ID: 1032496824

View in Genome Browser
Species Human (GRCh38)
Location 7:132368979-132369001
Sequence CTGAATTAGGGGAGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 389}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032496824 Original CRISPR CTGAATTAGGGGAGGGTGGA TGG (reversed) Intronic
900841894 1:5056683-5056705 CAGAAGTGGGGGAGGGTGAAAGG + Intergenic
901240924 1:7692784-7692806 CTGAATGACAGGTGGGTGGACGG - Intronic
901913858 1:12482265-12482287 CTGGATAAGGGGAGGCTGGGTGG - Intronic
901921478 1:12540567-12540589 TGGAGTTGGGGGAGGGTGGAGGG - Intergenic
902107282 1:14048293-14048315 CTGAATTAGGGCAGGATGGTAGG - Intergenic
902527491 1:17068692-17068714 CTGAATGAGGGGAGAAGGGAAGG - Exonic
902712368 1:18249246-18249268 TGGGATTAGGGGAGGGTGGGAGG + Intronic
902876212 1:19342379-19342401 CTGAAGCATGGGGGGGTGGACGG + Intronic
902898144 1:19493832-19493854 CTGAATTGAGGCAAGGTGGAAGG + Intergenic
903103126 1:21050943-21050965 CTGAATAAGGGGATGGGGTAGGG + Exonic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905775970 1:40667341-40667363 CTAGATTAGGGGAGGTGGGATGG + Intergenic
905925356 1:41745735-41745757 CTGAATTAGAGCAGGGTTGTGGG + Intronic
906116707 1:43361809-43361831 CTGAATGTGGGGGGAGTGGAAGG - Intronic
906134920 1:43491888-43491910 CTGAGTTTGTGGGGGGTGGAAGG + Intergenic
906195872 1:43930550-43930572 GTGAATTTGGGTAGGGGGGAGGG + Exonic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906561474 1:46761150-46761172 CAGTATCAAGGGAGGGTGGAGGG + Intronic
906582629 1:46948845-46948867 CAGAACTAGGGGAGGTTGGGTGG - Intergenic
907677978 1:56536419-56536441 TTGAATTTGGGGAGGGGGAAGGG - Intronic
907905248 1:58778561-58778583 CTGCATTAGTGGAGGCAGGAAGG + Intergenic
907964922 1:59319733-59319755 CTGTATTAGGCGGGGCTGGATGG + Intronic
909470353 1:76020715-76020737 CTGAACTAGGGCATGGTGGTAGG - Intergenic
910493036 1:87794404-87794426 CTGAAGTAGGGAGGGCTGGAGGG - Intergenic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
912568365 1:110605156-110605178 CTGCATTGGGGGAAGGTGGCTGG + Intronic
915875681 1:159609742-159609764 CGGAGTGGGGGGAGGGTGGAGGG + Intergenic
915907230 1:159887774-159887796 GGGAATAAGGGGAGGGCGGAGGG + Intronic
917089678 1:171340393-171340415 CTGAAATGGGGGAGAGGGGAGGG - Intronic
917653455 1:177102198-177102220 TTAAATAAGGGGAGGGAGGAAGG + Intronic
917665117 1:177218715-177218737 CTGACTTAGGGGAGAGAGGAAGG + Intronic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920452242 1:206068299-206068321 TTGAGTTGGGGTAGGGTGGAGGG + Intronic
921260453 1:213381459-213381481 CTGAATGAGAGGAGGGGGGCAGG + Intergenic
923956952 1:239032941-239032963 CTGAAAATGGGGTGGGTGGAAGG + Intergenic
1062769078 10:85574-85596 CTTCATTAGGTGAGCGTGGAGGG - Intergenic
1064794192 10:18992874-18992896 CTCAATTAGGGATGGGAGGATGG + Intergenic
1066345052 10:34576592-34576614 CTAAATTAGGGGTGGGCAGAGGG - Intronic
1066680155 10:37930317-37930339 ATGAATTACTGTAGGGTGGAAGG + Intergenic
1067202986 10:44190346-44190368 CAGGGTTGGGGGAGGGTGGAGGG + Intergenic
1069853426 10:71425162-71425184 CTGGAGTGGGTGAGGGTGGAAGG + Intronic
1071806973 10:89133223-89133245 TTGATTTAAGGGAGGGGGGAGGG - Intergenic
1072358258 10:94633453-94633475 CTCTACTAGGGAAGGGTGGAGGG + Intergenic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1075011559 10:118874733-118874755 CTGAAACAGGGGAATGTGGATGG + Intergenic
1076257787 10:129042270-129042292 ATGGAGTAGGGAAGGGTGGATGG - Intergenic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1077817690 11:5703194-5703216 CTACACTAGGGGAGGGAGGAGGG - Intronic
1078508568 11:11969038-11969060 ATGAATTAGAGGAGGGTGGCTGG + Intronic
1079239826 11:18714525-18714547 CTGAATGACGAGAAGGTGGAGGG - Exonic
