ID: 1032513114

View in Genome Browser
Species Human (GRCh38)
Location 7:132487717-132487739
Sequence CATGAGAGGAAGACCCGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 278}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032513106_1032513114 20 Left 1032513106 7:132487674-132487696 CCAGGATTCCTGGCAGCAACTGG 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1032513114 7:132487717-132487739 CATGAGAGGAAGACCCGGGAAGG 0: 1
1: 0
2: 0
3: 20
4: 278
1032513108_1032513114 12 Left 1032513108 7:132487682-132487704 CCTGGCAGCAACTGGAAGTGATG 0: 1
1: 0
2: 1
3: 17
4: 153
Right 1032513114 7:132487717-132487739 CATGAGAGGAAGACCCGGGAAGG 0: 1
1: 0
2: 0
3: 20
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032513114 Original CRISPR CATGAGAGGAAGACCCGGGA AGG Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903278344 1:22235964-22235986 AATGAGGGGCAGACCTGGGAAGG + Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904900646 1:33854593-33854615 CATGAGAAGAATCCCCAGGAAGG - Intronic
906213563 1:44025824-44025846 CATGGGAGGAAACCCCAGGAAGG + Intronic
906286369 1:44590405-44590427 ACTGAGAGGAAGCCCCGTGAAGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908007335 1:59740304-59740326 CATGAGAGGAAAGACAGGGATGG - Intronic
908116225 1:60943041-60943063 CATGAGAGGAAGACACTGCATGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
911096246 1:94057389-94057411 CAAGGGAGGAAGACCTGGGTAGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915528482 1:156490227-156490249 CATGAGAAGGAGACCCGAGAGGG - Intronic
916053598 1:161052594-161052616 CAGGGGAGGAAGGCCCAGGAAGG + Intronic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
917493449 1:175518395-175518417 CATGAGAGGAGGAATGGGGATGG - Intronic
918400899 1:184162090-184162112 CATGAGAGGAAGTGCAGGGAGGG + Intergenic
921481796 1:215672426-215672448 CATGAGAGGAGAACCAGGGGAGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922740329 1:228010770-228010792 GATGTGAGGGAGACCCTGGAGGG - Intronic
924552329 1:245090190-245090212 CATGAGGGAAAGACCCAGGTAGG + Intronic
924941044 1:248812618-248812640 CCTGAGAGGAAGGCTCTGGAAGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063773322 10:9229624-9229646 CACAGGAGGAAGACACGGGACGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065467973 10:26045674-26045696 GATGAAAGGAGGACCGGGGAAGG - Intronic
1065698434 10:28401740-28401762 CATGAGAGTCAGAACCAGGATGG + Intergenic
1065870298 10:29950571-29950593 CATGAGAGAAAGGACAGGGAAGG + Intergenic
1067093403 10:43283300-43283322 CATGAGTGGAAGCCAAGGGAGGG + Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069741622 10:70688829-70688851 CATGAGAGGGAGACCGGAGGGGG + Intronic
1070411934 10:76149918-76149940 GATGAGGGGAAGCCCTGGGAGGG + Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073491771 10:103857115-103857137 GATGAGAGGTAGACCTGGAACGG + Intergenic
1074308253 10:112298745-112298767 CGTGAGAGGAAGGCCTGGGCAGG + Intronic
1074943227 10:118255080-118255102 CTTGAGGGGAGGACCCTGGAAGG - Intergenic
1077138942 11:1015071-1015093 TGTGAGAGGAACACCCAGGAGGG + Intronic
1077514491 11:2993133-2993155 CATGAGAGGGAGAACAGGGCGGG - Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1079669340 11:23147485-23147507 AATGAGAGGGAGACATGGGAGGG - Intergenic
1081853971 11:46292277-46292299 CATCAGAGCAAGATTCGGGACGG + Intronic
