ID: 1032510257

View in Genome Browser
Species Human (GRCh38)
Location 7:132466607-132466629
Sequence CAAGATGCAAGGATGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 368}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032510243_1032510257 11 Left 1032510243 7:132466573-132466595 CCTTCACGCTGAGCCCCATTGGG 0: 1
1: 0
2: 1
3: 8
4: 106
Right 1032510257 7:132466607-132466629 CAAGATGCAAGGATGGAGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 368
1032510246_1032510257 -3 Left 1032510246 7:132466587-132466609 CCCATTGGGTCCAGCCCTCCCAA 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1032510257 7:132466607-132466629 CAAGATGCAAGGATGGAGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 368
1032510245_1032510257 -2 Left 1032510245 7:132466586-132466608 CCCCATTGGGTCCAGCCCTCCCA 0: 1
1: 0
2: 1
3: 12
4: 174
Right 1032510257 7:132466607-132466629 CAAGATGCAAGGATGGAGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 368
1032510247_1032510257 -4 Left 1032510247 7:132466588-132466610 CCATTGGGTCCAGCCCTCCCAAG 0: 1
1: 0
2: 1
3: 12
4: 199
Right 1032510257 7:132466607-132466629 CAAGATGCAAGGATGGAGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 368
1032510240_1032510257 13 Left 1032510240 7:132466571-132466593 CCCCTTCACGCTGAGCCCCATTG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1032510257 7:132466607-132466629 CAAGATGCAAGGATGGAGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 368
1032510239_1032510257 14 Left 1032510239 7:132466570-132466592 CCCCCTTCACGCTGAGCCCCATT 0: 1
1: 0
2: 1
3: 8
4: 151
Right 1032510257 7:132466607-132466629 CAAGATGCAAGGATGGAGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 368
1032510241_1032510257 12 Left 1032510241 7:132466572-132466594 CCCTTCACGCTGAGCCCCATTGG 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1032510257 7:132466607-132466629 CAAGATGCAAGGATGGAGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032510257 Original CRISPR CAAGATGCAAGGATGGAGGT GGG Intronic
902121189 1:14167424-14167446 CTAAATACAAGGATGGAGGCAGG + Intergenic
902398270 1:16144061-16144083 GAAGATGAAAGGCTGGAGGCAGG - Intronic
902691826 1:18114752-18114774 GAAGATGAAAGGATGGCAGTAGG + Intronic
903378755 1:22882760-22882782 CAAGATGAAAGGGTCGTGGTAGG - Intronic
903670267 1:25031243-25031265 AGAGATGGAAGGATGGAGGCTGG + Intergenic
903735035 1:25524467-25524489 CAAGAAGCAAGGTGGGAAGTGGG + Intergenic
904002314 1:27345718-27345740 CAAGAGGCAAGCCTGGAGGCAGG - Intronic
904772612 1:32888772-32888794 CAAGAGGCAGGGATGGCTGTTGG + Intronic
904904473 1:33884623-33884645 CAGGATGGAAGGATGGATGCAGG - Intronic
905234455 1:36536331-36536353 CATGTGGGAAGGATGGAGGTGGG + Intergenic
906267656 1:44445713-44445735 CAAGATGGAGGGATTGAGGCGGG - Intronic
906290921 1:44618751-44618773 CAGGAGGCAAGGGAGGAGGTCGG + Intronic
906725588 1:48041894-48041916 CAAGAAGGCAAGATGGAGGTTGG - Intergenic
907744411 1:57198620-57198642 GAAGATGCAGGGAGGGAGGGAGG - Intronic
907804317 1:57803064-57803086 CAAGCTGCATGGAGTGAGGTCGG - Intronic
908045799 1:60167172-60167194 ATAGATGCTTGGATGGAGGTAGG - Intergenic
908872863 1:68634657-68634679 CAACATGAAAGGAACGAGGTAGG + Intergenic
910295837 1:85644131-85644153 CAAAATAAAAGGATGGAGGAAGG + Intergenic
911090595 1:94014194-94014216 AAAGAAGGAAGGATGGAGGGAGG + Intronic
915031938 1:152887053-152887075 CAAGGGGCAGGGATGAAGGTTGG - Intergenic
915198571 1:154209165-154209187 CAAGATGAAAATGTGGAGGTTGG - Intronic
915812070 1:158923615-158923637 CAAGTTGGAATAATGGAGGTGGG - Intergenic
918302195 1:183214674-183214696 GGAGAGGCAAGGATGGAGGCAGG + Intronic
919572338 1:199264411-199264433 CAAGATGCAAGAGGGGAGGGAGG - Intergenic