1080030661 11:27657283-27657305 CTGGCTTAGGGGATGGGGGATGG - Exonic
1080034684 11:27699774-27699796 CTGACTGAGGGGAGGGTGCTGGG - Intronic
1080158529 11:29143215-29143237 CTGACTCGGGGGAGGGGGGAGGG - Intergenic
1080306688 11:30844345-30844367 CTGTACTAGGGGAGTGTAGAGGG - Intronic
1080312051 11:30905851-30905873 CAGGATTAGGGAAGGGAGGAGGG + Intronic
1080941777 11:36926731-36926753 CTGAGCTAGGCCAGGGTGGACGG + Intergenic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1083063947 11:59903990-59904012 CTGTTTTGGGGGAGGGGGGAGGG + Intergenic
1084365504 11:68694993-68695015 TTGAATTAAGGGAAGGTAGATGG - Intergenic
1085984376 11:81768004-81768026 CTGAATTAGGGAAGAGATGAGGG - Intergenic
1086398842 11:86444206-86444228 ATGAATTAGGGGAGAGAGAATGG + Intronic
1087390660 11:97528149-97528171 CTGAATTAGGTGGGAGGGGAGGG + Intergenic
1087433355 11:98081234-98081256 CTCAACTAGGGAAGTGTGGAGGG + Intergenic
1091514153 12:1161176-1161198 CAGAATTATGGGAGGTTAGAAGG + Intronic
1091727837 12:2857940-2857962 TTGAATTTGGGGTGGGAGGATGG - Exonic
1092919086 12:13214780-13214802 CCGAGATAGGGGAGGGGGGAGGG + Exonic
1093589709 12:20886865-20886887 CTAAAGTGTGGGAGGGTGGAAGG - Intronic
1095206385 12:39443766-39443788 CTGACTCCGGGGAGGGAGGAGGG - Intergenic
1095607990 12:44093032-44093054 CTGAAATGGGGGTGGGAGGAAGG + Intronic
1096049339 12:48593500-48593522 CTCAAAGAGGGCAGGGTGGAGGG - Intergenic
1096802099 12:54117397-54117419 CTGATTTAGCAGAGGGTGAAGGG + Intergenic
1096844980 12:54401491-54401513 GTGGTTTAGAGGAGGGTGGAAGG + Intronic
1096909282 12:54966023-54966045 CTGAAGTTTGGCAGGGTGGAAGG - Intronic
1096989049 12:55783566-55783588 ATGATTTAGGGGAGGCTGGGGGG + Intronic
1098115864 12:67175855-67175877 CTGCATTAGGGGGTTGTGGAAGG + Intergenic
1099782481 12:87215314-87215336 CTGAGTTAAGTGAGGGTGGGAGG - Intergenic
1100894041 12:99159372-99159394 CTGGAGTAGGGAAGGATGGAGGG - Intronic
1101099803 12:101380493-101380515 TTGAATGAGTGGAGGGTAGAAGG + Intronic
1102121519 12:110445654-110445676 ATTAATTAGGGGAGGGAGAAGGG + Intronic
1102192459 12:110999016-110999038 CTGATTTAGGAGAGGCTGGGAGG + Intergenic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1103359501 12:120345572-120345594 CTGAAGCAGGGGACGGTGGCAGG - Exonic
1104075891 12:125389414-125389436 ATGAATTATGGAAGGATGGATGG - Intronic
1104439255 12:128781676-128781698 GTGAATGAGGGGAGGGTGTCTGG + Intergenic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1109346644 13:61123129-61123151 CCAAATTCGGGGAGGGGGGAGGG - Intergenic
1110250340 13:73374057-73374079 CCTAAATATGGGAGGGTGGAGGG + Intergenic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1113596954 13:111540198-111540220 CGGAACTTGGGGAGGGGGGACGG - Intergenic
1113600304 13:111563541-111563563 GTGAAATAAGGGAGGGAGGATGG - Intergenic
1114450093 14:22819683-22819705 CTGAGTCAGGGGAGAGGGGAAGG + Intronic
1114627110 14:24136880-24136902 CTGACCTGGGGAAGGGTGGAGGG - Intronic
1115936582 14:38559594-38559616 CTCTACTAGGGCAGGGTGGAGGG - Intergenic
1116149150 14:41116452-41116474 CTGATGTGGGGGATGGTGGAGGG - Intergenic
1117875290 14:60245760-60245782 ATGATGTAGGGGAGGGAGGAAGG + Exonic
1117881856 14:60320242-60320264 CTCAACTAGGGCAGTGTGGAGGG + Intergenic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118502368 14:66373734-66373756 CTGAATTGAGGGACCGTGGAAGG - Intergenic
1118692163 14:68350698-68350720 CTGATTTAGTGGAGGGGAGATGG + Intronic
1119889683 14:78173550-78173572 CAGAATTGGGGGAGGATGGAGGG - Intergenic
1120230571 14:81836666-81836688 CTCTATTAGGGCAGCGTGGAAGG + Intergenic