1082064103 11:47884937-47884959 CCTGAGTGGAAGACCCAGCAAGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083178688 11:60970701-60970723 CAGGAGAGGTGGACCTGGGATGG + Intergenic
1083581208 11:63826775-63826797 CATGAGGGGAAGCCCAAGGATGG - Intronic
1083627357 11:64078512-64078534 CATCGGAGGGATACCCGGGAGGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088367197 11:109052255-109052277 CATGGGAGGGAGTCCAGGGATGG - Intergenic
1088883443 11:113989419-113989441 CAAGAGAGGGAGACCCCGGGTGG - Intronic
1089706916 11:120284657-120284679 CAGGAGAGGCAGCCCCAGGATGG - Intronic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091903586 12:4164963-4164985 CATGCGCGGAGGAGCCGGGAGGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092709687 12:11322624-11322646 CATGACTGGAACACCAGGGAAGG + Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1095396350 12:41766481-41766503 GAGGAGAGGAAGACACAGGAAGG - Intergenic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1100289676 12:93201891-93201913 CATGATGGGAAGCCACGGGAAGG - Intergenic
1102180904 12:110911553-110911575 CAAGAAAGGAAGAACAGGGAAGG - Intronic
1103477239 12:121227650-121227672 CTTGAGGGGAAGAACCTGGAAGG + Intronic
1105563753 13:21522037-21522059 CATTAGAGGAAGACCAGGTGTGG - Intronic
1105872530 13:24518254-24518276 CATGAGAGCAAGAGCTGGCAGGG - Intergenic
1106771739 13:32967995-32968017 CATGTAAGGCAGACCCTGGAAGG + Intergenic
1107107748 13:36664950-36664972 CATGATAGTAAGATTCGGGATGG + Intergenic
1111108674 13:83678342-83678364 CATTAAAGGCAGACCTGGGATGG + Intergenic
1113485391 13:110649092-110649114 CGTGAGAGGAAGAGTCGGGGAGG - Intronic
1113952523 13:114079902-114079924 CATAAGAGGAAGAGGCGGGGGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1114901365 14:27063649-27063671 CAAGAGATGAAAGCCCGGGATGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1118030987 14:61817468-61817490 CCTGATAGGAAGCACCGGGAAGG + Intergenic
1122014584 14:98783563-98783585 CAGGAGAGGAAGTCACAGGATGG + Intergenic
1122367176 14:101201067-101201089 CATGAGTGGAAGAGGCTGGAGGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1124513590 15:30347996-30348018 CATGAGAGGAACACCAGAGAGGG - Intergenic
1124606601 15:31174227-31174249 CCTGGGAGGAAGACCTGGCATGG - Intergenic
1124729331 15:32182769-32182791 CATGAGAGGAACACCAGAGAGGG + Intergenic
1124965343 15:34429162-34429184 CATGGGAGGAAGACGCGGTCAGG - Intronic
1124981961 15:34575364-34575386 CATGGGAGGAAGACGCGGTCAGG - Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126990891 15:54374386-54374408 CATGAGAGGGAGGCCGGGGTGGG - Intronic
1127097997 15:55533211-55533233 TATGAGAGGAAGTCCTGGAAGGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127638820 15:60896186-60896208 CATGAGAGGGTGACCTGGCAAGG + Intronic
1129199666 15:73991482-73991504 CAGGACAGGAAGGCCAGGGAGGG + Intronic
1130981499 15:88814876-88814898 CAGGAGAGGAGGACAGGGGATGG - Intronic
1132027745 15:98417369-98417391 CATAAGAGGAAGCACCGGGTTGG - Intergenic
1132721368 16:1317822-1317844 GTGGAGAGGAAGACCCGGGATGG + Intronic
1133640483 16:7712195-7712217 CAAAACAGGAAGACCCGTGACGG - Exonic
1133911442 16:10069897-10069919 AAAGAGAGAAAGACCTGGGAAGG + Intronic
1134383715 16:13752084-13752106 CATGAGAGTAAGAACCATGATGG + Intergenic
1135754325 16:25083799-25083821 CAGGAGAGGAAGAGGGGGGAAGG - Intergenic
1136128579 16:28203765-28203787 GTTGAGAGGAAGACCTGGTAAGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136631731 16:31492921-31492943 AATGAGAGGCTGACCTGGGAGGG + Intronic
