ID: 1032511370

View in Genome Browser
Species Human (GRCh38)
Location 7:132475231-132475253
Sequence ATCCCAAGGAGGGCTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 426}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032511370_1032511379 4 Left 1032511370 7:132475231-132475253 CCCCTCCCAGCCCTCCTTGGGAT 0: 1
1: 0
2: 3
3: 52
4: 426
Right 1032511379 7:132475258-132475280 AGAATGGTTGCCGTGACCAGCGG No data
1032511370_1032511380 7 Left 1032511370 7:132475231-132475253 CCCCTCCCAGCCCTCCTTGGGAT 0: 1
1: 0
2: 3
3: 52
4: 426
Right 1032511380 7:132475261-132475283 ATGGTTGCCGTGACCAGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032511370 Original CRISPR ATCCCAAGGAGGGCTGGGAG GGG (reversed) Intronic
900191507 1:1354161-1354183 GTCCCCAGGAGGGCCGGGAGGGG + Intronic
900520319 1:3102233-3102255 CTCCCCAGCGGGGCTGGGAGGGG + Intronic
900529367 1:3145179-3145201 AACCCAAAGAGGGGTGGGGGCGG - Intronic
900887226 1:5423617-5423639 TTCCCCAGGTGGGGTGGGAGTGG + Intergenic
900968440 1:5975812-5975834 ATCCCGAGAAGGGCAGAGAGAGG + Intronic
901233915 1:7657223-7657245 ATCCCTAGGAAGGCTGGGTCAGG - Intronic
901275129 1:7985494-7985516 ATACCAATGAGGGCTGGGTGTGG + Exonic
901511211 1:9718920-9718942 GTCCCAGGGCCGGCTGGGAGGGG + Intronic
902124168 1:14194547-14194569 TCCCCAAGGACTGCTGGGAGAGG - Intergenic
903250590 1:22050629-22050651 ATCCAAAAGAGGGCTGGGTGCGG + Intergenic
903326872 1:22573862-22573884 ACACCCAGGAGGGCTGGGAAGGG + Intronic
903345114 1:22679590-22679612 ATCCCACTGAGAGATGGGAGAGG - Intergenic
903657768 1:24959495-24959517 CTCCCAGGGATGGCGGGGAGGGG + Intronic
903724251 1:25429441-25429463 TTCCCAGGAAGGGCTGGGCGCGG - Intronic
904360161 1:29965947-29965969 CTGCCAAGGAGGGCTCAGAGAGG + Intergenic
905212052 1:36381133-36381155 ATCCCAGCAAGGGCTGAGAGGGG - Intronic
905222968 1:36461541-36461563 ATCACAGGGAGGGCAAGGAGAGG + Intronic
906159235 1:43635445-43635467 ATAATAAGGAGGGCTGGGTGTGG + Intergenic
906673853 1:47679031-47679053 ATCCCAAGGACAGCTCTGAGAGG - Intergenic
907527748 1:55063659-55063681 AGGCCATGGAGGGCTGAGAGAGG - Exonic
907746664 1:57220352-57220374 ATTCCCAGGAGGGCTTGGTGGGG + Intronic
908606051 1:65797942-65797964 ATCCCAAGGAGGACTGAGAATGG - Intronic
908676297 1:66607912-66607934 GTTCCCAGGAGTGCTGGGAGAGG + Intronic
908804476 1:67916154-67916176 AGACTAAGGAGGGCTGGGTGCGG - Intergenic
910169146 1:84359175-84359197 AACCCAAGGAGGGGTGTGTGTGG + Intronic
912495847 1:110090708-110090730 ATCCCAAAGTGGCCTGGAAGAGG + Intergenic
913560149 1:120010273-120010295 ATTCCAAGGATGGCTGGAAATGG - Intronic
913637974 1:120783293-120783315 ATTCCAAGGATGGCTGGAAATGG + Intergenic
913995920 1:143651983-143652005 ATCCCTAGGAGGGCGGCGAAGGG + Intergenic
914086770 1:144461197-144461219 CGCCCAAGGAGGGCTGCGGGCGG + Intronic
914197229 1:145453854-145453876 ATCTCCAGCAGGGCTGTGAGGGG + Intergenic
914280737 1:146169692-146169714 ATTCCAAGGATGGCTGGAAATGG - Intronic
914393918 1:147246416-147246438 ATGCCTAGGAGTGCTGTGAGTGG + Intronic
914428732 1:147600599-147600621 GTCCCAAGCAGTGCTTGGAGAGG + Intronic
914541780 1:148620632-148620654 ATTCCAAGGATGGCTGGAAATGG - Intronic
914706512 1:150174471-150174493 ATCACAATGAAGGCTGGGCGTGG - Intergenic
914877780 1:151525104-151525126 GTCCCAAGGGGGACTGGGTGCGG + Intronic
915291630 1:154888090-154888112 ATCACAAGGAAGGCTCTGAGTGG - Intergenic
915602465 1:156930787-156930809 AGCCCAAGGTGAGATGGGAGGGG - Intronic
916889484 1:169102632-169102654 AAGACAAAGAGGGCTGGGAGAGG - Intergenic
917948561 1:180003724-180003746 AACCCATGGAAGACTGGGAGAGG + Intronic
918429226 1:184441129-184441151 ATGCCTAGGTGTGCTGGGAGTGG - Intronic
918780474 1:188693257-188693279 ATCTAAAAGAGGGCTGGGTGCGG - Intergenic
920789127 1:209071865-209071887 ATCCCAAGGAGAGGTGACAGAGG + Intergenic
922305578 1:224341121-224341143 CTCCCCACGAGGCCTGGGAGCGG + Intergenic
922489546 1:226004965-226004987 ATCTCAAAGAAGGCTGGGAGTGG - Intergenic
922733079 1:227962584-227962606 ATACAAAGGAGGTCTGGGCGCGG + Intergenic
923252032 1:232186358-232186380 GTCCCAAGGTGGACTGGGTGGGG - Intergenic
923350453 1:233100120-233100142 ATCACAATGAGGGCCGGGCGCGG + Intronic
1062816493 10:505025-505047 ATCCCTTGGAGGGCAGGGTGGGG - Intronic
1062927824 10:1330142-1330164 TTCCCAAGGAGGGCTGAGTCAGG + Intronic
1063105146 10:2986110-2986132 GTTCCAGGAAGGGCTGGGAGAGG - Intergenic