920268351 1:204743730-204743752 CTAGAAGAAAGGATGGATGTGGG - Intergenic
921317335 1:213905079-213905101 CAAGAAGGAAGGAAGGAGGAAGG + Intergenic
923427031 1:233881269-233881291 CTAAATGCAGAGATGGAGGTGGG - Intergenic
923579133 1:235190751-235190773 CAAAATGAAAGTATGGGGGTGGG + Intronic
924202222 1:241672216-241672238 AAAGAGTCAAGGATGAAGGTGGG - Intronic
924423424 1:243930523-243930545 CAAGATTCAAAGGTGGAGGTTGG - Intergenic
924772154 1:247087964-247087986 CAAGAGGCCATCATGGAGGTTGG - Intergenic
1062943903 10:1445308-1445330 ACAGATGAAAGGATGGATGTAGG - Intronic
1063082758 10:2783799-2783821 GAAGAGGCAAGGATGGATGGTGG + Intergenic
1063293774 10:4780638-4780660 CAAGATACAAGGACTGAGGCTGG - Intergenic
1063688351 10:8259906-8259928 AAGGATGCAAGGAAGAAGGTAGG - Intergenic
1065695553 10:28376558-28376580 TTAAATGCAGGGATGGAGGTGGG - Intergenic
1066106961 10:32164942-32164964 CAAGATGGAATGAAGGAGGATGG - Intergenic
1067268612 10:44770088-44770110 TAAGCTGCTAGGATGGAGCTTGG + Intergenic
1068597001 10:58913145-58913167 AAAGATGCAAGGATGGAAAGAGG + Intergenic
1069572028 10:69500075-69500097 CTAGATGCAGGGATAGAGTTAGG + Intronic
1069884731 10:71616419-71616441 CAGGAGGGAAGGATGGTGGTGGG - Intronic
1069954955 10:72044379-72044401 CAAGAAGGAAGGAAGGAGGGAGG + Intergenic
1070393936 10:75995345-75995367 TGAGACTCAAGGATGGAGGTTGG - Intronic
1071505116 10:86227431-86227453 CAAGAGGCAAGGCTGGAGGCAGG - Intronic
1071735119 10:88290076-88290098 AAAGATGAAAGGAAAGAGGTAGG + Intronic
1072602599 10:96942956-96942978 TAAGATACAAGAGTGGAGGTAGG + Intronic
1073352511 10:102830119-102830141 CAGGAGGCCAGGAGGGAGGTTGG - Intergenic
1073830761 10:107380389-107380411 CTAGATGCAAAGATGGGTGTTGG + Intergenic
1074367866 10:112874622-112874644 CAAGATGCCATGGTGGTGGTGGG - Intergenic
1074655714 10:115585611-115585633 CAAAATAAAAGGATGGAGGAAGG - Intronic
1074816319 10:117143521-117143543 CAAGAAGCCTGGGTGGAGGTGGG - Intergenic
1075341408 10:121649344-121649366 CAGGATGGAAGGATGGAAGCTGG + Intergenic
1075536248 10:123274718-123274740 CAAAATGGATGGAGGGAGGTGGG + Intergenic
1076137105 10:128052695-128052717 TAACTTGCTAGGATGGAGGTAGG - Intronic
1076821409 10:132941842-132941864 CAAGGGGCCAGGATGGAGGATGG - Intronic
1077546101 11:3170708-3170730 CTGGAGGCAAGGAGGGAGGTTGG + Intergenic
1077782580 11:5347751-5347773 AAAGATGGAAGGAAGGAGGTAGG + Intronic
1078159566 11:8828900-8828922 TAAGATGAAAGGAAGGAGGGAGG + Intronic
1080782881 11:35447501-35447523 CAAAATAAAAGGATGGAGGAAGG - Intronic
1082938724 11:58680886-58680908 CAAAATACAGGGATGGAGGAAGG + Intronic
1083667407 11:64283451-64283473 CAAGATGGAAGGATGGACACTGG - Intronic
1084678404 11:70650351-70650373 AAAGGTGCAGGGATGGAGGGAGG + Intronic
1086420699 11:86634348-86634370 CAGGATGTCAGGAGGGAGGTTGG - Intronic
1087261543 11:96017802-96017824 CAAGAGGCAAGATTGGCGGTGGG + Intronic
1087508501 11:99059086-99059108 CAAGATGAAAGGAGGGAGAGAGG - Intronic
1087904747 11:103682559-103682581 CAAGAAGCACGGAAGGAGCTGGG + Intergenic
1088794947 11:113259998-113260020 TAAGAAGCAATGATGGGGGTGGG - Intronic
1089450632 11:118593475-118593497 CAAGGTGGTAGGATCGAGGTGGG - Intronic
1090551209 11:127821979-127822001 CAAGATTCCAGGAGGGAGGAGGG + Intergenic
1091021214 11:132101813-132101835 GAAGATGCAAGGTTGGAGTTAGG - Intronic
1091044970 11:132317278-132317300 TAAGATGAAACGATGGGGGTGGG + Intronic
1091208206 11:133834841-133834863 CATGTCGCAAGGATGGAGGAGGG - Intergenic
1091823822 12:3494583-3494605 AGAGATGCAGTGATGGAGGTGGG + Intronic
1091998611 12:5015320-5015342 CTAGGTGAAAGGATGGAGGGAGG + Intergenic
1092510976 12:9156359-9156381 CAAGATCCAGAGATGGAGGAAGG - Intronic
1093141618 12:15516530-15516552 AAAGATGAAAGGAGGGAGGGAGG + Intronic
1093561659 12:20549369-20549391 AAAGAGGCAATGATGGGGGTAGG - Intronic