1122889179 14:104724665-104724687 GTGGAGTAGGGGTGGGTGGAAGG - Intronic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931268 14:104933869-104933891 CTGAGTGAGGGGAGGGCGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1123677301 15:22723333-22723355 CTGAAGTAGGGTAGGGAGCAGGG - Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124329513 15:28797602-28797624 CTGAAGTAGGGTAGGGAGCAGGG - Intergenic
1124798321 15:32804430-32804452 CTGAATTCGGGGGGGGGGGGGGG + Intronic
1126347155 15:47708332-47708354 CAGAATCAGGGGAGGGTGATAGG - Intronic
1127221231 15:56883848-56883870 CTGAATTGGGAGAGGGTGAAAGG - Intronic
1127371762 15:58348135-58348157 CTGAATCTGGAGAGTGTGGAAGG - Intronic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1128706377 15:69840026-69840048 TTGAACTTGGGGAGGGTGGGGGG + Intergenic
1128926023 15:71656990-71657012 CTGAATGAGGGGACTGGGGATGG - Intronic
1129677740 15:77641605-77641627 CTGTAATTGGGGAGGGTGTAGGG - Intronic
1129934297 15:79436874-79436896 CTGAAGTTGGGGACAGTGGAGGG - Intronic
1133539286 16:6733331-6733353 CTGGATTATGGAAGGATGGAAGG - Intronic
1135040425 16:19113851-19113873 CTGCCTTCGGGGAGGGAGGATGG + Intergenic
1135593416 16:23722188-23722210 CTGAAACAGTGGAGGGTGGGAGG - Intergenic
1135624590 16:23982752-23982774 CTGTAATAAGGGAGGGTGGGAGG + Intronic
1138443650 16:57050005-57050027 TTGAATTCAGGGAGGGGGGATGG - Intronic
1139044633 16:63041856-63041878 CTAAATGGGGGGAGGGGGGAGGG - Intergenic
1140068310 16:71627760-71627782 GTGAGCTAGGGGAGGGTGGGGGG + Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140856144 16:78979496-78979518 CTGAATTAGAGGCAGGTGAAAGG + Intronic
1141347152 16:83257119-83257141 CTGAGTTGGGGGATGGAGGAAGG + Intronic
1141405273 16:83787204-83787226 CTGAATTAGAGCAACGTGGATGG - Intronic
1142364808 16:89644620-89644642 TTGATTTTGGGGAGGCTGGAGGG + Exonic
1143028370 17:3953895-3953917 CTGAGTCGGGGGAGGGTAGAGGG - Intronic
1144582361 17:16466150-16466172 CTGGCTTAGGGGAGGGGGGATGG - Intronic
1145062946 17:19743854-19743876 CTGGATCCGGGCAGGGTGGAGGG + Intronic
1145744697 17:27307539-27307561 TTGAATTAATGGAGGGTGGGAGG + Intronic
1146092585 17:29894826-29894848 CTTAATTGGGGGAAGGTGGAAGG - Intronic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146571053 17:33953737-33953759 CTGAATGAGGGGAGTGTTGTGGG + Intronic
1146578044 17:34012046-34012068 CAAAATAAGGGGAGGGAGGAAGG - Intronic
1147844366 17:43394504-43394526 CTGAAGTAAGGGAGGGTAGGAGG - Intergenic
1147877669 17:43632847-43632869 CAGGATGAAGGGAGGGTGGACGG + Intergenic
1148471366 17:47895874-47895896 CTGGGTTAGAGGTGGGTGGAAGG + Intergenic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1152016509 17:77754408-77754430 CTGACTTAGGGGAGGGTCTGAGG - Intergenic
1152108187 17:78342595-78342617 AGGAGTTAGGGGTGGGTGGAGGG - Intergenic
1152256751 17:79244479-79244501 CTGAAGGTGGGGAGGGTGGGTGG - Intronic
1152677156 17:81647527-81647549 TTGGAGCAGGGGAGGGTGGATGG - Intronic
1152962135 18:86384-86406 CTTCATCAGGTGAGGGTGGAGGG - Intergenic
1153308580 18:3655186-3655208 CTTAATCAGGGGAGGCTGCATGG - Intronic
1153761363 18:8335239-8335261 CTGAAGGAGGGGAGAGGGGAGGG - Intronic
1153910928 18:9706414-9706436 CAGAACTAGGGGAGGGGAGAAGG + Intergenic
1156470409 18:37374198-37374220 CTGAACTAAGGAAGGGTGCATGG - Intronic
1156675664 18:39524712-39524734 CTGAGTAAGGGGAGGGGAGAAGG - Intergenic
1157249157 18:46078945-46078967 ATGAATGGGGGGAGGGGGGAGGG + Intergenic
1157509140 18:48255881-48255903 GGAAAATAGGGGAGGGTGGAGGG - Intronic
1157549393 18:48570798-48570820 CAGACTTTGAGGAGGGTGGAGGG + Intronic
1157806836 18:50664612-50664634 AGTAATTAGGGGAGGCTGGAGGG + Intronic
1157850299 18:51042380-51042402 CTGAAGTAAGGGAGGGAGGCAGG - Intronic
1157865036 18:51175431-51175453 GTAATTTAGGGGAGGGAGGAGGG - Exonic
1159265300 18:66072195-66072217 CTTTATTAGGGCAGTGTGGAGGG + Intergenic