1065359689 10:24877988-24878010 TTCCCAAAGAGAGCTGGGTGTGG + Intronic
1066223094 10:33355331-33355353 ATGCCAAGGAGGGCAGGAAAGGG - Intergenic
1066756299 10:38716210-38716232 ATCCTAAGTAAGGCTGTGAGAGG + Intergenic
1067289249 10:44929457-44929479 ATCCTGAGGAGGGGGGGGAGTGG - Intronic
1067438054 10:46292625-46292647 AGCTCAGGGAGGGCTGGGAGAGG + Intronic
1067574858 10:47402762-47402784 AGCTCAGGCAGGGCTGGGAGAGG + Intergenic
1068866801 10:61903256-61903278 CTCCCGGGGAGGGCGGGGAGGGG + Intronic
1070308034 10:75251405-75251427 AGGCCAAGGAGGGGTGGGCGTGG + Intergenic
1070967382 10:80537927-80537949 AGCCCAGGCAGGGCTGGGACTGG + Exonic
1071173652 10:82898277-82898299 ATCCCAAGGAACACTGTGAGGGG - Intronic
1071480038 10:86058176-86058198 TTCCATAGGAGGGCTGGGGGAGG - Intronic
1071824124 10:89307546-89307568 AGCCCAAGGAGTTCTGGGAGAGG + Exonic
1071911886 10:90245749-90245771 AACCAAGGGAGGGCTGGAAGTGG + Intergenic
1072009373 10:91290251-91290273 AGCAGGAGGAGGGCTGGGAGAGG + Intergenic
1072751477 10:97983496-97983518 AACCCAATGAGGGGAGGGAGAGG - Intronic
1073047481 10:100648638-100648660 ATCCCAACATGGGCTGGGTGTGG - Intergenic
1073640665 10:105249589-105249611 ATGAGAATGAGGGCTGGGAGCGG + Intronic
1073727651 10:106252905-106252927 ATCACAAGGAGGACTGGCAGTGG + Intergenic
1074165795 10:110872454-110872476 TTCCCAGGGAGGGCAGGGGGCGG - Intronic
1074560314 10:114529734-114529756 ACCCGAAGGTGGGCTGGGCGTGG + Intronic
1074717083 10:116229576-116229598 CTCCTAAGGAGGGGTGGGAAGGG - Intronic
1075161429 10:120027994-120028016 AGCCCAGGGAGGAATGGGAGAGG + Intergenic
1075730950 10:124636581-124636603 ATCCCAGGGTGGGCGGGCAGGGG - Intronic
1076453918 10:130576152-130576174 AGGACAAGGAGAGCTGGGAGAGG - Intergenic
1076612536 10:131735708-131735730 ATCGCAAGGGGCCCTGGGAGAGG + Intergenic
1076760929 10:132605407-132605429 ATCCCCAGGAGGGATGGGAAAGG + Intronic
1077014290 11:393077-393099 AAGCCTAGGAGGGCTGGGGGTGG - Intronic
1077091542 11:780578-780600 AATCCAAGGATGGGTGGGAGAGG + Intronic
1077539700 11:3140741-3140763 ACCCCAAGGAGGACTAGGATGGG - Intronic
1078086680 11:8237678-8237700 CTCCCCACGAGGGCAGGGAGAGG + Intronic
1079284520 11:19117064-19117086 AGCCGATGGAGGGCTGGGATTGG + Intergenic
1080557275 11:33429260-33429282 ACCACAATGAGGGCTGGGAACGG - Intergenic
1081450538 11:43167222-43167244 ATCAGAAGGAGGACTGGTAGGGG + Intergenic
1081534103 11:43984937-43984959 ATGCCAGGGAGGGCTGGGGAAGG + Intergenic
1081760393 11:45572706-45572728 ATCCCAGGGAGTGCTGGGAAAGG - Intergenic
1083252789 11:61478981-61479003 TTCCCATGGGGGGCTGGGTGAGG + Intronic
1083292151 11:61696300-61696322 TTCCCATGGAGTCCTGGGAGCGG + Intronic
1083300471 11:61737424-61737446 GTCACATGGAGGTCTGGGAGTGG + Intronic
1083348079 11:62007856-62007878 ATCACAATGAGGGCTGGATGTGG + Intergenic
1083479458 11:62934243-62934265 AGCCCAGGAAGGGCAGGGAGGGG + Intergenic
1084009707 11:66340706-66340728 AGCCCAAAGAGGGGTGGGCGTGG + Intronic
1084434140 11:69128548-69128570 ACCACAATGAGGGCTGGGCGTGG + Intergenic
1084661302 11:70548122-70548144 TTCCCAAGGATGGCCGGCAGGGG + Intronic
1085053617 11:73392071-73392093 ATCCCCAGCATGGCGGGGAGTGG + Intronic
1085296437 11:75434277-75434299 GTCCAATGTAGGGCTGGGAGTGG - Intergenic
1085459051 11:76682158-76682180 ATACCGAGGAGGACTGGGAAAGG + Intergenic
1085464949 11:76716909-76716931 AGCCCAGAGAGGGCTGGGATTGG + Intergenic
1085859142 11:80211772-80211794 TTATCAAGAAGGGCTGGGAGTGG - Intergenic
1087565104 11:99845660-99845682 ATCCCAAGAAGGGCCGGGCGCGG - Intronic
1088671511 11:112145900-112145922 TTCCCTATGATGGCTGGGAGTGG - Intronic
1089392707 11:118113017-118113039 ACCTCAAGGAGGGCTGGGGAAGG - Intronic
1089474728 11:118749796-118749818 TTTCCAGGGAGGGGTGGGAGAGG - Exonic
1089631496 11:119787272-119787294 CCTCCCAGGAGGGCTGGGAGCGG - Intergenic
1090264366 11:125344728-125344750 ATTCCAAGGAGGACCCGGAGGGG + Intronic
1091045045 11:132317885-132317907 TCCCCCAGGAGGGCTGGGAAGGG + Intronic
1091298524 11:134490009-134490031 CTCCCAAGGCGGGGTAGGAGGGG - Intergenic
1091704026 12:2681626-2681648 AGCTCCAGGAGGACTGGGAGGGG - Intronic
1092203957 12:6604472-6604494 TTCCCAAGGGGGAATGGGAGGGG - Intronic
1092814467 12:12300984-12301006 CTCCCCAGGTGGTCTGGGAGAGG + Intergenic
1094017434 12:25880116-25880138 AGGCCAAGGAAGGCTGGGATGGG - Intergenic
1095970820 12:47901058-47901080 ACCCCAAGGCTGGCTGGGAGAGG - Intronic