1094272895 12:28636960-28636982 TAAGATGGAGGGATGGAGGTGGG + Intergenic
1094468501 12:30779877-30779899 CAAGCTCCAAGGATGTAGTTTGG + Intergenic
1095946426 12:47756353-47756375 CAAGAGGGAAGGAGGGAGGGAGG + Intronic
1095999420 12:48116270-48116292 GAAGATGGAAGGAAGGAGGTAGG - Intronic
1097582456 12:61474442-61474464 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1098603846 12:72365976-72365998 GAAGATGCAAAGATGGAGAAAGG - Intronic
1099683871 12:85861306-85861328 CAAGATATAAGGAAGGAGTTTGG + Intergenic
1100437486 12:94584854-94584876 CAAGAGGGAAGGATGGGGATAGG + Intronic
1100722207 12:97371055-97371077 TAAGATGAGAGGATGGAGGGGGG - Intergenic
1101634659 12:106528593-106528615 AGAAATGCAAAGATGGAGGTGGG + Intronic
1103162422 12:118740463-118740485 GAGGATGGAAGGATGGAGGTTGG + Intergenic
1103202239 12:119097217-119097239 AAAGATGCAAGGCTGGAGGTAGG + Intronic
1104744173 12:131200826-131200848 GAAGATGGAAAGAGGGAGGTGGG - Intergenic
1104790206 12:131476397-131476419 GAAGATGGAAAGAGGGAGGTGGG + Intergenic
1106414746 13:29537160-29537182 CAGGATGGAAGGGTGGGGGTGGG + Intronic
1106806434 13:33312468-33312490 CAAAATGAGAGGATGGGGGTGGG - Intronic
1108642485 13:52395674-52395696 GAAGAAGCAAGCAGGGAGGTGGG + Intronic
1109093686 13:58082827-58082849 GAAGATGTAAGAATGGAGGGTGG - Intergenic
1111332207 13:86774219-86774241 AAGGATGGAGGGATGGAGGTGGG + Intergenic
1112066605 13:95799750-95799772 CAAGATGCAAACAGGGAGGGGGG + Intergenic
1112401704 13:99084355-99084377 CAAAATGCAGGGAAGCAGGTGGG - Intronic
1112404198 13:99103646-99103668 CAAGAAGAAAGGAGGGAGGAGGG - Intergenic
1113448944 13:110392365-110392387 CAAGATGCAGGGAGAAAGGTGGG + Intronic
1113578942 13:111414464-111414486 CAAGATGGGAGCCTGGAGGTGGG - Intergenic
1114033586 14:18598385-18598407 AAAAATGCAAGGATGGGGCTGGG + Intergenic
1114078376 14:19177581-19177603 AAAAATGCAAGGATGGGGCTGGG + Intergenic
1114125113 14:19716966-19716988 AAAAATGCAAGGATGGGGCTGGG - Intergenic
1114576528 14:23719400-23719422 CAGGATGCCAGAATGGAGCTGGG + Intergenic
1114758818 14:25288800-25288822 CAAAAAGCAAGGTTGGAGGGAGG + Intergenic
1114791758 14:25667504-25667526 CAATATACAAGGAGTGAGGTTGG - Intergenic
1116575787 14:46573838-46573860 CAAGAAAAAAGGTTGGAGGTGGG + Intergenic
1117015718 14:51515043-51515065 CAAGTTTCTAGGATGGGGGTGGG - Intronic
1117171927 14:53109162-53109184 CAAGAGGAAAGGAAGGAAGTGGG - Intronic
1118130124 14:62953825-62953847 GAGGAAGCAAGAATGGAGGTGGG - Intronic
1120704155 14:87730141-87730163 CAAGATTCAAGAAAGGAGGCCGG + Intergenic
1120792003 14:88592840-88592862 CAACATACAAGGATGCAAGTTGG - Intronic
1120894138 14:89514736-89514758 CAAGATGCACAGATGGAGTGAGG - Intronic
1121497050 14:94399995-94400017 CAATTTCCACGGATGGAGGTTGG + Intergenic
1122497444 14:102168885-102168907 TAAGAGGCAAGGATAGAGGTGGG - Intronic
1126203428 15:46015188-46015210 CAAGATGCAAGGTGGGGGCTGGG + Intergenic
1126839940 15:52708131-52708153 CAAAATGAAGGGAAGGAGGTTGG + Intronic
1127857093 15:62961923-62961945 GTGGATGGAAGGATGGAGGTGGG - Intergenic
1128761409 15:70218487-70218509 CAAGATGGTAGGGTTGAGGTTGG - Intergenic
1128824286 15:70697233-70697255 CAAGATGCAAGGTAGGAAGAAGG + Intronic
1129701214 15:77769589-77769611 CTGGAGGCAAGGATGGAGGCAGG + Intronic
1130133205 15:81160729-81160751 GACGATGCAGGGATGGAGGAAGG - Intronic
1131559733 15:93429041-93429063 CAATAGACACGGATGGAGGTGGG + Intergenic
1132330701 15:101010485-101010507 CAAGAATCCAGGAGGGAGGTGGG - Exonic
1134428552 16:14178207-14178229 AAAGATGGAAGGATGGGAGTGGG + Intronic
1134501743 16:14774347-14774369 TAGGCAGCAAGGATGGAGGTGGG + Intronic
1134523362 16:14928273-14928295 CCAGCTGCAGGGCTGGAGGTGGG + Intronic
1134578820 16:15354532-15354554 TAGGCAGCAAGGATGGAGGTGGG - Intergenic