1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG + Intergenic
1161958012 19:7506904-7506926 ATGGATTAGGAGAGGGGGGAGGG - Intronic
1162311892 19:9913049-9913071 CTGAAAGAGGGGAGGATCGAGGG - Intronic
1162345320 19:10115130-10115152 CTGGGGTAGGGGAGGGTGGCAGG + Exonic
1162751240 19:12830581-12830603 CTGAATGCGGGGAGGCGGGAAGG - Intronic
1162993303 19:14317492-14317514 CAGAATTCGGGGAGGGTTGGAGG + Intergenic
1163025240 19:14507188-14507210 CTGGCATAGGGGAGGGAGGATGG - Intergenic
1163751064 19:19078136-19078158 CTGTATATGGGGAGGCTGGAGGG + Intronic
1163809056 19:19419050-19419072 CTGAATTCAAGGATGGTGGAGGG - Intronic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164440636 19:28275569-28275591 GTGGAGTAGGGGAGGGGGGAGGG + Intergenic
1165226433 19:34358432-34358454 TGGAAGTAGGGGAGGGTGCATGG - Intergenic
1165752327 19:38267875-38267897 GGGATTTTGGGGAGGGTGGAGGG + Intronic
1165793564 19:38506188-38506210 TTGAGCCAGGGGAGGGTGGAGGG + Intronic
1165833740 19:38742543-38742565 CAGGATTAGGTGAGGATGGAAGG + Intronic
1166049868 19:40252261-40252283 CTTAACTATGGGTGGGTGGAGGG - Intronic
1166057924 19:40304560-40304582 CTAAATTATGGGAGGGTGCAGGG - Intergenic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166357218 19:42234328-42234350 CAGAGTTATGGGAGGGTGGCGGG - Intronic
1166602115 19:44105667-44105689 CTCAAAATGGGGAGGGTGGAAGG - Intronic
1166684770 19:44789836-44789858 CCCAATTAGAGGTGGGTGGAGGG + Intronic
1167697383 19:51023265-51023287 CTGCATTAGGGGAGGTGGCAGGG - Intronic
1167842469 19:52133246-52133268 TTCAATTAGGGCAGAGTGGAAGG + Intronic
1168522145 19:57060902-57060924 CTGGAGCAGGGGAGGGTGGTGGG - Intergenic
1168707476 19:58478159-58478181 CTGAATCCTGGGTGGGTGGAAGG - Exonic
925554158 2:5110895-5110917 CTGAAGTAGGGGAGAGAGGAGGG + Intergenic
926099565 2:10105639-10105661 CTCAACTAGGGCAGTGTGGAGGG - Intergenic
926418151 2:12671144-12671166 CTGAATCAGGAGTGGGAGGATGG - Intergenic
926599985 2:14832134-14832156 GGGAATTAGAGAAGGGTGGAGGG - Intergenic
926777357 2:16435704-16435726 CAGAGTTAGGGGAGGGAGAATGG - Intergenic
926861823 2:17317839-17317861 GTGAATTTGGGCAGGGTGTATGG + Intergenic
926917840 2:17909861-17909883 TGAAGTTAGGGGAGGGTGGATGG + Intronic
927438721 2:23093525-23093547 ATGAACTAGGGCAGGGTGGGGGG + Intergenic
927859367 2:26550908-26550930 ATGCATCAGGGGAGTGTGGAGGG - Intronic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
931372006 2:61672298-61672320 CTGGGTGAGGGAAGGGTGGATGG + Intergenic
931669833 2:64637008-64637030 ATTAATTAGGGGTGGGAGGAAGG + Intronic
932409502 2:71537044-71537066 CTGAATTGGGAGAGGAGGGAAGG - Intronic
933558599 2:83863588-83863610 CTGAATTAGCTGAGAGTAGAGGG + Intergenic
935316851 2:101843270-101843292 GTGAACAAAGGGAGGGTGGAAGG + Intronic
936780898 2:116030794-116030816 CTGAAAGAGGGGAGGGAGGTAGG - Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
939337478 2:140849058-140849080 CTTAAGTAGGGGAGGGAGGCCGG + Intronic
941564383 2:167088225-167088247 CTGCTTTAGGGGATGGTGCAGGG - Intronic
941854703 2:170219208-170219230 CTGTATTAAGGGAGGGTCTAAGG - Intronic
942428127 2:175880692-175880714 CTGAATCAGGGGAGAGTGATGGG + Intergenic
942570158 2:177305752-177305774 CTAAATTTGGGAAGGGTGGAGGG - Intronic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
942672271 2:178388731-178388753 CAGAAGTATGGGAGGGTAGATGG - Intronic
942784878 2:179689293-179689315 AGGAATTAGGTGATGGTGGAGGG + Intronic
942926281 2:181436814-181436836 CCAAAATAGGGGAGGATGGAGGG + Intergenic
943248369 2:185484942-185484964 CTGTAGTAGGGCAGTGTGGAGGG + Intergenic
943391101 2:187268901-187268923 CTGAAACAGGGAAGGGTGGGAGG - Intergenic
943645047 2:190401084-190401106 AGGAACAAGGGGAGGGTGGAGGG + Intergenic
945155528 2:206833711-206833733 CTGAATTAGGGTAAGGGAGACGG + Intergenic
