ID: 1032505736

View in Genome Browser
Species Human (GRCh38)
Location 7:132433345-132433367
Sequence TGCTGGGTATGTAGGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032505736_1032505748 29 Left 1032505736 7:132433345-132433367 CCTTCTACCCTACATACCCAGCA 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1032505748 7:132433397-132433419 TGCCAAACACAGGTGGCTGGAGG No data
1032505736_1032505747 26 Left 1032505736 7:132433345-132433367 CCTTCTACCCTACATACCCAGCA 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1032505747 7:132433394-132433416 TAGTGCCAAACACAGGTGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 187
1032505736_1032505746 22 Left 1032505736 7:132433345-132433367 CCTTCTACCCTACATACCCAGCA 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1032505746 7:132433390-132433412 TCATTAGTGCCAAACACAGGTGG No data
1032505736_1032505745 19 Left 1032505736 7:132433345-132433367 CCTTCTACCCTACATACCCAGCA 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1032505745 7:132433387-132433409 TGCTCATTAGTGCCAAACACAGG 0: 1
1: 0
2: 1
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032505736 Original CRISPR TGCTGGGTATGTAGGGTAGA AGG (reversed) Intronic
900668582 1:3834251-3834273 TACTCGGTATGAAGGGAAGATGG - Intronic
904857961 1:33514393-33514415 TGATGGGTATATGGCGTAGATGG + Exonic
908106936 1:60854888-60854910 TGCTGGGGAGGAGGGGTAGAAGG - Intergenic
911563170 1:99431052-99431074 TCCAGGGTATGTGGGGTAGGAGG + Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
914198608 1:145465014-145465036 TGCTGGGTAGTTCGGGTAGTTGG + Intergenic
914377329 1:147083968-147083990 TGCTGGGTAGTTCGGGTAGTTGG + Intergenic
914477715 1:148038149-148038171 TGCTGGGTAGTTCGGGTAGTTGG + Intergenic
914503026 1:148264219-148264241 TGCTGGGTAGTTCGGGTAGTTGG - Intergenic
915205000 1:154263556-154263578 TGCTGTGGATGAAGGGTGGAGGG + Intronic
915341368 1:155178649-155178671 TGCTGGGGAGGAAGGGAAGAAGG - Intronic
916243144 1:162659444-162659466 TGCTGGGCATGTGGAGTGGAGGG + Intronic
918507431 1:185272083-185272105 TTCTGGGTATGTAAGTTGGATGG - Intronic
920939551 1:210468780-210468802 TACTGGGATTGTTGGGTAGAAGG + Intronic
921465940 1:215487849-215487871 TGGTGGGGATTTAGAGTAGAAGG - Intergenic
922887648 1:229032142-229032164 TGGTGTGTATGTAGGGGAGTGGG - Intergenic
923284499 1:232479638-232479660 TGTTGGGCATGTAGGGAAGCAGG + Exonic
924373035 1:243375125-243375147 AGGTGGGTATGTAGGGTGGGTGG + Intronic
924435549 1:244037450-244037472 GGCTGGCTGTGGAGGGTAGAGGG + Intergenic
924716094 1:246575600-246575622 TAGTGGGTATGTAGGGCAGGGGG + Intronic
1065854674 10:29820787-29820809 TGCAGGGTATGAAGGGTTAACGG - Intergenic
1066269438 10:33808025-33808047 AACTGAGTATGTAGGGTAGGGGG - Intergenic
1066668960 10:37816851-37816873 TGCTGGGTAGGGAGGGTAAGAGG + Intronic
1068945959 10:62729133-62729155 TGCTGGGCTTGCAGGGAAGATGG - Intergenic
1071089936 10:81906484-81906506 TGCAGGGCATGTAGGTGAGACGG + Intronic