1096181705 12:49554743-49554765 AGGCCAAGGAGAGCTGGCAGGGG - Intronic
1096829198 12:54301187-54301209 CTGAAAAGGAGGGCTGGGAGAGG - Intronic
1097266994 12:57751855-57751877 GCCCCAAGGAAGACTGGGAGCGG - Intronic
1097341638 12:58444879-58444901 ATCCCCAGGAGGGAGGGGAAGGG + Intergenic
1097980624 12:65734475-65734497 ATCCCAAGAGGGTCAGGGAGAGG + Intergenic
1097999428 12:65924069-65924091 TTCCCAAGGTGGGCTGGGGGTGG - Intronic
1100712847 12:97276068-97276090 ATGCCAATTAGGGCTGGGACTGG - Intergenic
1101430380 12:104621874-104621896 GTCCAAAGGAGGCCTGGGAGAGG + Intronic
1101618583 12:106361709-106361731 TTCTCAAGTAGGGCTGGGAATGG - Intronic
1102010764 12:109617062-109617084 ATCCAATGGGAGGCTGGGAGCGG - Intergenic
1102683144 12:114704111-114704133 TGCCCAAGGAGGGCTGGGCAGGG + Intergenic
1102788154 12:115620814-115620836 ATCCCAAGGAGGCCAGGCTGGGG + Intergenic
1103097656 12:118144886-118144908 ATGCCAAGGGGGGCAGGAAGAGG - Exonic
1103447507 12:121003907-121003929 CTCCCACGGAGGGCTGGCGGGGG - Exonic
1104894231 12:132153959-132153981 AGCCCAAGGAGGGCGGGGAGGGG - Intergenic
1104989647 12:132618609-132618631 GTCCCAGGTGGGGCTGGGAGCGG - Intergenic
1105211946 13:18262071-18262093 CTCCCCAGGAGGGCTGTCAGTGG - Intergenic
1105594841 13:21827693-21827715 ATCCCAAGGAGGTGTGGGAAGGG - Intergenic
1108761476 13:53570997-53571019 AGCCCATGGAGAGTTGGGAGTGG + Intergenic
1110304965 13:73975785-73975807 AGCCAAAGGAGGGTTAGGAGTGG - Intronic
1111724656 13:91991209-91991231 ATTACAAGGAGGGCTGTGAAAGG - Intronic
1111931297 13:94515611-94515633 ACCTCAAGAAGGGCTTGGAGTGG + Intergenic
1113289197 13:108886275-108886297 ACCCAAAGGAGGGCCGGGCGCGG - Intronic
1114464177 14:22909231-22909253 ATACCAAGAGGGGCTGGGCGTGG - Intronic
1116833146 14:49742377-49742399 TTCCCGGGGAGGGCTGGGCGTGG + Intronic
1117026152 14:51622120-51622142 ATCCCTGTGAGTGCTGGGAGTGG + Intronic
1117265919 14:54086614-54086636 ATCCCAAGGAGAGACAGGAGGGG - Intergenic
1117449843 14:55839741-55839763 AGCCCACGGAGGGCTGGGGGAGG - Intergenic
1118298035 14:64588338-64588360 ATCCCAGGTGGGGCTGGAAGGGG + Intronic
1118315169 14:64721703-64721725 ATCTCCAGGAGGGATGGGAGGGG + Intronic
1119069227 14:71564777-71564799 ATGCCAAGGATGGCCGGGCGTGG - Intronic
1119403675 14:74381988-74382010 ATCACAATGAGGGCCAGGAGTGG + Intergenic
1119967363 14:78931854-78931876 AAGCCAAGGAAGGCTGGGCGCGG + Intronic
1121029551 14:90646306-90646328 ATCCCCAGAACAGCTGGGAGGGG + Intronic
1121114957 14:91337049-91337071 ATTCCAAGGGGGGCTGGAAGTGG - Intronic
1121786184 14:96662941-96662963 ATCCCAGGGAGGAATGGGATAGG + Intergenic
1122028445 14:98894968-98894990 GTCCCAGGGAGGGCTGGCAGGGG + Intergenic
1122354461 14:101114671-101114693 TTCCCAGGGTGGTCTGGGAGTGG + Intergenic
1122625844 14:103085021-103085043 GGCCCAGGGAGGGCTAGGAGGGG - Intergenic
1202894311 14_KI270722v1_random:189534-189556 ATCCCAAAAGGGGCGGGGAGGGG - Intergenic
1123781773 15:23635564-23635586 ATCCCAAGGGAGGCCGGGCGCGG + Intergenic
1124830575 15:33145270-33145292 ATCCCAAGGAGAAGCGGGAGAGG - Intronic
1125017484 15:34950376-34950398 ATAGCAAAGAGGGCCGGGAGTGG - Intronic
1128604542 15:69027118-69027140 GTCCCAAGGACAGCTAGGAGAGG - Intronic
1128775571 15:70317547-70317569 AGCCCAAGGATGGCTGGGTGGGG - Intergenic
1129018438 15:72490698-72490720 ATGACAAGCAGGGATGGGAGAGG + Intronic
1129411318 15:75352059-75352081 ATCCCATGGAGGGTGGGGATGGG + Intronic
1129964405 15:79721205-79721227 ATCCCAAAGAACCCTGGGAGTGG + Intergenic
1131765552 15:95671944-95671966 ATTGCAAGGGAGGCTGGGAGAGG - Intergenic
1132460431 16:51052-51074 ATCCCCAGGTGTCCTGGGAGGGG - Intronic
1133240771 16:4413052-4413074 ATGGCCAGGAGGGCTGGGAGGGG - Intronic
1133324748 16:4936155-4936177 TTCCCAGGGCGGCCTGGGAGGGG - Intronic
1133704824 16:8343683-8343705 ATGCCAGGAAGGGCTGGGTGTGG - Intergenic
1133753815 16:8746261-8746283 AGCCAAAGAAGGGCTGGGCGCGG + Intronic
1133983877 16:10653238-10653260 CTCCCAGGCAGGGCTGGGCGGGG - Intronic
1134264047 16:12677346-12677368 ATTCCAAGGTTGGCTGGGCGCGG + Intronic
1135643772 16:24143519-24143541 CTCCCTAGCAGGGATGGGAGAGG + Intronic
1136135199 16:28252150-28252172 ATCCCAATGCTGGCTGGGTGTGG - Intergenic
1136375408 16:29862553-29862575 ACCCCAAGGCTGGCTGAGAGGGG + Intronic
1136726376 16:32360658-32360680 ATCCTAAGTAAGGCTGTGAGAGG - Intergenic
1136844621 16:33566171-33566193 ATCCTAAGTAAGGCTGTGAGAGG - Intergenic