945186954 2:207148909-207148931 GGGAATCAGGTGAGGGTGGAGGG - Intronic
946222665 2:218241849-218241871 CTGAATTTGGAAAGGGTGGCAGG - Intronic
946325218 2:218981557-218981579 CTGGATTAGAGGACGGTTGACGG + Exonic
946661794 2:222008683-222008705 CTGAATAAGGGGAGTGGGTATGG + Intergenic
946724867 2:222652305-222652327 CTGAATCAGTGGAGGTTAGAGGG + Intronic
948741972 2:240054118-240054140 CTGAACAAGGACAGGGTGGATGG - Intergenic
1168928795 20:1604668-1604690 CTGGATGAGTGGAGGGTGGTGGG + Intronic
1168969584 20:1921764-1921786 CTGGATGAGTGGAGGGTGGTGGG - Intronic
1169603776 20:7292231-7292253 AGGAATTAGGGGAGAGTGGATGG + Intergenic
1170188318 20:13617745-13617767 CTGAAGTAGGGTAGGGAGCAGGG + Intronic
1170540040 20:17378570-17378592 CTGAATTATGGATGGATGGACGG + Intronic
1171514995 20:25723070-25723092 CTAAATTAGGGGAGGAAGGATGG + Intergenic
1171794613 20:29557066-29557088 CTGATTTAGTAGAGGGTGAAGGG - Intergenic
1171853840 20:30327198-30327220 CTGATTTAGTAGAGGGTGAAGGG + Intergenic
1172989971 20:39028148-39028170 GTGGCTTAGGGGAGGTTGGAGGG + Intronic
1173005767 20:39138613-39138635 CAGAATTGGGGGAGGATGCATGG - Intergenic
1173334701 20:42102938-42102960 CTGAATGAGGGAAGGATGGAGGG - Intronic
1173619800 20:44428368-44428390 CTGCATCAGGTGAGGGTGCAGGG - Exonic
1173968982 20:47136451-47136473 CTGAATTATAGGAGGTTGGTGGG - Intronic
1173976600 20:47191490-47191512 ATGGATTAGTGGATGGTGGATGG + Intergenic
1174250936 20:49219175-49219197 CAGTATTTGAGGAGGGTGGAAGG - Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174965614 20:55211182-55211204 CTTAAGAGGGGGAGGGTGGAAGG + Intergenic
1175017892 20:55811309-55811331 CTGAATTGGGGCAGGTTGGCAGG - Intergenic
1175172511 20:57090444-57090466 CTGGATTTGGGGAGGGCGGAAGG + Intergenic
1176198892 20:63850991-63851013 CTGAAGTAGGGGGAAGTGGAGGG - Intergenic
1176843341 21:13858003-13858025 CTGTACTAGGGCAGTGTGGAAGG + Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1178307463 21:31502510-31502532 CAGATTTGGGGGAGGGTGGTAGG - Intronic
1178627580 21:34231096-34231118 TTGCATCAGAGGAGGGTGGAGGG + Intergenic
1181719846 22:24765292-24765314 CTGAAATGGGGGAGAGGGGAGGG - Intronic
1182015210 22:27033364-27033386 CTGAAATAGAAGAGGATGGATGG + Intergenic
1183404708 22:37624772-37624794 GTGAATGAGGGAAGGGTGGGAGG + Intronic
1183537771 22:38413133-38413155 TTGAATTAGGGGGGGTTGGTTGG - Intergenic
1183680350 22:39325017-39325039 CTGGATTAGGAGAGGATGGAAGG + Intergenic
1183686687 22:39365081-39365103 CAGAAACAGGGGAGGATGGAGGG - Intronic
1184048884 22:41989786-41989808 GAGAATTGGGGGAGGGTTGAGGG - Intronic
1184135000 22:42542893-42542915 CTGAATTTGGGGGGGGTGGGGGG + Intergenic
1185007825 22:48294337-48294359 CTGAATTGTGTGAGTGTGGAGGG + Intergenic
949230413 3:1743948-1743970 CTGTACTAGGGCAGTGTGGAGGG - Intergenic
949331019 3:2922324-2922346 CTGACCTAGGGGAGGTTTGAAGG - Intronic
949421696 3:3872776-3872798 CTGAAGTAGGCAAGAGTGGATGG - Intronic
950230397 3:11271060-11271082 CTGCCTTTGGGGAGGGTGGGGGG + Intergenic
950917375 3:16659620-16659642 AGGAATTAGAGGAGGGAGGAAGG - Intronic
951246705 3:20349780-20349802 CTGAATCAAAGGAGGGTGCAGGG - Intergenic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952755699 3:36864631-36864653 CAGAATCAGGGGAGGGTGGAGGG - Intronic
953626923 3:44579350-44579372 CTGAATCAGGAGCGGGTGGGCGG - Intronic
953995436 3:47515826-47515848 GTGATTTAGGGGAGGGTTTAAGG - Intergenic
954671191 3:52292155-52292177 CTGAGTTGGGGGAGGGTGTGTGG + Intronic
954746813 3:52792074-52792096 CTGATTTTGGGGAGGGAGGATGG + Intergenic
955450091 3:59057185-59057207 CTGATTTAGGGGAGGGTTTAGGG - Intergenic
956368195 3:68529235-68529257 GTGAAGAAGGGCAGGGTGGAGGG - Intronic