1071574635 10:86716447-86716469 TGCTGGGGATGGAGTGTAGGTGG - Exonic
1074444449 10:113507895-113507917 TGCAGGGGAGGTGGGGTAGAGGG - Intergenic
1077280257 11:1741423-1741445 TGCTGGGTGGGTAGAGGAGAGGG + Intronic
1078646220 11:13143195-13143217 TGCTGGGTCTATTGGGTAGAAGG + Intergenic
1080232507 11:30033806-30033828 ACCTGAGTATGGAGGGTAGAAGG + Intergenic
1081261083 11:40961866-40961888 TGCTGTGTGTTTAGGGTAGGGGG + Intronic
1081749547 11:45500118-45500140 TGTTGGGGATGTAGAGAAGATGG + Intergenic
1084719197 11:70893323-70893345 TGCTGGGTATGTGGTGGGGAGGG - Intronic
1087797381 11:102468768-102468790 TACTGGGAATGTAGGCTAGCAGG + Intronic
1087876925 11:103369786-103369808 TGCTGGTTATGCAGGGCACAAGG - Intronic
1089296864 11:117474620-117474642 TGCTGGGTAAGCAGGGTGTATGG - Intronic
1092598069 12:10029612-10029634 TGCTGAGTAGGTAGGGCACAGGG - Intergenic
1093620519 12:21283918-21283940 TGGTGAGTATGTAGAGTAAAGGG + Intronic
1102769054 12:115457519-115457541 TGCTGGGTATTTCAGCTAGAGGG - Intergenic
1102976493 12:117210464-117210486 TGCTGGGTATGTGGGGCAGCGGG + Exonic
1103254283 12:119527433-119527455 TGCTGGAAAAGTAGGGTGGAAGG + Intronic
1105304618 13:19159947-19159969 TGCAGGGCATGTAGGTTGGAGGG - Intergenic
1105323322 13:19347670-19347692 TGAGGGGAATGTAGGGTCGATGG + Intergenic
1106350015 13:28921216-28921238 TGCTGGGTATTTAGGGCCCAAGG + Intronic
1108394905 13:49982518-49982540 TGTGGGGTATGCAGGGAAGAAGG + Intergenic
1111118279 13:83811162-83811184 TGGTAGGTATGAAGGGCAGATGG - Intergenic
1111756200 13:92398835-92398857 TTCTGGGTATGTAGTCAAGAAGG - Intronic
1111900768 13:94197111-94197133 TGCTAGGACTGTAGGGAAGATGG + Intronic
1113638861 13:111943192-111943214 TGCTCGGTCTGCAGGGGAGAAGG + Intergenic
1114459681 14:22878480-22878502 TGGTGGGTGTGGAGGGTGGAGGG - Exonic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114755255 14:25252609-25252631 TGGTGTGTATGTAGGGCAGCTGG + Intergenic
1115588220 14:34836451-34836473 TACAGGGTATTTGGGGTAGAAGG + Intronic
1115755870 14:36525481-36525503 TGTTGGGGATGTGGGGGAGACGG - Intergenic
1116615947 14:47139202-47139224 TACTGGGTATATATGGTGGAAGG - Intronic
1116699435 14:48220930-48220952 TTCTTGTTATGTAGGGCAGATGG - Intergenic
1119895909 14:78219918-78219940 GGATGGGGATGGAGGGTAGAAGG + Intergenic
1121308934 14:92924257-92924279 TGCTGGGGATGAGGGGTAGGAGG + Intronic
1121538603 14:94708315-94708337 TGATGGGAATGTTGGGTAGTAGG + Intergenic
1125177567 15:36842246-36842268 TGCTGCTTATGAAGGGTTGAGGG - Intergenic
1126675460 15:51156400-51156422 TGCTGGGTCTGAAATGTAGAGGG + Intergenic
1127555255 15:60081436-60081458 TGCTGGGTTTAGATGGTAGATGG - Intergenic
1127794964 15:62429516-62429538 TGCTGGGTTTGTAGTTTAGCAGG + Intronic
1129670566 15:77605670-77605692 TGCTGGAAGTGTGGGGTAGATGG - Intergenic
1130108001 15:80943363-80943385 TGCTGGGAGTGTAGTGAAGAGGG - Intronic
1130535499 15:84782584-84782606 TGATGGGTGTGTAGTGAAGATGG + Intronic