1137277710 16:46947491-46947513 ACCACAAGGAGGGCCGGGCGCGG - Intergenic
1138989752 16:62376829-62376851 ATCCCAAGGGAGGCTGAGATAGG - Intergenic
1139572451 16:67821639-67821661 AGACCCAGGAGAGCTGGGAGAGG - Intronic
1140976312 16:80063169-80063191 ATCCCGCAGAGGGCTGGGCGTGG + Intergenic
1141619897 16:85231642-85231664 CTCCTAAGGAAGGCAGGGAGAGG - Intergenic
1142149106 16:88504947-88504969 ATAGCAAGGAGGGCAGGGTGGGG - Intronic
1142161807 16:88561743-88561765 ACCCCAAGGAGGCCGGGGAAAGG - Intergenic
1142230813 16:88899498-88899520 ACCCCAAGGCGGGCTGGGAGTGG + Intronic
1142319786 16:89373745-89373767 ATCCCAGGTAGGTGTGGGAGGGG - Intronic
1203000057 16_KI270728v1_random:157099-157121 ATCCTAAGTAAGGCTGTGAGAGG + Intergenic
1203131657 16_KI270728v1_random:1693500-1693522 ATCCTAAGTAAGGCTGTGAGAGG + Intergenic
1203154789 16_KI270728v1_random:1866469-1866491 ATCCTAAGTAAGGCTGTGAGAGG - Intergenic
1142506196 17:364772-364794 AGACCAGGGAGGGCCGGGAGTGG - Intronic
1142630185 17:1220668-1220690 ATTGCAAGGAGGGTGGGGAGTGG - Intronic
1142681206 17:1549963-1549985 AAACCAAGGACGGCTGGGCGCGG - Intronic
1143141360 17:4743585-4743607 ATTCCATTGAGGGCTGGGAAAGG - Intronic
1143175500 17:4952750-4952772 ATCACAGGGATGGCTGGGCGCGG - Intronic
1143239323 17:5430549-5430571 AACCTAATGAGGGCTGGCAGAGG + Intronic
1143566760 17:7726591-7726613 ACACCAAAGAGGGCTGGGCGCGG - Intronic
1143626290 17:8111989-8112011 CTCCCTGGGAGGGCTGGGAGAGG + Intronic
1143651964 17:8268861-8268883 GGCCCAAGGAAGGCTGGGGGAGG + Intronic
1144669791 17:17126529-17126551 ATCCCAGGGAGGACAGGGACAGG - Intronic
1145415089 17:22708283-22708305 ATGCAAAGGAGGGATGGGGGAGG - Intergenic
1146158054 17:30540853-30540875 ATGCCAAGTATGGCTGGGCGCGG - Intergenic
1146652187 17:34613722-34613744 TACCCATGGAGGGCTGGGGGAGG - Intronic
1146675639 17:34772142-34772164 CTGCCAAGGAGGGCTGGGGTTGG + Intergenic
1146957754 17:36946684-36946706 AGCCCTTGGAGGGCAGGGAGAGG + Intergenic
1147114979 17:38292369-38292391 AGCCCGAAGAGGGCTGGGTGTGG - Intergenic
1148098282 17:45070158-45070180 ATCCCAGGGAGGGCCGAGGGTGG + Intronic
1148133885 17:45279415-45279437 ATACCAAAGAAGGCTGGGTGTGG - Intronic
1148414638 17:47496841-47496863 AGCCCGAAGAGGGCTGGGTGTGG + Intergenic
1148559406 17:48597379-48597401 AACCCTACCAGGGCTGGGAGAGG + Intronic
1149627285 17:58088821-58088843 ATCCCAGGGTGGGCTAGGGGTGG + Intronic
1149768985 17:59305078-59305100 ACACCAAGGATGGCTTGGAGTGG - Intergenic
1150281340 17:63931186-63931208 ATCCTAAGGAGGCCTGGGGATGG + Intronic
1151191268 17:72399802-72399824 ACCCCCAGGGTGGCTGGGAGGGG - Intergenic
1151572306 17:74932917-74932939 AGCTCAAGGAGGGCTGGGGTGGG + Intronic
1151671440 17:75573670-75573692 ATCTCAGAGAGGGCAGGGAGGGG - Intronic
1151911913 17:77088943-77088965 ATCGCAAGTAGGGCTTGGACGGG + Exonic
1152180982 17:78821726-78821748 ATTCCCACGAGGGCTGGGTGTGG - Intronic
1152774622 17:82193251-82193273 ATCCAAAGCAAGGCTGGGTGTGG + Intronic
1152782746 17:82233430-82233452 GTGTCAAGGAGGGCTGGCAGAGG - Intronic
1152804098 17:82346890-82346912 CTCCCCAGGAGGGCTCCGAGGGG + Intergenic
1153933282 18:9897830-9897852 ATCCAAAGGATGGCTGGGTGCGG + Intergenic
1153984417 18:10340149-10340171 TTCCCATGGAAGGCTGGGAACGG - Intergenic
1157465555 18:47941714-47941736 ATGCCAAGGAAGGCTGGGTGTGG + Intergenic
1157496550 18:48161270-48161292 TTCTCCAGGAGGGCTGGGAGTGG + Intronic
1157609799 18:48949374-48949396 CCGCCAAGGAAGGCTGGGAGAGG - Intronic
1158131193 18:54154165-54154187 ATACCAAGGAAGGGAGGGAGTGG - Exonic
1158255145 18:55537851-55537873 GTCCCATAGAAGGCTGGGAGGGG - Intronic
1158868739 18:61663412-61663434 ATTCCCAGGATGGCTAGGAGAGG - Intergenic
1160665451 19:326007-326029 ACCCCAGGGTGGGCTGGGACCGG - Intronic
1160877187 19:1302194-1302216 AGCCCACCTAGGGCTGGGAGGGG + Intergenic
1161725507 19:5926176-5926198 ATCCTCACGAGGCCTGGGAGGGG + Intronic
1161738108 19:6004154-6004176 TCCCCAACGATGGCTGGGAGGGG - Intronic
1161918083 19:7245224-7245246 AACCCATTGAGGGCTGGGCGCGG - Intronic
1162394633 19:10409820-10409842 AACACAAGCAGGGCTGGGAGCGG + Intronic
1162757396 19:12868397-12868419 ATCCCAAATTGGGCTGGGTGTGG - Intronic
1162936956 19:13986205-13986227 AGCTCAAGGTGGGCAGGGAGTGG + Intronic
1163656128 19:18546117-18546139 ATCACCTGGAGGGCTGGGTGCGG + Intergenic
1163864679 19:19762854-19762876 ATCCAAGGGTAGGCTGGGAGAGG + Intergenic