956816130 3:72910054-72910076 CTGAATCAGGGGAAGGGTGAAGG + Intronic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
959099903 3:101998576-101998598 CTGAATGAGGGAATGGTGGCTGG - Intergenic
959504128 3:107139297-107139319 CTGAATTAGGGGATGGAGTGTGG + Intergenic
962467473 3:135673833-135673855 CTGACATAGCGGAAGGTGGAAGG + Intergenic
962708487 3:138067054-138067076 CTGGATTTGGGGAGGCTGGAGGG + Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963606312 3:147414008-147414030 TTGCATTGGGGGAGGGGGGAGGG + Exonic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
966924586 3:184636037-184636059 CTGAAGTAGGGCTGCGTGGAAGG + Intronic
967101733 3:186221444-186221466 CTGATTTGGCGGAGGGTGGAGGG + Intronic
967799308 3:193638244-193638266 CTGAGTGAGGGGAGAGTGGTAGG + Intronic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
970966139 4:21930312-21930334 CTGAATTAAAGCAGTGTGGAAGG - Intronic
971892639 4:32544543-32544565 CTCAACTAGGGCAGTGTGGAGGG + Intergenic
972228336 4:37041134-37041156 CTGAATTATGTGAGGCTGGATGG - Intergenic
972622592 4:40762966-40762988 ATGAACTGGGGGAAGGTGGAGGG - Intronic
972699107 4:41476718-41476740 ATCCATTAAGGGAGGGTGGAGGG - Intronic
972942497 4:44214051-44214073 CTAAATTATGGGAAGGTGAAGGG - Intronic
973330463 4:48906530-48906552 CCGAGTTAGGGGAGAGTGGGGGG + Intronic
973561891 4:52145139-52145161 TTGAATTTGGGCAGGGAGGAAGG + Intergenic
974715328 4:65662081-65662103 TTGACTTAGTGGAGGATGGAAGG + Intronic
976879615 4:89903869-89903891 CTGAATTAGGCAAGGGTGAGGGG - Intronic
977114159 4:93000801-93000823 CTAAAATTGGGGAGGGTGGGTGG + Intronic
981074508 4:140577804-140577826 ATGAATTTGGGGGGGGTGGTGGG + Intergenic
981185776 4:141801200-141801222 CTGAAATGGCGGAAGGTGGAAGG + Intergenic
981331302 4:143513604-143513626 CTGATTTAGAGAAGGGCGGAGGG - Exonic
981924742 4:150126695-150126717 CAGCATTACGGGAGGCTGGATGG - Intronic
982523723 4:156452075-156452097 AGGAATTTGGGGAGGGAGGACGG + Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
984785802 4:183566281-183566303 CTGAATTAGGGAGGAGTGGAGGG + Intergenic
985039809 4:185878850-185878872 CGGAAAGTGGGGAGGGTGGACGG - Intronic
986395325 5:7323511-7323533 ATCAAGTAGGAGAGGGTGGAGGG - Intergenic
987843582 5:23253448-23253470 CTGAAAGGGGGGAGGGCGGAGGG - Intergenic
987958104 5:24766130-24766152 CTGGGCTAGGGGAGGGGGGAGGG + Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
990320316 5:54623474-54623496 CTGAAACAGGGCAAGGTGGATGG + Intergenic
992954508 5:81893490-81893512 CTGAATTTTGGGGGGGTGGTGGG - Intergenic
994078922 5:95684369-95684391 AAGAACTAGGGGATGGTGGAAGG - Intronic
996266642 5:121549221-121549243 CTGAATTAGTGGAGGAAAGAAGG - Intergenic
996519309 5:124409356-124409378 CTGAATCAGGGGAGAATGTAAGG + Intergenic
996854181 5:127986603-127986625 CTGACTTAGGGGAAGGCTGATGG + Intergenic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
997474965 5:134137547-134137569 CTGATTTAGGGGATTGAGGAGGG + Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
999236915 5:150104014-150104036 CTGACTTAGGGGTGGGAGGGGGG + Intronic
999721270 5:154400818-154400840 TGGAATGAGGTGAGGGTGGAGGG + Intronic
1000213336 5:159130544-159130566 AAGAATTAGGGTAGGATGGAGGG + Intergenic
1001650701 5:173314017-173314039 CTGAAGTAGGGGAAGGTGTGTGG + Intergenic
1001681253 5:173558542-173558564 CTGAGTCAGGGGTGGGAGGAAGG + Intergenic
1001963767 5:175896021-175896043 CTGAGCTGGGGGAGGGGGGAAGG - Intergenic
1003186393 6:3835143-3835165 TTGTGTTAGGGCAGGGTGGAAGG + Intergenic
1004573403 6:16869716-16869738 CTGAAGGAGGGGTGGGTGGGAGG + Intergenic
1005097338 6:22131845-22131867 CTAAATTAGAGAAGGGTGCATGG - Intergenic
1005412497 6:25565163-25565185 CCCAATTTGGGGAGGCTGGAAGG + Intronic
1006348797 6:33505186-33505208 ACCCATTAGGGGAGGGTGGAGGG - Intergenic