1137328980 16:47471293-47471315 GGTGAGAGGAAGGCCTGGGATGG + Intronic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139259637 16:65579256-65579278 CATGAGAAGAACACCGGGCAGGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140899440 16:79354332-79354354 CAGGAGAGGAACACACGAGATGG + Intergenic
1141410250 16:83828245-83828267 CATGTGAGGCAGACTCGGGATGG + Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143121386 17:4609450-4609472 CATGAGAAGAAAATCCAGGAAGG + Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146595042 17:34161325-34161347 CATGACAGGTATACCAGGGAAGG + Intronic
1147677797 17:42219609-42219631 CATGAGAGCAGAACCTGGGAGGG - Intronic
1147688239 17:42299962-42299984 CATGAGAGCAGAACCTGGGAGGG + Intronic
1149292574 17:55231737-55231759 CATGAAAGGGAGTCCGGGGATGG - Intergenic
1149637298 17:58181106-58181128 CATGAGAGAAAGAGCAGAGAGGG - Intergenic
1151750516 17:76034650-76034672 CTTGGGAGGAGGACCTGGGAGGG - Intergenic
1152018881 17:77770251-77770273 GAAGAGAGGAAGACAGGGGAGGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152771904 17:82175207-82175229 CATGAGGGGTAGACCCTGGAAGG + Intronic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153613437 18:6910632-6910654 CATGAGAGAAAGACCAAGCATGG - Intronic
1153676260 18:7458451-7458473 CATGCCAGAAAGACCAGGGATGG + Intergenic
1155347759 18:24875519-24875541 TAGGAGAGGAAGAGCAGGGAAGG - Intergenic
1156522392 18:37732833-37732855 CATGATAGAAAGACCCTGGCGGG - Intergenic
1157179938 18:45488187-45488209 CATGAGAGCAAGAGCAGGCAGGG + Intronic
1157340130 18:46771022-46771044 TATGAGAGGAAGGCACGGGATGG - Intergenic
1158023420 18:52869668-52869690 CATGGGAGGAAGCCAAGGGAGGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163712543 19:18855260-18855282 CTTGCGGGCAAGACCCGGGAGGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166942484 19:46375215-46375237 CATGAGAGGAAGGGCCCGGCTGG - Intronic
1167554043 19:50181819-50181841 CAACAGAGAAAGACCCTGGAGGG - Intergenic
1167930175 19:52857360-52857382 TATGGCAGAAAGACCCGGGACGG + Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168277712 19:55286421-55286443 CATGAAGAGAAGACCCAGGAAGG + Intronic
925024290 2:595482-595504 CACGTGATGAAGACCCTGGACGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926119097 2:10231799-10231821 AAGGGGAGGAAGGCCCGGGAGGG + Intergenic
926909959 2:17843361-17843383 CATGAGAAGAAGACGGGAGAGGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935818374 2:106869179-106869201 CAGGAGAGGAAGGCCTGGAAGGG + Intronic
936093926 2:109517574-109517596 CATGAGAGGAGGGCCTGGGCAGG - Intergenic
937124988 2:119469093-119469115 GATGTGAGGAAGACCCTTGAAGG + Intronic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938671372 2:133589508-133589530 CAGGAGAGAGAGACCCAGGATGG + Intergenic
939519820 2:143215609-143215631 CATGTGAGGCAGACACAGGAGGG + Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941589259 2:167398635-167398657 CATGAGAGGAATACCCACCAAGG + Intergenic
942119787 2:172765476-172765498 CAAGAGAGAAAGAGCCAGGATGG + Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945119088 2:206440487-206440509 CATGTGAGCAATACCCAGGAAGG - Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
948607906 2:239147538-239147560 AATGAGTGGAAGGCCCGCGAGGG - Intronic
948813437 2:240497942-240497964 CATGAGCGGAGGACCAGGCAGGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169427080 20:5504700-5504722 CCGGAGAGGAAGAGCCGAGAAGG + Intergenic
