ID: 1032505120

View in Genome Browser
Species Human (GRCh38)
Location 7:132428604-132428626
Sequence GGTTCCTGTGTCTGAGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032505120_1032505124 -7 Left 1032505120 7:132428604-132428626 CCTGCTACTCAGACACAGGAACC 0: 1
1: 0
2: 2
3: 18
4: 234
Right 1032505124 7:132428620-132428642 AGGAACCGTATGGGGCAGCCTGG No data
1032505120_1032505130 18 Left 1032505120 7:132428604-132428626 CCTGCTACTCAGACACAGGAACC 0: 1
1: 0
2: 2
3: 18
4: 234
Right 1032505130 7:132428645-132428667 CCCGGTGGTCCCCTCTGTCCCGG No data
1032505120_1032505127 3 Left 1032505120 7:132428604-132428626 CCTGCTACTCAGACACAGGAACC 0: 1
1: 0
2: 2
3: 18
4: 234
Right 1032505127 7:132428630-132428652 TGGGGCAGCCTGGCTCCCGGTGG 0: 1
1: 0
2: 3
3: 31
4: 299
1032505120_1032505126 0 Left 1032505120 7:132428604-132428626 CCTGCTACTCAGACACAGGAACC 0: 1
1: 0
2: 2
3: 18
4: 234
Right 1032505126 7:132428627-132428649 GTATGGGGCAGCCTGGCTCCCGG 0: 1
1: 0
2: 1
3: 24
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032505120 Original CRISPR GGTTCCTGTGTCTGAGTAGC AGG (reversed) Intronic