1164576179 19:29406824-29406846 ACCCCAGGGAGGGCCGTGAGTGG - Intergenic
1165331859 19:35144628-35144650 ATCCGAAGCAGGGCGGGGGGTGG + Intronic
1165422257 19:35728040-35728062 TTCCCCAGGAGAGCTGGCAGGGG - Intronic
1166001196 19:39878315-39878337 ATCCCACCGGGGGCTGGGAGAGG + Intronic
1166003978 19:39894574-39894596 ATCCCACCGGGGGCTGGGAGAGG + Intronic
1166140092 19:40800784-40800806 GTCCCGAAGAGGGCTGGCAGTGG - Exonic
1166655281 19:44606656-44606678 ATCCCAAGGTTGGCTGGGCGCGG + Intergenic
1166867397 19:45848197-45848219 ATCCCCATGAGGGCAGGGCGAGG - Intronic
1167116460 19:47491884-47491906 ATCCAAAGGCTGGCTGGCAGGGG + Intronic
1167224067 19:48225041-48225063 AGCACAAGGAGGGCCGGGTGCGG - Intronic
1167374379 19:49103280-49103302 ATCTCAAGGAGGCCTTAGAGTGG - Intronic
1167636654 19:50659558-50659580 CTTCCAAGGGGGGGTGGGAGGGG - Intronic
1168323791 19:55526459-55526481 AGGCCAAGGAGGGCGCGGAGAGG + Intergenic
925262312 2:2539517-2539539 GTTCCCAGGAGAGCTGGGAGGGG - Intergenic
925469171 2:4140455-4140477 CTCCCAGGGAGGGCAGGGAGAGG - Intergenic
926064094 2:9823371-9823393 AGTCCAAGGACGGCTGGGTGCGG + Intergenic
926293761 2:11552409-11552431 ATCCCAAGGAGGCCTTTGATAGG + Intronic
926348154 2:11968370-11968392 ATCCCCAGGAGGCCTGGGGGTGG + Intergenic
927489712 2:23513010-23513032 ATGCCAAGGATGGCTGACAGTGG - Intronic
927613125 2:24562520-24562542 ACCCCTAGTAGGGCTGGAAGAGG + Intronic
927903447 2:26840271-26840293 ATGCCAAAAAGGGATGGGAGAGG + Intergenic
928167644 2:28982337-28982359 TTCCTCAGGAGCGCTGGGAGGGG + Intronic
930013195 2:46953571-46953593 ATGAGAAGGAGAGCTGGGAGAGG + Intronic
930068414 2:47345448-47345470 ATCCAAAGGAGAAGTGGGAGGGG - Intronic
931693225 2:64852837-64852859 ATCCCTGGCAGGGCTGTGAGAGG + Intergenic
932698445 2:73976665-73976687 ATCCCTCGTAGAGCTGGGAGAGG - Intergenic
933802586 2:85975024-85975046 AGCCCAAATAGGGCTGAGAGTGG - Intergenic
934319596 2:91960458-91960480 ATCCTAAGTAAGGCTGTGAGAGG + Intergenic
936623043 2:114120003-114120025 TTCCCAAGGAGGAGTGGCAGGGG + Intergenic
937871496 2:126789352-126789374 AAGCCAAGGAGTGCTGTGAGGGG - Intergenic
939500666 2:142979655-142979677 ATACCCAGGAGGGCTGGGTATGG + Intronic
940321532 2:152382478-152382500 ATCTCAAGAAGGGCTGAGAGAGG + Intronic
940849921 2:158678442-158678464 GTGCCAATGCGGGCTGGGAGAGG - Intronic
940875432 2:158893120-158893142 AGCCCAAGGAGGGATGGGGTGGG + Intergenic
942317562 2:174709650-174709672 AGCCCATGGTGGGCGGGGAGGGG + Intergenic
942349814 2:175040209-175040231 ATTCCCAGGATGACTGGGAGTGG + Intergenic
943171401 2:184405794-184405816 ATCACAATGAGGGCTGGGCATGG + Intergenic
944488778 2:200235399-200235421 AAGTCAAGGAGGGCTGGGTGTGG - Intergenic
944688797 2:202140878-202140900 ATCCCAAGGAAGGGAGGGAGGGG - Intronic
945583342 2:211624929-211624951 ATCACAGGGGGGGCTGGGTGTGG + Intronic
945977198 2:216280195-216280217 ACTCACAGGAGGGCTGGGAGGGG + Intronic
946217872 2:218199707-218199729 TAGCCAAGGTGGGCTGGGAGTGG + Intergenic
946327220 2:218990895-218990917 AGCCCATGGAGGGCAGGGATGGG + Exonic
948514708 2:238496853-238496875 AGGGCAAGGAGGGCTGGGCGGGG + Intergenic
1170066424 20:12315670-12315692 ATCCACAGCAGGGCTGGGAGAGG - Intergenic
1170128863 20:12997217-12997239 ATCCTTAGGAAAGCTGGGAGTGG + Intergenic
1170605677 20:17873789-17873811 CTTCCAGGGAGGGGTGGGAGTGG - Intergenic
1172092782 20:32445870-32445892 CCCCCAAGGAGGGATGGGGGGGG - Exonic
1172137517 20:32697275-32697297 AACCCAAGCAGGGCTGGGTGTGG + Intergenic
1172173327 20:32957800-32957822 TTTCCAAGAAGAGCTGGGAGTGG - Intronic
1174254789 20:49246465-49246487 TGCCCAAGGAGGGCAGGGAGGGG + Exonic
1174454807 20:50641624-50641646 ATTCCCAGGATGGCTGGAAGGGG - Intronic
1174471991 20:50768104-50768126 ATTCTCAGGAGGGCTGGAAGGGG + Intergenic
1174521748 20:51136760-51136782 ATCTCATGGTGGGCTGGGCGTGG + Intergenic
1175231938 20:57479398-57479420 CTGCTAAGGAGGGCTGGGACAGG + Intergenic
1175867394 20:62186817-62186839 ATCCCAGGGAAGGCTGGGCACGG - Intronic
1176102600 20:63371364-63371386 ATCCCCACCAGGGCTGGGACAGG - Intronic
1176205497 20:63885935-63885957 TCCCCGAGGAGGGCTGTGAGTGG + Intronic
1176236578 20:64056389-64056411 ATCCAAGGGAGGCCTGGGTGGGG + Intronic
1177076695 21:16584399-16584421 TTCCTAACCAGGGCTGGGAGTGG + Intergenic
1178540099 21:33442244-33442266 GTCTCAAGGGAGGCTGGGAGTGG - Intronic