1170302637 20:14902769-14902791 CTTGAGAGCAAGAGCTGGGAAGG + Intronic
1171240785 20:23565634-23565656 CAGGGGAGGAAGACCAGAGAGGG + Intronic
1171377108 20:24700991-24701013 CATGAGAGAAACACAGGGGATGG - Intergenic
1172898202 20:38315446-38315468 CATGAAGGGAAGAGCAGGGAGGG + Intronic
1175794638 20:61764101-61764123 CAGGAGAGCAAGACCCAGGCGGG + Intronic
1176619599 21:9047009-9047031 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1179251546 21:39675056-39675078 CATGAGAGGCACCCACGGGAAGG - Intergenic
1179784182 21:43720245-43720267 CAGGAGAGCACGACCCGGCAGGG - Intronic
1180391802 22:12290675-12290697 CATGGTGGGAAGAACCGGGAGGG + Intergenic
1181257436 22:21572892-21572914 CAAGGGAGGAAGAGCCGAGAAGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183361445 22:37385141-37385163 CCTGAGAGGTAGCCCGGGGAGGG + Intronic
1184149741 22:42631125-42631147 CGTGAGGGGAATCCCCGGGAGGG - Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
950798466 3:15530513-15530535 CATCAGAAGAAGACAGGGGAGGG - Intergenic
953539972 3:43809473-43809495 CTTGAGAGGAAGAGCAGGGGTGG + Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
957926968 3:86826873-86826895 AAAGAGAGGAAGCCCCTGGAGGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961168788 3:124781183-124781205 CACCAGAGCCAGACCCGGGATGG + Intronic
961464549 3:127073305-127073327 CAGGAGAGGAAGGCCTAGGAGGG - Intergenic
961524958 3:127490800-127490822 CATGAGAGGAAGGCAAGGGGGGG - Intergenic
963366185 3:144337473-144337495 CATGAGAGGAAGGAGGGGGAAGG - Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966850690 3:184163430-184163452 ACTGAGAGGATGCCCCGGGAAGG + Intronic
967891918 3:194369699-194369721 CCTGAGAGGAGGACGAGGGACGG + Exonic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968940012 4:3632867-3632889 CAGGAGTGGAAGACGCAGGAAGG + Intergenic
969134358 4:5018608-5018630 AGAGAGGGGAAGACCCGGGAGGG - Intronic
969411325 4:7030179-7030201 TAGGAGTGGAAGACCCTGGAGGG + Intronic
969435912 4:7189329-7189351 CATTGCAGGAAGAGCCGGGATGG - Intergenic
970131904 4:12880756-12880778 CATGAAAGGAAGACCAGGAGGGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971402388 4:26287844-26287866 CAATAGAAGAAGACCAGGGAAGG + Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972665442 4:41160650-41160672 GGTGAGAGGGAGACCAGGGAAGG - Intronic
974981996 4:68968190-68968212 CATGGGAGGAAGACAGTGGAAGG + Intergenic
975342809 4:73259622-73259644 AAGGGGAGGAAGACACGGGAAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978611767 4:110549133-110549155 CATTACAGGAAGGTCCGGGATGG + Intronic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
980908786 4:138975283-138975305 GATCAGAGGAAGACCTGGAAAGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982856270 4:160385883-160385905 CGTGAGAGGAAGGCCAAGGAGGG - Intergenic
983688450 4:170438433-170438455 TATGAGAGGAAGACTGGAGATGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
987025755 5:13925055-13925077 CATGGGAGGAAGATCCCTGAGGG - Intronic
987573272 5:19693604-19693626 CATGAGAGGAAGGCCAAGCATGG + Intronic
989170276 5:38466493-38466515 CAAGAGAGGAAGAAACGGGCCGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991416493 5:66397880-66397902 CATGAGAAGGAGAAACGGGAGGG + Intergenic
996881425 5:128300895-128300917 CAGGAGAGCAAGAGCCGGGAAGG + Exonic