1134723767 16:16403015-16403037 TAGGCAGCAAGGATGGAGGTGGG + Intergenic
1134943662 16:18308855-18308877 TAGGCAGCAAGGATGGAGGTGGG - Intergenic
1135586142 16:23672581-23672603 CAAGAGGCAAGTGTGCAGGTGGG + Exonic
1136290187 16:29267102-29267124 TAAGATGCAAGGCTGGAGAGTGG + Intergenic
1137695452 16:50458970-50458992 TAAGAGGCAAGGATGGTGGTTGG + Intergenic
1137699202 16:50484301-50484323 CTAGATGGAAGACTGGAGGTTGG + Intergenic
1137701953 16:50503748-50503770 CCAGATGGAGGGATGGAGGAAGG - Intergenic
1141096831 16:81168714-81168736 GAAGATGAATGGATGGAGGATGG + Intergenic
1141196931 16:81867108-81867130 CCAGAGGAAAGGCTGGAGGTGGG + Intronic
1142096071 16:88240624-88240646 TAAGATGCAAGGCTGGAGAGTGG + Intergenic
1142661847 17:1435888-1435910 GAAGAAGAAAGGAAGGAGGTAGG + Intronic
1143255567 17:5555319-5555341 CAGGAAGAAAGGGTGGAGGTTGG - Intronic
1143617187 17:8059307-8059329 CAAGAGACAATGATGGTGGTTGG - Intergenic
1144044293 17:11440936-11440958 CAAGAGGAAAGGAGGGAGGAAGG + Intronic
1144237198 17:13272999-13273021 CAAGATGGGAGGATTAAGGTGGG - Intergenic
1144587695 17:16497827-16497849 GAGGAGGCAAGGCTGGAGGTGGG - Intergenic
1145016444 17:19401728-19401750 CAAGAAGGAAGGATAGAGGCAGG - Intergenic
1145225428 17:21124221-21124243 CAAGAGGCAAGCATGGGGATGGG + Intronic
1145928237 17:28664098-28664120 CAAGATGAAAGTTTGGAGGCAGG - Intronic
1146805828 17:35864470-35864492 GAAGAGGCAAGGATAGAGGAGGG - Intronic
1147959232 17:44155997-44156019 CAAGATCCTAGGAAGGTGGTGGG - Intronic
1148238815 17:45986557-45986579 CAAGATCCAAGGATGGGGGTGGG - Intronic
1149342111 17:55697982-55698004 CAACCTGCAAGGATGGAAGTGGG - Intergenic
1150221236 17:63497000-63497022 TAAGACCCAAGGCTGGAGGTGGG - Intronic
1150690800 17:67365648-67365670 CAAGAAACAAGGATGGAGAAAGG - Intronic
1153366870 18:4266191-4266213 CAAGAAGAAGTGATGGAGGTTGG - Intronic
1154177620 18:12094929-12094951 TACGATGCAAGGGTGGGGGTGGG + Intronic
1156718970 18:40046676-40046698 CAGGAGGTAAGGATAGAGGTGGG - Intergenic
1158626259 18:59074130-59074152 CAAGGGCCAGGGATGGAGGTAGG - Intergenic
1160230460 18:77044577-77044599 CCAGGTGCGAGGAGGGAGGTGGG - Intronic
1160863278 19:1246549-1246571 CAAGAGGCAGGGAGGGAGGTGGG + Intergenic
1161235581 19:3196511-3196533 CATGATGGAAGGAAGGAGATGGG - Intronic
1162828196 19:13267343-13267365 CCAGATGGAAGGATGGACATCGG - Intronic
1162860610 19:13504017-13504039 TAAGAGGAAAGGAAGGAGGTGGG - Intronic
1163212947 19:15854877-15854899 GAAGCTGAAAGGATGGAGGCAGG + Intergenic
1163284725 19:16339209-16339231 ACAGATGCAGGGAGGGAGGTTGG - Intergenic
1164751589 19:30659293-30659315 CAGGAGGAAAGGAGGGAGGTGGG + Intronic
1164867438 19:31616451-31616473 CAAGATGAAAATATGGAGTTCGG + Intergenic
1165375681 19:35440014-35440036 GAAGATGCACGGAGGGGGGTGGG + Intergenic
1165380009 19:35472565-35472587 CAAGAGGCAGGAATGGAGGGAGG - Intergenic
1167680520 19:50917311-50917333 CAAGATGGGAGGATGGCTGTGGG + Intergenic
1167686322 19:50958983-50959005 AGTGATGCAAGGATGGAGCTGGG + Exonic
1168060672 19:53890206-53890228 CAAGAAGCCAGGTTGGAGGCGGG - Intronic
1168241483 19:55091277-55091299 CCCGAGGCCAGGATGGAGGTGGG - Exonic
1168422523 19:56214039-56214061 CATGAGGGAAGGATGGTGGTTGG - Intergenic
1168424842 19:56231435-56231457 CATGAGGGAAGGATGGTGGTTGG - Intronic
925315457 2:2919433-2919455 CGGGATGCAGGGATGGATGTTGG - Intergenic
926037302 2:9645787-9645809 CATGATGCAGGGAGGGAGGAGGG - Intergenic
926680648 2:15661541-15661563 ATAGATGCATGGATGGAGGGAGG - Intergenic
927251534 2:20998989-20999011 CAAGAAGAAAGAATGGAGGCAGG - Intergenic
927749563 2:25655345-25655367 CTAGAAGCAATGAGGGAGGTAGG - Intronic
927848365 2:26483694-26483716 GTAGATGCCAGGATGGGGGTTGG - Intronic
928627296 2:33153406-33153428 CAGGATGAAAGGATGGAGTCAGG + Intronic