1132512458 16:351163-351185 TGCTGAGTATCTCGGGTAGCCGG + Intronic
1132737761 16:1395534-1395556 TGCAGGGTATGGACGGTACAGGG - Intronic
1133242847 16:4425937-4425959 TGCCGGCTATATCGGGTAGAGGG + Exonic
1133514188 16:6491970-6491992 GGCTGGATATTTTGGGTAGATGG + Intronic
1135008802 16:18854574-18854596 TACTGTGTATGTATGGTATAAGG - Intronic
1135940438 16:26817468-26817490 TGCTGGGTTTGTAGGGATGGTGG - Intergenic
1136364661 16:29804233-29804255 TGCAGGGCATTTAGGGTGGAAGG + Intronic
1137062614 16:35805371-35805393 AGCTGGGTAAGTAAGGAAGAAGG - Intergenic
1137513770 16:49124797-49124819 TGCTGGGTAGGTAGGAGAGTGGG - Intergenic
1137714091 16:50587226-50587248 TTCTGATTTTGTAGGGTAGATGG + Intronic
1139722764 16:68870249-68870271 GGCTGGATATGTGGGGAAGAAGG + Intronic
1142406340 16:89892294-89892316 TGCTGGGGATGGAGGGTTGGGGG + Intronic
1142943329 17:3402230-3402252 TGCTGGGTGAGTTGGGCAGAAGG - Intergenic
1146079878 17:29769950-29769972 TGGTGGATCTGTAGGCTAGAAGG - Intronic
1148331338 17:46815598-46815620 GGCTGGGGCTGTAGGGTAGATGG - Intronic
1149383779 17:56121924-56121946 TGCTGGGGTTTTAGGGTAGCAGG + Intronic
1151506561 17:74531619-74531641 TGCAGGGTCTTTAGGGTAGGGGG + Intergenic
1153043120 18:832607-832629 TGATGGGCAGGTAGTGTAGACGG + Intergenic
1153923283 18:9810167-9810189 TGCTGGGTAGTCAGGGAAGAAGG + Intronic
1157204775 18:45688795-45688817 TGCTGGGTCTTCAGGATAGAAGG - Intergenic
1157602484 18:48902466-48902488 TGTTAGGTGTGTGGGGTAGATGG - Intergenic
1157639679 18:49202035-49202057 TGTTGGGTAAGAAGGGAAGATGG - Intronic
1158118958 18:54026875-54026897 TGCTGGGTTTGTAGGGAAGTAGG + Intergenic
1160176048 18:76595294-76595316 TGATGGATATATAGAGTAGAAGG + Intergenic
1162858302 19:13486904-13486926 GGCTGCGTGTGTAGGGAAGAAGG - Intronic
1164424410 19:28128198-28128220 TGCTGGGTGTGTGGGGAATAGGG - Intergenic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1166291969 19:41869209-41869231 AGATGGGTAAGCAGGGTAGAGGG + Exonic
1166345948 19:42165855-42165877 TGGTGGGTAGGTAAGGGAGAAGG + Intronic
926688438 2:15716410-15716432 TGCTGGGGATGTGGGGGAGCAGG + Intronic
928033276 2:27799210-27799232 TGATGGGTATGAAGTGTAGCTGG + Intronic
928879397 2:36080546-36080568 TGCTGGGTAAGTTGACTAGATGG + Intergenic
929620562 2:43350055-43350077 TGCTGGGAATGTACAGTATAGGG + Intronic
930687089 2:54321366-54321388 TGCTAGGTAGGTAGGGTAAATGG + Intergenic
933561913 2:83898187-83898209 TGCTGGTTATGTAGGGACCAAGG + Intergenic
934521329 2:95021971-95021993 GGATGGGGATGGAGGGTAGAGGG - Intergenic
934621743 2:95814409-95814431 TGCTGGCTGTGTGGGGTAGAGGG - Intergenic
934811704 2:97284404-97284426 TGCTGGCTGTGTGGGGTAGAGGG + Intergenic
934825987 2:97423536-97423558 TGCTGGCTGTGTGGGGTAGAGGG - Intergenic
935571178 2:104661253-104661275 TGGTGGGTAGGTAGGGAAGGGGG + Intergenic
936754324 2:115687460-115687482 TGCTGGCTTTGTAGGATGGATGG + Intronic
938094974 2:128455667-128455689 AGGTGGGTCTGCAGGGTAGATGG + Intergenic
939273180 2:139966440-139966462 TGTTGGGTGTTTAGGGTGGATGG - Intergenic