1006607178 6:35266447-35266469 CTGAAATTGGGGAGCCTGGAAGG + Intronic
1006717998 6:36132272-36132294 AAGCATAAGGGGAGGGTGGAAGG - Intronic
1006718047 6:36132516-36132538 GTGTATTAGGAAAGGGTGGATGG + Intronic
1007170762 6:39861741-39861763 CTGAAAACTGGGAGGGTGGAGGG - Intronic
1007220982 6:40278682-40278704 CTGATTTGGGGGAGGTTGGTTGG + Intergenic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1010579092 6:77572066-77572088 CTGAATTCGGGGAGTGTACATGG - Intergenic
1012135774 6:95554090-95554112 CAGAATAGGGTGAGGGTGGAGGG - Intergenic
1012903953 6:105042210-105042232 CTGAATTGGGGGAAGGGGGTAGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013609084 6:111777568-111777590 CACAGTTAGGGGAGGGAGGAGGG - Intronic
1015211191 6:130701140-130701162 CTGAAAGAGGGGAGGGAGGAAGG + Intergenic
1016995859 6:149962187-149962209 CTGACTTCAGGGAGGGTGGCAGG + Intergenic
1018029946 6:159834011-159834033 CTGTCTTAGGGTAGGGAGGAGGG - Intergenic
1018208032 6:161453786-161453808 TTGAATTTGGGGAGAGGGGAAGG - Intronic
1018466148 6:164047479-164047501 CTCTGTTAGGGTAGGGTGGAAGG + Intergenic
1018597881 6:165502826-165502848 AGGAACTAGAGGAGGGTGGAGGG + Intronic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1020253990 7:6491524-6491546 CTGAATTGGAGGAGTGGGGAGGG + Intergenic
1020276102 7:6625514-6625536 CTGAATTTTTGGGGGGTGGAGGG - Intergenic
1020361223 7:7328821-7328843 CTGAAGTAGGAGTTGGTGGAAGG - Intergenic
1021272595 7:18609771-18609793 CGGAGTTGGGGGAGGGGGGAGGG - Intronic
1022212496 7:28225250-28225272 CTGAATTGGAGGAAGGTTGAGGG + Intergenic
1023584975 7:41719691-41719713 CAGGAATGGGGGAGGGTGGATGG + Intergenic
1023840230 7:44092950-44092972 CTGACTCAGGTGAGTGTGGACGG + Intergenic
1024482129 7:49874829-49874851 CTGAATTAGGGAAGAGGGGCAGG - Intronic
1024927008 7:54627775-54627797 CTGCATTGGGGGAGGCTGCATGG - Intergenic
1026395796 7:69953040-69953062 CTAATTTAGGGGAGGGAGGAGGG - Intronic
1026464856 7:70645226-70645248 ATGAATGAGGGGAGGTTGGGAGG - Intronic
1026847308 7:73705369-73705391 CAGAATTGGGGGAGGGGGGCGGG - Intronic
1026876452 7:73881737-73881759 CAGAATCAGGGGAGGGGGGTGGG + Intergenic
1028713181 7:93934394-93934416 TTGAGTTAGGGGTGGGTGGAAGG - Intergenic
1028893306 7:96012962-96012984 GTGACTTGGGGAAGGGTGGATGG + Intronic
1029131368 7:98333732-98333754 CTTAGTTTGGGGAGGGTGGGCGG - Intronic
1030745850 7:113165572-113165594 CTGAATTGCGGGAGGGAGCAAGG + Intergenic
1032219135 7:129980789-129980811 CTGAGTTAGGGGTGGCTTGATGG - Intergenic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1032552167 7:132794215-132794237 CTGCATTAGTGGATGATGGATGG + Intronic
1032882240 7:136102146-136102168 CTGAATTATTGAAGGGTGGGTGG + Intergenic
1034376398 7:150648764-150648786 CTGAATGAGGGGAAGTTGAAGGG - Intergenic
1034990359 7:155544130-155544152 GTGAATTTGAGGAGGGTGGAAGG + Intergenic
1036181360 8:6588194-6588216 CTGGACTAGGAGAAGGTGGAGGG - Intronic
1036479308 8:9124098-9124120 CTGAATTAGGAAAGAGAGGAAGG + Intergenic
1036753333 8:11456767-11456789 CTGGATTAGGGGAGTGCGGCTGG + Intronic
1038179218 8:25210868-25210890 CTGAATGAGGGGAGGGGGAAGGG + Intronic
1040928024 8:52706243-52706265 CTGAAATAGGGAAGGCTGGTGGG - Intronic
1042391567 8:68241726-68241748 CAGAAAGATGGGAGGGTGGAAGG - Intergenic
1042735515 8:71983632-71983654 ATGAATTGGGGGTGGGGGGAGGG - Intronic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043594810 8:81872825-81872847 CTGAACTGGGGCAGGGTGGGTGG - Intergenic
1044031479 8:87242936-87242958 CTGAAAAAGGACAGGGTGGAGGG + Intronic
1046130103 8:109956117-109956139 CTGAGTGGGGGGAGGGGGGAGGG - Intergenic
1046892894 8:119442417-119442439 CTGAATTGGGGGTGGGAAGATGG + Intergenic