1179577772 21:42318407-42318429 CTCCCAAGGAGGAAAGGGAGAGG - Intergenic
1179849711 21:44131333-44131355 ATCCCCAAGAGGTCAGGGAGAGG - Intergenic
1180003133 21:45004134-45004156 AGCCACAGAAGGGCTGGGAGCGG + Intergenic
1180307846 22:11144503-11144525 ATCCTAAGTAAGGCTGTGAGAGG + Intergenic
1180546322 22:16506316-16506338 ATCCTAAGTAAGGCTGTGAGAGG + Intergenic
1180932025 22:19598668-19598690 ATCCCAGGAAGGGCGGGGTGAGG + Intergenic
1181132800 22:20743432-20743454 ATAGTAAGGAGGGCTGGGTGTGG - Intronic
1181510930 22:23388439-23388461 ATCACAGGGAGGGGTGAGAGGGG + Intergenic
1181516106 22:23414746-23414768 AGCCCAAGGAGGTCCTGGAGGGG + Intergenic
1182458220 22:30466108-30466130 ATCCCTGGGAGAGCTGGGACTGG + Intronic
1182487748 22:30649479-30649501 AGCCCACGGCGGGGTGGGAGTGG + Intronic
1182578398 22:31289464-31289486 ATCCCAACGAGGGCAGGGGTGGG + Intronic
1183472337 22:38016356-38016378 ATCCCAGGGACGGCTGGTGGAGG - Intronic
1184149735 22:42631115-42631137 ATCCCCGGGAGGGGTGGGAGGGG - Intronic
1184521796 22:44998933-44998955 ATCCTGAAGAGGGATGGGAGGGG - Intronic
1184685925 22:46096335-46096357 CGCCCACTGAGGGCTGGGAGGGG - Intronic
1184710453 22:46246560-46246582 AACCCAAGGACGGATGGAAGTGG - Intronic
1184961278 22:47930619-47930641 ATACAGAAGAGGGCTGGGAGGGG + Intergenic
1185416745 22:50714795-50714817 AGCTCAAGGAGGGAGGGGAGCGG + Intergenic
949322029 3:2822034-2822056 ATACGAAGGAGAGGTGGGAGAGG + Intronic
949896402 3:8769943-8769965 ATTCTAAGCAGTGCTGGGAGAGG + Intronic
950316624 3:12006378-12006400 ATTCTAAGGAGGGCTGCCAGTGG - Intronic
951565684 3:24010700-24010722 ATACCCAGGAGGGCCGGGCGTGG + Intergenic
952331534 3:32368026-32368048 ATCCCAAGCAAGCCTTGGAGAGG - Intronic
953568908 3:44056487-44056509 CTCACAATAAGGGCTGGGAGTGG - Intergenic
954302526 3:49707539-49707561 ATGCCAAGAGGGGCAGGGAGAGG - Intronic
955158520 3:56441835-56441857 ATCCCAGGGAAGGCTGGGGATGG - Intronic
955805543 3:62730247-62730269 ATCCCCAGGAGATGTGGGAGGGG - Intronic
956627723 3:71283118-71283140 ATCCCAGAAAGGGCTGAGAGAGG + Intronic
959562932 3:107802968-107802990 ATCCCAATGTGGTCTGAGAGAGG - Intronic
961738440 3:129016836-129016858 CTCCCAAGCAGTGCTGTGAGTGG + Intronic
963603526 3:147396360-147396382 ATTCAAAGGACGGCTGGGGGAGG + Exonic
963805061 3:149714418-149714440 ATCCGAGGGGGCGCTGGGAGCGG - Intronic
964000989 3:151771727-151771749 ACCACAAAGAGGGCTGGGCGTGG - Intergenic
964720500 3:159764301-159764323 CCCCCAAGGAGGCCTGGGGGCGG - Intronic
965516761 3:169629964-169629986 CTCCGCAGAAGGGCTGGGAGAGG - Intronic
965632994 3:170752473-170752495 ATTCCAAAGAGGGGTGGGAGTGG - Intronic
968669895 4:1843643-1843665 ACACCAATGAGGCCTGGGAGGGG + Intronic
968900615 4:3429924-3429946 AACCCGAGGAGGGGTGGTAGAGG - Intronic
968949057 4:3680960-3680982 ATCCCGAGGAGAGAGGGGAGTGG - Intergenic
968963751 4:3759050-3759072 ACTCCAAGGAGAGCTTGGAGAGG - Intergenic
969440270 4:7212849-7212871 AGCCCATGGAGGGCAGGGTGAGG + Intronic
970008041 4:11428924-11428946 ATCCCGAGGAGGGGGAGGAGCGG + Exonic
972280880 4:37601190-37601212 ATTCGAAGGTGGGCTGGGGGCGG - Intronic
972643435 4:40945940-40945962 TTCCCAAGGAAGGCCGGGCGTGG + Intronic
973348676 4:49084358-49084380 AGCCCATTGAGGGCTGGGCGTGG + Intergenic
973667466 4:53177512-53177534 ATGAAAAGGAGGACTGGGAGAGG + Intronic
976356720 4:84127202-84127224 GGCCCCAGGAGGGCTGGGGGAGG + Intergenic
976524927 4:86075982-86076004 GGCCCCAGGAGGGCTGGGGGAGG - Intronic
978472564 4:109085959-109085981 AGCCAAAGGAGGAATGGGAGTGG + Intronic
980954120 4:139410833-139410855 ACAGGAAGGAGGGCTGGGAGCGG + Intronic
980969754 4:139557016-139557038 ACCCGAAGGAGGGCGGGGAGTGG - Intronic
982778625 4:159467112-159467134 ATCCCCAGGAGTGCTGGAAAAGG - Intergenic
983890767 4:173027271-173027293 ATTTCAGGGAGGGCTGGGCGCGG - Intronic
984356555 4:178666743-178666765 ACCCCAATGAGGGCCAGGAGTGG - Intergenic
984587330 4:181579038-181579060 AGCCCAGGCAGGGATGGGAGAGG - Intergenic
984734892 4:183099492-183099514 ATGCCTAGGAGGGCCGGGAGCGG + Exonic
984920855 4:184762938-184762960 ATCCCTATGAGGCCTGGCAGAGG + Intronic
985242330 4:187943663-187943685 ATCCCAAGGAGGGCCGGGCGTGG - Intergenic
985619500 5:946742-946764 AGCCCCAGGAGGGCTGAGGGCGG - Intergenic
986663729 5:10082121-10082143 ATGCCAGGGAGGGCTCTGAGAGG + Intergenic
988609972 5:32714154-32714176 TTCCCAAGGCCGGCTGGGACTGG + Intronic
990768691 5:59217831-59217853 ATTCCCAGGAAGGCTGGAAGGGG + Intronic