929705001 2:44201280-44201302 CAGCATGCAAGGATGGAGAGTGG + Exonic
931781449 2:65582345-65582367 CAAGAAGCCAGAATGGAGGCTGG - Intergenic
931969276 2:67567759-67567781 CAAGATCAAAGGAGAGAGGTTGG - Intergenic
932599595 2:73114279-73114301 CAAGATTGAGGGATGGAAGTGGG - Intronic
932961738 2:76420246-76420268 CAAGAGGGAGGGATGTAGGTGGG + Intergenic
933084795 2:78042692-78042714 CTAGATGGAAGGATGGGAGTGGG - Intergenic
933643056 2:84784979-84785001 GAATATGCAAGGATGGGGTTGGG - Intronic
933685307 2:85136601-85136623 CAAGATGTAGGTATGGGGGTGGG - Intronic
935208078 2:100913962-100913984 CAAGATGCATGGCTGTAGCTGGG - Intronic
936489487 2:112957952-112957974 GCATATGCAAGGCTGGAGGTTGG - Intergenic
937093152 2:119219955-119219977 AAAGATGCCAGGGTGGAGGGTGG - Intergenic
937104299 2:119295517-119295539 CAAGTGGCAGGGATGGAGGGTGG - Intergenic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
942123092 2:172797976-172797998 CAAGATACAAAGATGGAGAAAGG - Intronic
943048500 2:182887497-182887519 TAATGTGCAAGGAGGGAGGTTGG + Intergenic
943420024 2:187658459-187658481 GGAGATGCAAGAATGGAGGAGGG + Intergenic
944547177 2:200810680-200810702 CAGGATTCAAGGAGAGAGGTAGG + Intronic
945223577 2:207508965-207508987 GAAGATGGAAGGATGGATGTAGG + Intergenic
945546878 2:211165740-211165762 CAGGATGGAAGGAGGGAGGGAGG + Intergenic
946181631 2:217952613-217952635 CAAGCTGAAAGTCTGGAGGTTGG - Intronic
946234893 2:218318079-218318101 CACGGTGCAAAGATGGAGGCAGG + Intronic
946902236 2:224383768-224383790 CAAGAGGCAATGATGGCAGTTGG - Intronic
946986066 2:225274836-225274858 CAAGATGCAAGTCTTAAGGTTGG + Intergenic
947419392 2:229928575-229928597 CAATATTCAATGAGGGAGGTGGG - Intronic
947868922 2:233421629-233421651 AAGGAAGCAAGGAAGGAGGTGGG - Intronic
948646546 2:239408648-239408670 ATAGATGCAAGGTTGGTGGTAGG + Intergenic
948882783 2:240868957-240868979 CATGATGCGAGGAGGCAGGTTGG - Exonic
1169117426 20:3074838-3074860 CTAGATGCAGGGATAGATGTGGG - Intergenic
1169181464 20:3572404-3572426 CAGGATGAAAGGATGGAATTTGG + Intronic
1169291649 20:4358356-4358378 CTAGTAGCAAGGATGGGGGTAGG + Intergenic
1169940638 20:10933558-10933580 GCAGAGGCAAGCATGGAGGTTGG + Intergenic
1170023436 20:11862678-11862700 GAATATGCAAGGATGGAGGAAGG - Intergenic
1170149851 20:13218425-13218447 CTAGATACTGGGATGGAGGTGGG + Intergenic
1171823952 20:29878034-29878056 TGAGATGGAAGGATGGAGCTAGG - Intergenic
1171896125 20:30812303-30812325 TGAGATGGAAGGATGGAGCTAGG + Intergenic
1172055640 20:32152521-32152543 GAAGATGCAGAGATGGGGGTGGG - Intronic
1172303075 20:33863349-33863371 CCAGATGCAGGGCTGGGGGTGGG - Intergenic
1172783527 20:37451241-37451263 CAAGTTTAAAGGAAGGAGGTGGG - Intergenic
1172882445 20:38210851-38210873 CAACAGGCATGGATGGAGATGGG + Exonic
1172957379 20:38770804-38770826 CAACATGCACAAATGGAGGTGGG - Intronic
1173226188 20:41163638-41163660 CAAGATGGTAGGTTGGGGGTAGG - Intronic
1173228410 20:41175500-41175522 AAAGATCCAGGGATGGAGATGGG + Exonic
1173510700 20:43625864-43625886 CAAGGAGCAAGAATGGAGGTAGG + Intronic
1173746874 20:45444423-45444445 GAAGATGGAAGGAGGGAGGAAGG - Intergenic
1174701226 20:52611195-52611217 AAAGAAGGAAGGAGGGAGGTAGG - Intergenic
1175121946 20:56722513-56722535 GAGGTTGCAAGGATGGAGATGGG + Intergenic
1175934868 20:62509920-62509942 GAAGATGGAAGGGTGGAGGGTGG - Intergenic
1175983943 20:62755061-62755083 ATAGATGGAAGGATGGAGGGAGG - Intronic
1180148287 21:45934092-45934114 CAAGAGGGAAGCATGGGGGTGGG + Intronic
1180457702 22:15525444-15525466 AAAAATGCAAGGATGGGGCTGGG + Intergenic
1180791149 22:18576497-18576519 CAGGATGGAGGGATGGAGCTGGG - Intergenic
1180823555 22:18847991-18848013 CCAGCTGCAAGCATGGATGTGGG + Exonic
1181230589 22:21418817-21418839 CAGGATGGAGGGATGGAGCTGGG + Intronic