1047196173 8:122723579-122723601 GGGGATTAGGGGAAGGTGGAAGG - Intergenic
1047751217 8:127882156-127882178 CTCATTCAGGGGAGGGGGGATGG - Intergenic
1048167211 8:132073714-132073736 CTGAGTTAGAGAAGGATGGATGG - Intronic
1048192652 8:132304143-132304165 CTGAAAGGTGGGAGGGTGGAAGG + Intronic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048714783 8:137256282-137256304 ATGAATTAGGTGGAGGTGGATGG + Intergenic
1048989605 8:139753431-139753453 GTGAATAAAGGGAGGGAGGAAGG - Intronic
1049467588 8:142759121-142759143 CTGAATTCCAGGAGGGAGGAGGG - Intergenic
1051697216 9:19781368-19781390 ATGAAGTAGGGGAAGGTGGAAGG + Intronic
1052892335 9:33713644-33713666 CCAAATTGGGGGAGGGAGGAAGG - Intergenic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1053416728 9:37951629-37951651 CTGAGCTCAGGGAGGGTGGATGG - Intronic
1053533610 9:38905121-38905143 CTGAATGAGGGGAGCCTGGCAGG - Intergenic
1053791639 9:41690490-41690512 CTGATTTAGTAGAGGGTGAAGGG + Intergenic
1054153519 9:61624280-61624302 CTGATTTAGCAGAGGGTGAAGGG - Intergenic
1054180042 9:61902505-61902527 CTGATTTAGTAGAGGGTGAAGGG + Intergenic
1054205834 9:62129550-62129572 CTGAATGAGGGGAGCCTGGCAGG - Intergenic
1054632526 9:67458820-67458842 CTGAATGAGGGGAGCCTGGCAGG + Intergenic
1054657551 9:67678636-67678658 CTGATTTAGTAGAGGGTGAAGGG - Intergenic
1054771834 9:69090557-69090579 CTGGGTTGGGGGAGGGAGGAAGG + Intronic
1054851307 9:69849308-69849330 ATGAAGTAAGGGAGGGAGGAAGG + Intronic
1055067578 9:72134077-72134099 GTGAATTAGTGGAGGGAGTAGGG + Intronic
1055152583 9:73020465-73020487 CTGAGTTAGGGGATGGTTGAAGG + Intronic
1055535989 9:77245021-77245043 ATGAGTGAGGGGAGAGTGGAGGG + Intronic
1055960480 9:81815940-81815962 CTGAATTAGCAGTGGGTGGTGGG - Intergenic
1056695688 9:88848995-88849017 CTGAATTATGGATGGGTGGATGG + Intergenic
1056756687 9:89386170-89386192 CTGAATTGGGGAAGGCAGGAAGG - Intronic
1056838336 9:89976376-89976398 CTCTATTATGGGAGGGTGAAGGG - Intergenic
1059735159 9:117093125-117093147 CTGAAACATGGGAGAGTGGACGG - Intronic
1061777911 9:132978090-132978112 CTGAACTTGGGGAGGGAGGGAGG + Intronic
1062427061 9:136510929-136510951 CAAAATTAGGGGAGAGGGGATGG - Intronic
1062736005 9:138137733-138137755 CTTCATCAGGTGAGGGTGGAGGG + Intergenic
1185612794 X:1402447-1402469 CTGAATTTTGGGAGGGGGGAAGG - Intergenic
1185612892 X:1402785-1402807 CTGCATTTGGGGAGGGGGGAAGG - Intergenic
1186844950 X:13521528-13521550 GTGATTTAGGGGAGGGTTTAAGG + Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1187447419 X:19371834-19371856 CTGAAATAAGGGAGGGGGGCCGG + Intronic
1187671516 X:21670848-21670870 CCAAAAGAGGGGAGGGTGGAAGG - Intergenic
1188306751 X:28568587-28568609 ATGAATCAGGGAAAGGTGGAAGG - Intergenic
1189371302 X:40431660-40431682 CTCTATTAGGGCAGTGTGGAAGG + Intergenic
1189631629 X:42960398-42960420 AGAAATTTGGGGAGGGTGGAGGG + Intergenic
1190110739 X:47587480-47587502 GAGAAGTAGGGGAGGGAGGATGG - Intronic
1190128385 X:47725124-47725146 GTGAAGGAGAGGAGGGTGGAGGG - Intergenic
1190430828 X:50376403-50376425 GGGAATTTGGGGAGGGTAGAAGG + Intronic
1192076821 X:68007510-68007532 GTGATTTAAAGGAGGGTGGAAGG - Intergenic
1192187078 X:68954814-68954836 GTGGATCTGGGGAGGGTGGATGG - Intergenic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1192590683 X:72357045-72357067 TTGAACCAGGAGAGGGTGGAAGG + Intronic
1194734939 X:97501052-97501074 CTGAACTTGGGGAGGGGGAATGG - Intronic
1195162530 X:102184564-102184586 GTGAGTTGGGGGAGGGAGGAGGG + Intergenic
1198323478 X:135543035-135543057 CTGAGTTAGGGCAGTGGGGATGG - Intronic
1198805152 X:140486843-140486865 GTTCATTTGGGGAGGGTGGAAGG - Intergenic
1199435099 X:147804248-147804270 GTGAGTGAGGGGTGGGTGGAAGG + Intergenic
1201617623 Y:15919098-15919120 CTAAAATAGGGAAGGATGGAGGG + Intergenic