAGGAGATGATAATGG + Intergenic
1049579305 8:143404189-143404211 CACAAAGTAGGACATCAGAAAGG - Intergenic
1049918968 9:345721-345743 CCCCACGCAGGACACCTGAAGGG - Intronic
1052593588 9:30530725-30530747 CTCCACCAAGGAGTTGAGAATGG - Intergenic
1057868144 9:98697738-98697760 GTCCAGGAAGGACCTCTGAAGGG + Intronic
1058328042 9:103722993-103723015 CTCAACTAAGGACATGATAAAGG + Intergenic
1062441535 9:136571849-136571871 ATCCACTAAGGACGTGAGAAGGG - Intergenic
1185777143 X:2812500-2812522 GTCCCCGAAGGAAACCAGAAAGG + Intronic
1189915989 X:45856342-45856364 CTACATGAAGGACAACAGCAGGG + Intergenic
1193031645 X:76905506-76905528 CTCCAAGAAGAAAATGAGAATGG + Intergenic
1196008999 X:110866224-110866246 CACCAGGAAGGACATCTGAATGG - Intergenic
1201292869 Y:12438951-12438973 GTCCCCGAAGGAAACCAGAAAGG - Intergenic