1181248061 22:21516052-21516074 CAGGATGGAGGGATGGAGCTGGG - Intergenic
1181440989 22:22935112-22935134 GGAGATGCAAGGAAGGAGGGTGG + Intergenic
1181821884 22:25482758-25482780 CAAGCTGTAAGGATGAAGCTTGG + Intergenic
1181846245 22:25711753-25711775 CAAGCTGCCAGCATGGGGGTAGG - Intronic
1183121643 22:35734603-35734625 TAAGGTGAAAGGTTGGAGGTAGG + Intergenic
1183167792 22:36160728-36160750 GCAGATGCACGGCTGGAGGTGGG - Exonic
949845201 3:8362643-8362665 CTAGATGGATGGATGGAGGATGG + Intergenic
949846341 3:8374168-8374190 CAAAATACAGGGATGGAGGAAGG + Intergenic
950850380 3:16056723-16056745 CATGATGCAAAAATGTAGGTAGG - Intergenic
951418742 3:22458047-22458069 AAAAATGGAAGGAAGGAGGTGGG + Intergenic
952746585 3:36787615-36787637 CAAGATGCAGGGGTGGGTGTGGG - Intergenic
952962000 3:38598177-38598199 CAGGAAACAAAGATGGAGGTGGG + Intronic
953875668 3:46665436-46665458 CTCCATGCAGGGATGGAGGTGGG - Intergenic
953902416 3:46850701-46850723 CATGATGGATGGATGGAGGGAGG + Intergenic
953906360 3:46870272-46870294 CAGGATGCAAGGAGAGAGGGTGG + Intronic
954331975 3:49895984-49896006 CAAGCTGCAGGGATGGGGGCAGG + Exonic
954556244 3:51519796-51519818 AAAGAGGCAAGGCTGGAGATGGG - Intergenic
959746870 3:109785808-109785830 CAAGATGCTTGGGTGCAGGTGGG + Intergenic
960166837 3:114411888-114411910 CCAGATGCAAGGTTGGTGCTAGG + Intronic
963637993 3:147823632-147823654 AAAGATGGAAGGGTGGAAGTAGG - Intergenic
963764056 3:149315586-149315608 AAAGATGTAAAGATGGAAGTAGG - Intergenic
964701503 3:159572970-159572992 CAAAATAAAAGGATGGAGGAAGG - Intronic
965313691 3:167163834-167163856 GAACATGCATGGGTGGAGGTGGG - Intergenic
965943113 3:174209277-174209299 TCAGAAGGAAGGATGGAGGTAGG - Intronic
967531154 3:190550023-190550045 AGAGATGCAAGGATGGAAGAGGG - Intronic
968134457 3:196211092-196211114 GAAGATGATAGGATGGAGGCAGG - Intronic
968758970 4:2432191-2432213 ATAGATGCAATGCTGGAGGTAGG - Intronic
968905852 4:3450168-3450190 CAGGACGCCAGGAAGGAGGTGGG - Intergenic
971251752 4:24978577-24978599 GAAGAGACAAGGATGGGGGTAGG + Intronic
971279354 4:25229804-25229826 GAGGAGGCAAGGATCGAGGTTGG - Intronic
971400397 4:26270472-26270494 AAAGATGAAAGGAGGGAGGAAGG + Intronic
974097094 4:57375291-57375313 AGAGAGGCAAGGATGGAAGTTGG + Intergenic
974410043 4:61528668-61528690 CCAGAGGCAAGGATGCAGATGGG + Intronic
976026132 4:80689826-80689848 CAAAATAAAAGGATGGAGGAAGG + Intronic
977393929 4:96448671-96448693 CAAAAGTCAAGAATGGAGGTTGG + Intergenic
978121841 4:105089429-105089451 CAAGATGTAAGGATTTAGGAAGG - Intergenic
978382272 4:108141858-108141880 GAACATGCAAAGATGGGGGTGGG + Intronic
978454040 4:108868485-108868507 CAAGAAGGAAGGAAGGAGGGAGG + Intronic
979562141 4:122112237-122112259 CAAAATAAAAGGATGGAGGAAGG + Intergenic
982330324 4:154175208-154175230 CCAGAGGTAAGGATGGAGGGAGG - Intergenic
982354747 4:154453659-154453681 AAAGAAGGAAGGAAGGAGGTTGG - Intronic
982950000 4:161682610-161682632 CAAGATGTGAACATGGAGGTGGG - Intronic
985530062 5:428990-429012 CAAGCTGCATGGCAGGAGGTGGG - Intronic
985932429 5:3069042-3069064 CAAAATGCAAGGACTTAGGTGGG - Intergenic
988481076 5:31631096-31631118 CACGAGGGAAGGAGGGAGGTGGG + Intergenic
989432969 5:41376572-41376594 CAAGAGCAAAGCATGGAGGTAGG - Intronic
989606562 5:43249528-43249550 GAAGATGGAAGGATGGACGAAGG + Intronic
989794262 5:45447169-45447191 CAAAATAAAAGGATGGAGGAAGG + Intronic
989797800 5:45497560-45497582 CAAAATAAAAGGATGGAGGAAGG - Intronic
989949673 5:50282361-50282383 CAAAATAAAAGGATGGAGGAAGG + Intergenic
990374493 5:55155745-55155767 CATGATGGAAGGAAGGGGGTGGG - Intronic
990630183 5:57660193-57660215 CAAGAGGAAAGGAAGGAGGGAGG - Intergenic
991292311 5:65044834-65044856 CAAGATTCAGTGATGGTGGTGGG - Intergenic
993323908 5:86510606-86510628 AAAGATGAAATGATGGAGGTCGG + Intergenic