991989967 5:72327760-72327782 ATGGAAAGGAGGGCTGGGCGTGG - Intronic
994765774 5:103915555-103915577 ATTCCAGGGTGGGCAGGGAGTGG - Intergenic
994791826 5:104237027-104237049 ATCTGAATGAGGGATGGGAGAGG + Intergenic
997326533 5:133026453-133026475 GTCCACTGGAGGGCTGGGAGCGG - Intronic
997594240 5:135095602-135095624 CTCCCAATGAGGGAGGGGAGGGG - Intronic
997977616 5:138449551-138449573 ATCCCAAGGAGGCCTGGGCATGG - Intergenic
997979357 5:138459344-138459366 ACCCCAGGGAGGGCTTTGAGGGG - Intergenic
999153832 5:149443977-149443999 GTCCCAAGGCGGGCTGTGAGAGG + Intergenic
999257384 5:150217087-150217109 AACTCAAGGAAGGCTGGGATGGG - Intronic
999458227 5:151735952-151735974 ATGGCAAGGAGGGCTGGAAGTGG - Intergenic
999615259 5:153416487-153416509 ATGACAATGAGGGCTGGGAAGGG + Intergenic
1001286397 5:170427046-170427068 AGCCCAAGGAGGGCTGGAGCAGG + Intronic
1001805949 5:174586344-174586366 ACCACAATGAGGGCTGGGTGTGG - Intergenic
1001931658 5:175677610-175677632 AGCCCAAAATGGGCTGGGAGGGG - Intronic
1002527955 5:179825516-179825538 ATCCAAAGGAGGGCAGTCAGAGG - Intronic
1002872455 6:1179171-1179193 CCCCCAAAAAGGGCTGGGAGTGG + Intergenic
1003621874 6:7707844-7707866 TTCCCAAGGAGGGTAGAGAGAGG + Intergenic
1004705120 6:18117484-18117506 ATATCAAGGATGGCTGGGCGCGG + Intergenic
1005187413 6:23178668-23178690 ATTTCAACCAGGGCTGGGAGAGG - Intergenic
1006136776 6:31900612-31900634 ACCCCCTGGAGGCCTGGGAGGGG - Exonic
1006416877 6:33909715-33909737 ATCCCGAGGGTGGGTGGGAGTGG + Intergenic
1006654342 6:35577424-35577446 ATCCCAAGGAGATTTGAGAGGGG + Intronic
1007181882 6:39934487-39934509 ATCCCAGCAAGGGCGGGGAGGGG + Intronic
1007401000 6:41602274-41602296 CCTCCACGGAGGGCTGGGAGGGG - Exonic
1007698139 6:43746886-43746908 CTCCCTTGGGGGGCTGGGAGCGG + Intergenic
1008368976 6:50712379-50712401 ATTTCAAGGAGGGGTGGGAGGGG + Intergenic
1008417612 6:51261285-51261307 ATCTCATGAAGGGGTGGGAGAGG + Intergenic
1008600147 6:53085857-53085879 ATCCCAAAGTTGGCTGGGTGTGG + Intronic
1011590512 6:88966266-88966288 ACCCCAGGGAGCGATGGGAGTGG - Intergenic
1011642770 6:89431497-89431519 ATCTGAAGAAGGGCTGGGCGCGG + Intergenic
1012550158 6:100458176-100458198 AACCCAAGGAGGGCGGGGTTCGG + Intronic
1013330591 6:109095774-109095796 ATCCCAAGGGTCGCAGGGAGCGG + Intronic
1013934183 6:115572973-115572995 ATCATAAGGATGGCTGGGTGTGG - Intergenic
1014494303 6:122101591-122101613 ATCCCAGCAAGGGCTGGGAATGG + Intergenic
1018796413 6:167188676-167188698 ATCCCAATTTGGGCTGGGTGCGG + Intronic
1018949888 6:168372188-168372210 GTTCCCCGGAGGGCTGGGAGGGG + Intergenic
1019413637 7:917363-917385 CTACCAGGGAGGGCTGGGAGGGG + Intronic
1019712004 7:2522066-2522088 ATTCCGTGCAGGGCTGGGAGAGG - Intronic
1019793889 7:3035589-3035611 AATCCAAGGAGGGCTGGGCGCGG - Intronic
1019798837 7:3072810-3072832 AGACCTGGGAGGGCTGGGAGGGG + Intergenic
1020059329 7:5140607-5140629 ACCCCAAGGCTAGCTGGGAGCGG - Intergenic
1020102769 7:5404080-5404102 ATCCCAGGCAGGGCCGGGGGCGG + Intronic
1020208588 7:6139933-6139955 AACACAGGGAGGTCTGGGAGTGG - Intronic
1021560002 7:21960183-21960205 ATACCAAGGATTGCTGGGTGTGG - Intergenic
1021683398 7:23157680-23157702 ATACCAAGGTGGGGTGGAAGGGG - Intronic
1022175351 7:27867179-27867201 CTCAAAAGGAGGGCTGGGAAAGG + Intronic
1022466789 7:30657359-30657381 GTCCCAGGGAGGGCTGGGGATGG + Intronic
1022507787 7:30917307-30917329 GACCCAAGGAGGGTTGGGCGGGG + Intronic
1023239066 7:38123013-38123035 ATGCCAAGGAGCAGTGGGAGGGG + Intergenic
1024264853 7:47598686-47598708 ATCTCAAGGAAGGCTGCAAGGGG + Intergenic
1024889631 7:54185262-54185284 ATACAGAGGAGGGCTGCGAGGGG + Intergenic
1026624660 7:71981380-71981402 AACCCAAGAGGGGCTGGGGGTGG + Intronic
1029288147 7:99480371-99480393 ATCCCCAGTAGGGTTTGGAGTGG - Intronic
1029382149 7:100221279-100221301 ACACCCAGGAGGCCTGGGAGGGG - Exonic
1030071321 7:105700213-105700235 ATGACAAGGGGGGCTGGGCGCGG + Intronic
1030679091 7:112415555-112415577 AGCCCATGAAGGTCTGGGAGAGG - Intergenic
1032277829 7:130475261-130475283 AAACCAAGGAGGGCTGGGCGCGG - Intergenic
1032511370 7:132475231-132475253 ATCCCAAGGAGGGCTGGGAGGGG - Intronic
1032697956 7:134354162-134354184 ATCCTGTGGAGGGCAGGGAGAGG - Intergenic
1033007733 7:137585786-137585808 CTTCCAAGGAGGTCAGGGAGAGG - Intronic
1033172931 7:139100239-139100261 ACCACAATGAGGGCTGGGCGCGG + Intronic