939897670 2:147811125-147811147 TGGTGGGAATGTGGGGTAGCAGG - Intergenic
940522869 2:154773450-154773472 TATTGGGTATGTAGGGTTTAGGG + Intronic
942099231 2:172562029-172562051 TGCTGGGAATGAATGGTAGAAGG - Intronic
942212662 2:173687277-173687299 TTCTGGGTATGTCTGGTAAATGG - Intergenic
944284444 2:197932515-197932537 TGCTGGGTTTGGGGGGTAGGGGG - Intronic
948642604 2:239385177-239385199 TGCTGGGGATGCTGGGGAGAGGG - Intronic
1178808513 21:35859756-35859778 TGGTGGGTATGTAGGGCTGTGGG - Intronic
1181083499 22:20428811-20428833 TGCTGGGGATGTAGGCAGGAGGG + Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184839367 22:47043572-47043594 TGCTGAGGACGTAGGGAAGATGG + Intronic
949359997 3:3221570-3221592 TGATGGGGATGAAGGGGAGAAGG - Intergenic
952540378 3:34361063-34361085 TGTTGGGTATGTTGGGCAGATGG + Intergenic
953980097 3:47409321-47409343 GGCTGGGTGAGCAGGGTAGAGGG + Intronic
955527692 3:59838131-59838153 TGCTAGTTATGAAGGCTAGAGGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957003629 3:74916968-74916990 TGGTGGGTGTGTAGGATTGAGGG + Intergenic
959670120 3:108967498-108967520 TGTGGGGTATGTGTGGTAGATGG - Intronic
965175705 3:165329134-165329156 TACTATGTATGTAGGGTATATGG + Intergenic
965254689 3:166390790-166390812 TGCTGTGGATGTAGGGGAAAAGG - Intergenic
967083064 3:186068583-186068605 TGTTGGGTGTGCAGTGTAGAAGG + Intronic
968603981 4:1522872-1522894 TGCTAGGGATGGAGGGCAGATGG - Intergenic
973938649 4:55879537-55879559 TGCAGGGTAGGGAGGGGAGATGG + Intronic
974808546 4:66915717-66915739 TGCTGGTTATGTAAGATTGAGGG - Intergenic
976226766 4:82800337-82800359 TGCTGGGTATGGGGAGCAGAGGG - Intergenic
980200088 4:129645421-129645443 TGCTGGAGATGGAGGATAGAGGG - Intergenic
986018012 5:3774989-3775011 GGATGGGTGTGTTGGGTAGATGG - Intergenic
989247894 5:39274326-39274348 TGTTGGGCACGTAGAGTAGATGG - Intronic
989460813 5:41696541-41696563 AACTGGGCATGTAGTGTAGAGGG + Intergenic
993935643 5:93998253-93998275 AGATGGGGATGTGGGGTAGAAGG + Intronic
994501535 5:100584845-100584867 TGCTTGATATGTATTGTAGATGG - Intronic
996695105 5:126385759-126385781 TACTGGGAAAGTAGAGTAGAAGG + Intronic
998103297 5:139451803-139451825 GGGTGGGTGTGTAGGGTATAGGG + Intronic
999820379 5:155222061-155222083 TACTGTGTGTGTATGGTAGAGGG - Intergenic
1000865514 5:166509371-166509393 TTCTGGAGATGTTGGGTAGATGG - Intergenic
1001295824 5:170498118-170498140 TCCTGGGGAGGTAGGGGAGAAGG + Intronic
1003981762 6:11396661-11396683 TGCTGGGTAGGTAGGATGGGTGG + Intergenic
1005157783 6:22826978-22827000 TGTTGGGAATGTAGGGTTGAAGG - Intergenic
1005497215 6:26398238-26398260 TGATGGGTAGGCAGGGTTGATGG - Intergenic
1005501991 6:26436740-26436762 TGATGGGTAGGCAGGGTTGATGG - Intergenic
1006314055 6:33279944-33279966 TGCTGGGGGTCTTGGGTAGAGGG - Intronic
1012363125 6:98407908-98407930 GGCTCGCTATTTAGGGTAGAGGG - Intergenic
1012976459 6:105785552-105785574 TGCTGGGTGTGAAGGGTGGCAGG - Intergenic