993748097 5:91627395-91627417 AAAGTTGCAAGGATGGATCTAGG - Intergenic
993970737 5:94416980-94417002 CAAGATGCAAGGGAGGTGGAAGG - Intronic
995157732 5:108935269-108935291 CAAGAAGCTAGGATAGAGGCAGG - Intronic
995274896 5:110266919-110266941 CAGGAGGCAAGAATGGAGGGAGG - Intergenic
995298958 5:110555851-110555873 CAAAGTGAAAGGATGGAGGAAGG - Intronic
996069425 5:119117738-119117760 AGAGATGCAAGAATGGAGGAGGG + Intronic
996329239 5:122311655-122311677 CAAGAAGCAAGGAAGGGGGTGGG + Intronic
996907663 5:128619930-128619952 CAAGATGGAAGGGTGGAGAGTGG + Intronic
997401510 5:133606971-133606993 CAAGATCCAAGCCTGGAGCTTGG + Intronic
998111586 5:139506708-139506730 CCAGTTGCAAGCAAGGAGGTGGG - Intergenic
998451128 5:142235526-142235548 CAAGAGCCCAGGAGGGAGGTGGG + Intergenic
998602896 5:143603286-143603308 CAAAATCCAAGGATTGTGGTAGG - Intergenic
998821915 5:146064879-146064901 AAAGATGCAGGGAGGGAGGGAGG + Intronic
999008195 5:148005603-148005625 GGAGATGCAAGGATGGAAGATGG + Intergenic
1000345026 5:160307336-160307358 AAAGAAGCAAGGATGAGGGTGGG + Intronic
1002163931 5:177333032-177333054 CAGGAAGGGAGGATGGAGGTTGG - Intronic
1002375643 5:178787120-178787142 CAGGATGCTAGGATGCAGGCAGG + Intergenic
1004835944 6:19531696-19531718 CAAGAATCAAGGATGGGGGTCGG - Intergenic
1007418296 6:41704869-41704891 CAGAATGCAAGGCTGCAGGTGGG + Intronic
1007916902 6:45569523-45569545 CAAGAGGCCTGGATGGAGGGAGG + Intronic
1008704953 6:54146205-54146227 AAATATGCAAGAAAGGAGGTTGG - Intronic
1009297812 6:61976036-61976058 CAAGATGAAATCATAGAGGTAGG + Intronic
1009888309 6:69651283-69651305 AAAGATGAAAGGATAGAGGGAGG + Intergenic
1010151262 6:72735106-72735128 CAAGATGCAAGGCTTGCTGTTGG + Intronic
1010434871 6:75817347-75817369 CAAGAGGCAAGGGAGGAGGTGGG + Intronic
1010453626 6:76030283-76030305 GGGGATGCAAGGATGGAGGAGGG + Intronic
1013579379 6:111518081-111518103 CAAGTTGCAAGGATACAGCTCGG - Intergenic
1013773280 6:113650874-113650896 CAAGAAGGAAGGACGGAGTTGGG - Intergenic
1014057571 6:117034054-117034076 CAAGAAACAAGGATAGAAGTAGG + Intergenic
1014889059 6:126819595-126819617 AAAGAGGCCTGGATGGAGGTAGG - Intergenic
1015746369 6:136514062-136514084 TATGATGCATGGAGGGAGGTTGG - Intronic
1015858992 6:137656076-137656098 GGGGATGCAAGGATGGAGGAGGG + Intergenic
1016271472 6:142295202-142295224 GCAGCTGCAAGGATGGTGGTGGG - Intergenic
1017608462 6:156158347-156158369 CTAGAGACAAAGATGGAGGTAGG + Intergenic
1017798075 6:157865507-157865529 CAGCCTCCAAGGATGGAGGTGGG + Intronic
1018188554 6:161288772-161288794 CAAGATGGAAAGATTCAGGTGGG - Intergenic
1019327590 7:445941-445963 GAAGAGGAAAAGATGGAGGTGGG + Intergenic
1021280231 7:18708105-18708127 AAAGAGGTAAGGATGGATGTGGG + Intronic
1021947929 7:25745979-25746001 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1022467427 7:30661100-30661122 CAAAATCCCAGGCTGGAGGTAGG - Intronic
1022887495 7:34661579-34661601 CAGAATTCAAGGGTGGAGGTGGG - Intronic
1023082249 7:36536543-36536565 CAAGATCCAAAGATGGGGTTTGG + Intronic
1023752130 7:43382675-43382697 CCAGATGGAAGGATAGATGTGGG + Intronic
1024258905 7:47559570-47559592 CAAGAGGCAGGGATGGGGGCTGG + Intronic
1025636933 7:63329312-63329334 CAAGATGAAATTTTGGAGGTGGG + Intergenic
1025645762 7:63418790-63418812 CAAGATGAAATTTTGGAGGTGGG - Intergenic
1027220911 7:76213406-76213428 CAACATCCAATGATGTAGGTCGG + Intronic
1028907983 7:96176108-96176130 CAAGGTACAAGGAGGGAGTTTGG - Intronic
1029142957 7:98424630-98424652 CAGGATGGAAGGATGGAAGTTGG + Intergenic
1029708979 7:102289335-102289357 CAGGGGGCAAGGGTGGAGGTGGG + Intronic
1030282456 7:107791001-107791023 CAAGATGAACAGATTGAGGTGGG + Intronic
1031871653 7:127094569-127094591 CAAGAAGCAAGGACAGAGGCTGG + Intronic