1033422967 7:141218982-141219004 ATAACAAGGATGGCTGGGGGAGG - Intronic
1033890612 7:146008471-146008493 AATCCAGGGAGGGCTGGGCGCGG + Intergenic
1034541216 7:151759424-151759446 ATCCCCACGAGGGCAGGGATGGG + Intronic
1034557223 7:151857972-151857994 TTCCCAAAGAGAGATGGGAGAGG - Intronic
1034732333 7:153398984-153399006 GTCCCATGGTGGGCTGGGAGAGG + Intergenic
1034942160 7:155237595-155237617 GTCCCAAGGAGGGGTGGGGAAGG + Intergenic
1035261666 7:157665493-157665515 ATCCCACTGAGGGCTGGGCATGG + Intronic
1035553135 8:544989-545011 GTCCTGAGGAGGGCTTGGAGCGG - Intronic
1036585435 8:10119022-10119044 GTCCCAGGGAAGGCGGGGAGGGG - Intronic
1037708112 8:21332823-21332845 ATCCCCAGGAGTGCTTGGAAAGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1039062388 8:33581941-33581963 ATTCCTAGAATGGCTGGGAGAGG + Intergenic
1040951063 8:52939626-52939648 GTCCCGAGGAGGGGTGGGGGTGG - Exonic
1041511410 8:58658996-58659018 ATGCCCTGGAAGGCTGGGAGGGG - Intronic
1042839700 8:73111320-73111342 ATCCCAAGGATGGCTAGCAGGGG + Intronic
1043584369 8:81750307-81750329 AAGACAAGGAGGGCTGGGTGTGG + Intronic
1043880325 8:85535188-85535210 GTCCCAGGGAGGGCTGCGAGAGG + Intergenic
1046016797 8:108615214-108615236 ATTCCAAGGATGGCTTGGAAGGG + Intronic
1046770538 8:118112344-118112366 AGTGGAAGGAGGGCTGGGAGAGG - Intergenic
1046827070 8:118703168-118703190 ATGAGAAGGAGGGCTAGGAGAGG - Intergenic
1048078380 8:131098063-131098085 ATAACTAGGAGGGATGGGAGAGG + Intergenic
1048534372 8:135278674-135278696 ACCCCAAGATGGTCTGGGAGGGG + Intergenic
1049257436 8:141621407-141621429 AGCCCAGTGAGGGCTGGCAGTGG - Intergenic
1049535294 8:143177654-143177676 ATCCCAATTAGGGCTGGTGGTGG + Intergenic
1049690230 8:143955083-143955105 GTCCCAGGGAGGGCAGGGACGGG - Intronic
1051369423 9:16345535-16345557 TTCCTAAGGAGGGCAGAGAGAGG + Intergenic
1052195797 9:25713470-25713492 ACCCCATGGAGGGCCGGGCGCGG + Intergenic
1052988843 9:34506811-34506833 TGCAGAAGGAGGGCTGGGAGTGG - Exonic
1053557335 9:39151262-39151284 ATACAAAGCAGGGCTGGGCGCGG + Intronic
1053821441 9:41971531-41971553 ATACAAAGCAGGGCTGGGCGCGG + Intronic
1054090318 9:60839679-60839701 ATACAAAGCAGGGCTGGGCGCGG + Intergenic
1054111729 9:61115236-61115258 ATACAAAGCAGGGCTGGGCGCGG + Intergenic
1054139780 9:61467687-61467709 ATACAAAGCAGGGCTGGGCGCGG - Intergenic
1054609127 9:67215885-67215907 ATACAAAGCAGGGCTGGGCGCGG - Intergenic
1055825740 9:80322201-80322223 AGCCCAGTGAGGGCTGGGCGTGG - Intergenic
1056928789 9:90857721-90857743 TTCTCAAAGAGAGCTGGGAGAGG - Intronic
1058529207 9:105889238-105889260 ATCCCCATGGAGGCTGGGAGGGG + Intergenic
1059336047 9:113569065-113569087 GGCCCATGGAGGGCAGGGAGAGG - Intronic
1060895725 9:127215879-127215901 CTCCCAAGATGGGCTAGGAGAGG - Intronic
1062697501 9:137882991-137883013 ATCTCCAGCAGGGCTGTGAGGGG - Intronic
1203794674 EBV:169995-170017 CCCCCAAGGGGGGCGGGGAGCGG + Intergenic
1203794875 EBV:170533-170555 CCCCCAAGGGGGGCGGGGAGCGG + Intergenic
1203795066 EBV:171056-171078 CCCCCAAGGGGGGCGGGGAGCGG + Intergenic
1203795267 EBV:171594-171616 CCCCCAAGGGGGGCGGGGAGCGG + Intergenic
1203491321 Un_GL000224v1:108190-108212 ATCCCAAAAGGGGCAGGGAGGGG - Intergenic
1203503945 Un_KI270741v1:50060-50082 ATCCCAAAAGGGGCAGGGAGGGG - Intergenic
1186452852 X:9687823-9687845 ATCCCACGGTGGGCAGGGAAGGG - Intronic
1189137029 X:38561156-38561178 ATGCCAGGGCGGACTGGGAGAGG + Intronic
1189261061 X:39679102-39679124 ATCCCAAGGAGGGCTCTGATTGG - Intergenic
1190056156 X:47182053-47182075 AGCCCAGGGAGGGATGGGATCGG + Intronic
1192229354 X:69254511-69254533 AACCCAATGACAGCTGGGAGGGG + Intergenic
1192322745 X:70105268-70105290 AACTCAGGGAGGGCTGGAAGGGG - Intergenic
1193668745 X:84356909-84356931 ATCCACAGGAGGGCCGGGCGCGG - Intronic
1196816336 X:119667833-119667855 AGCCCTGGGAGGGCTGGGGGAGG - Intronic
1196908241 X:120459988-120460010 ATCATAAGGAGGGCTGGGCATGG + Intronic
1197698015 X:129571620-129571642 ATCCCAAGGTTGGCTGCGAGCGG - Intronic
1199381484 X:147177692-147177714 ACCCCAAATAGGGCTGGGCGCGG + Intergenic
1200092039 X:153640503-153640525 GACACCAGGAGGGCTGGGAGTGG + Intergenic
1200210952 X:154346396-154346418 AGTCCAGGGAGGGCAGGGAGGGG - Intergenic
1200219900 X:154385696-154385718 AGTCCAGGGAGGGCAGGGAGGGG + Intergenic
1201247097 Y:12015412-12015434 ATCCCAAGCATGGCTCAGAGGGG - Intergenic
1201340058 Y:12924401-12924423 ATCTCAGGGAAGGCTGGAAGGGG - Intergenic