1020328185 7:6992531-6992553 TGCTGGTTAGGCCGGGTAGAGGG + Intergenic
1020897093 7:13953707-13953729 TGTGGGGGATGCAGGGTAGAAGG - Intronic
1021591789 7:22271699-22271721 TGTTGGGTAACTAGGGGAGAGGG - Intronic
1028437216 7:90817922-90817944 TGCTGGTTAGAAAGGGTAGATGG - Intronic
1032505736 7:132433345-132433367 TGCTGGGTATGTAGGGTAGAAGG - Intronic
1033882488 7:145902598-145902620 TGCTGGTTATTTAGGGTTGAAGG + Intergenic
1034470592 7:151252345-151252367 TGCTGGGGGTGTAGGGAAAAGGG - Intronic
1035399894 7:158557870-158557892 TGCTGGGAATGCTGGGAAGAGGG - Intronic
1037372438 8:18194282-18194304 TGATGTGTCTGTAGGGGAGAGGG + Intronic
1037556031 8:20023458-20023480 TGCTGGGTGTGTGGAGCAGATGG + Intergenic
1041113546 8:54510892-54510914 TGATATGTATGTAGAGTAGATGG + Intergenic
1042419756 8:68571990-68572012 TACTGTGTATGTAGGCTATAAGG + Intronic
1042578591 8:70250602-70250624 AGCTGGGTATGAAGGGTACATGG + Intronic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1044308565 8:90666168-90666190 TGCTGGGCATGGAGCGGAGACGG + Intronic
1047199315 8:122751326-122751348 AGCTGGGTATTAAGGATAGAAGG + Intergenic
1047463948 8:125094133-125094155 TATTGGGTATGAAGGGGAGAAGG + Intronic
1048220257 8:132534436-132534458 TGCTTGGTATGAAGCGTAGCTGG - Intergenic
1050687714 9:8190574-8190596 TCCTGGGCATGTAGTGTAGAGGG - Intergenic
1051444061 9:17121609-17121631 TAATGGCCATGTAGGGTAGAGGG + Intergenic
1052114409 9:24632286-24632308 TGGTGGGTATGTGGAGAAGAGGG - Intergenic
1054822117 9:69533159-69533181 TGCTGTGTATGTATGATGGAGGG + Intronic
1056204742 9:84309164-84309186 TGTTGGGTAGGGAGGGTAGATGG + Intronic
1056743462 9:89280067-89280089 AGCTGGGGTTGGAGGGTAGATGG - Intergenic
1057527115 9:95812660-95812682 TGCTGAGTATGCATGGGAGAAGG - Intergenic
1060294192 9:122332232-122332254 AGCTGGAGATGTAGGGGAGAGGG + Intergenic
1060510926 9:124231638-124231660 TGCTGGGAGTGAAGGGTAGATGG - Intergenic
1186192165 X:7076616-7076638 TGCAGGGTATGCAGTGGAGACGG - Intronic
1186619620 X:11224835-11224857 GGCTGTGTATGTTGGGAAGATGG + Intronic
1191250602 X:58258365-58258387 TGCTGAGTTTGTAGGGTACCTGG + Intergenic
1192848051 X:74925725-74925747 TGGTGGGGAAGAAGGGTAGAGGG - Intergenic
1193175140 X:78384075-78384097 TGCTGGTTATTCAGGGTACAAGG - Intergenic
1193603553 X:83538492-83538514 TGCTGGGGATGTAGGGATTAGGG - Intergenic
1194285713 X:92007820-92007842 TGCTGGTTATGCAGGGCCGAAGG + Intronic
1195656546 X:107336753-107336775 TGCTTGGTATGGAAGGAAGAGGG + Intergenic
1196613694 X:117743226-117743248 TCCTGGGTATGAAGCGAAGAGGG - Intergenic
1197404156 X:126029419-126029441 TGCTGGGGTTGCAGGGTAGGTGG + Intergenic
1197468924 X:126842383-126842405 TGATGGATATGGAGAGTAGAAGG + Intergenic
1197469003 X:126843752-126843774 TGGTGAGTATGTAGAGAAGAGGG + Intergenic
1199594171 X:149493584-149493606 TGCAGGGTAGGTAGGTGAGAAGG + Intronic
1199896088 X:152129273-152129295 TGTGGGGGATGTAGGGGAGATGG - Intergenic
1200401604 X:156023266-156023288 TGCGGGGTGTCTAGGGAAGAAGG - Intergenic