1032440252 7:131937315-131937337 GCAGATGCTAGGATGGAGTTTGG + Intergenic
1032510257 7:132466607-132466629 CAAGATGCAAGGATGGAGGTGGG + Intronic
1032916757 7:136499050-136499072 CAGGATTCAAGGATGGGGGAAGG - Intergenic
1038957746 8:32485583-32485605 CAAGAAGGAAGGAAGGAAGTAGG + Intronic
1039549649 8:38433554-38433576 GAAGATGCAAGGACCGAGGCGGG - Intronic
1039662644 8:39483757-39483779 CAGGATGTAAGGATGGAGCCTGG - Intergenic
1039856467 8:41419265-41419287 CAAGAGGCTGAGATGGAGGTGGG - Intergenic
1040678526 8:49781432-49781454 CAAGAAGCAAAGAGGGTGGTTGG - Intergenic
1040914960 8:52559345-52559367 GTACATGCAAGGATGGAGGGAGG + Intronic
1041445609 8:57948353-57948375 AAAGAGGCAGGGGTGGAGGTGGG + Intergenic
1041706190 8:60848706-60848728 CAAGATGCAAAAAAGGAGATGGG - Intronic
1041713377 8:60912758-60912780 GAAGAAGAAAGGATGGGGGTGGG + Intergenic
1043332046 8:79129637-79129659 CAAGATGATGGGATAGAGGTTGG + Intergenic
1043882344 8:85559269-85559291 CATGTTTCAAGAATGGAGGTGGG - Intergenic
1045970782 8:108077503-108077525 CAAGATGAAAAGATGGGAGTGGG - Intronic
1046106274 8:109670856-109670878 CAAGAGGGAAGGAGGGAGGGAGG + Intronic
1046951256 8:120021846-120021868 CAAGATGCATGGATTGTGGCTGG + Intronic
1047034058 8:120915140-120915162 AAAGAGGCAAGGATAGAGGAAGG - Intergenic
1047756432 8:127922567-127922589 ATGAATGCAAGGATGGAGGTAGG - Intergenic
1047808973 8:128387128-128387150 CCAGAAGCTAGGATGGAGGCTGG - Intergenic
1048027245 8:130597976-130597998 CATCATGCCAGGATGGAGGGCGG - Intergenic
1049042496 8:140123278-140123300 CAAGATGCAAGCGTGGCAGTGGG - Intronic
1049474787 8:142791819-142791841 GAAGATGGATGGATGGAGGCTGG - Intergenic
1050068477 9:1786027-1786049 GAAGATGAAAGGGTGGAAGTAGG - Intergenic
1050136119 9:2466727-2466749 AAATATGCAAGGATGGGGTTGGG + Intergenic
1050478263 9:6063361-6063383 GAAGATGCAAGGCTGGGGGAGGG - Intergenic
1051931310 9:22389565-22389587 CAAGATGCAAATATGGAGAAAGG + Intergenic
1052775808 9:32731164-32731186 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1054337096 9:63817131-63817153 TGAGATGGAAGGATGGAGCTAGG - Intergenic
1054794445 9:69286761-69286783 TAACATGAAAGGATGGAGGTGGG + Intergenic
1054896192 9:70314166-70314188 TAAGATGGAAGGATGGAGTTTGG - Intronic
1055971021 9:81913219-81913241 CATGAAGAAAGGATGGAGTTGGG + Intergenic
1056408135 9:86296533-86296555 CTAGAGGAAAGGATGGGGGTAGG + Intronic
1057740449 9:97706664-97706686 CAAGATGCAAGGTTGGAAAATGG - Intergenic
1059624660 9:116049804-116049826 GTAGATGCCAGGGTGGAGGTAGG - Intergenic
1060827497 9:126695318-126695340 CAAGAGGCAGGGAGAGAGGTCGG - Intronic
1061498240 9:130987870-130987892 AAAGAGGCAGGGAAGGAGGTGGG + Intergenic
1203377033 Un_KI270442v1:384552-384574 TGAGATGGAAGGATGGAGCTAGG - Intergenic
1186593027 X:10951567-10951589 CAAGCTGCTAGGAGGGAGGGAGG - Intergenic
1186703569 X:12117761-12117783 CAAGTTGCATGGAGGGAGGGTGG - Intergenic
1187288976 X:17933664-17933686 CAAGATGAAATGATGGTTGTTGG + Intergenic
1187293039 X:17973605-17973627 CAAGAAGCAGGCATGCAGGTAGG + Intergenic
1188025355 X:25202549-25202571 GACGATGCCAGGATGGAGGGGGG + Intergenic
1189951062 X:46231266-46231288 CATTATTCAATGATGGAGGTGGG + Intergenic
1190282390 X:48939640-48939662 CCAGAGGCCAGGAAGGAGGTTGG - Intronic
1190504560 X:51113995-51114017 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1192182937 X:68927599-68927621 AAAGCTGCAAGGAAGCAGGTAGG + Intergenic
1192192239 X:68998150-68998172 CAAGAAGCAAGGGTGGAGGGGGG + Intergenic
1192926239 X:75758237-75758259 CAAACAGCAAAGATGGAGGTTGG - Intergenic
1194017059 X:88636060-88636082 TAATTTGCAAGGTTGGAGGTGGG + Intergenic
1196213354 X:113021439-113021461 CAAGATGGAAAGCTAGAGGTGGG - Intergenic
1199855531 X:151756151-151756173 AAAGAAGCAAGGAAGGAGGAGGG - Intergenic