ID: 1032500081

View in Genome Browser
Species Human (GRCh38)
Location 7:132393451-132393473
Sequence TATGAACCTGGATTTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032500074_1032500081 19 Left 1032500074 7:132393409-132393431 CCTGGGTGTCAAACTAAGGAGTC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1032500081 7:132393451-132393473 TATGAACCTGGATTTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032500081 Original CRISPR TATGAACCTGGATTTGGGCA TGG Intronic
No off target data available for this crispr