997297935 5:132780012-132780034 CATGAGAGCAAGACCACGTAAGG - Intronic
997778240 5:136630443-136630465 CATGTGAGGAAGATCCAGGTGGG - Intergenic
999315258 5:150579413-150579435 CATGGGAGGAAGGCAAGGGACGG + Intergenic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1006360808 6:33586004-33586026 CATGATGGGAAAACCAGGGATGG - Intergenic
1006836667 6:37003009-37003031 CAGGAGAGGAACACCAGGGAGGG + Intergenic
1006921347 6:37629589-37629611 CAGGAGAGGAAGAACCCAGAGGG - Intergenic
1007072573 6:39048285-39048307 AATGAGAAGAGGACCTGGGAAGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1015110326 6:129585705-129585727 CATGAGTGTAAGGCCCTGGAAGG - Intronic
1017285695 6:152673421-152673443 TATGAGAGGAATTCCAGGGAAGG - Intergenic
1017656363 6:156633484-156633506 CATGAAACCAAGTCCCGGGATGG + Intergenic
1018397263 6:163387998-163388020 CATGAAGGGAAGGCCCTGGAAGG + Intergenic
1019158894 6:170056630-170056652 GATGAGGGGGAGACCCGGGGCGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1024160564 7:46670597-46670619 CAGGTGAGGAAGGCCAGGGAAGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1029346738 7:99984131-99984153 CATAAGATGCAGACCCAGGAAGG + Intergenic
1029558477 7:101286734-101286756 CATAAGATGCAGACCCAGGAAGG - Intergenic
1032097983 7:128948985-128949007 CAGGAGAGAAAGGCCCGGGAAGG - Intronic
1032513114 7:132487717-132487739 CATGAGAGGAAGACCCGGGAAGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034265912 7:149780570-149780592 TCTGAGAGGAAGACCCAGAATGG - Intergenic
1034496887 7:151428486-151428508 CATGGGAGGGAGGCCCAGGAAGG + Intergenic
1034872522 7:154696615-154696637 CATGAGTGGAAGGGCCTGGATGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035702543 8:1647720-1647742 AATGAGAGAGAGACCCGGCAGGG - Intronic
1038527409 8:28288253-28288275 CATGAGAGGAAGTGCAGGCAAGG - Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038668520 8:29562638-29562660 CATGGGAGGAGGACCCAGAAGGG + Intergenic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039365364 8:36923075-36923097 CATGAGAGGAGGAACATGGAGGG - Intronic
1039569442 8:38575395-38575417 AATGAGAGGCAGAGCCAGGAGGG - Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045295095 8:100865646-100865668 AATGAGAGGAAGGCCCGTGGGGG - Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047001232 8:120574802-120574824 AATGAGATGGAGACCCAGGAAGG + Intronic
1049121268 8:140740305-140740327 ACTGAGAGGATGACCAGGGAAGG + Intronic
1049432615 8:142572240-142572262 CATGAGATGAGGACCCTGCACGG - Intergenic
1049445965 8:142631705-142631727 CAGGAGAAGCAGAACCGGGAGGG + Intergenic
1049585926 8:143432363-143432385 GTTGAGAGGGAGGCCCGGGAAGG + Intergenic
1049613537 8:143566881-143566903 CATGAGGTGGAGACCCAGGAGGG + Exonic
1049614236 8:143569230-143569252 CATGAGAGGGAGAAACAGGAGGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051392592 9:16581892-16581914 TCTGAGAGGAATACCCGGGAAGG - Intronic
1051891090 9:21943898-21943920 CATGAGAGGACGCCCAGGGAAGG + Intronic
1053129181 9:35605587-35605609 CATGTGAGGCAGGCCCGGGCTGG + Exonic
1056802974 9:89706952-89706974 CATGAAAGGCAGAGCTGGGAGGG + Intergenic
1058156988 9:101526903-101526925 CTTGGGAGGAAGAACAGGGAAGG + Intronic
1058394561 9:104536088-104536110 CATCAGTGGAAGAACCAGGAAGG + Exonic
1058456641 9:105143725-105143747 CATGAGAGGAAGCCGATGGAAGG - Intergenic
1060123976 9:121024198-121024220 CAACAGAGCAAGACTCGGGAGGG + Intronic
1060130554 9:121093802-121093824 CTTGAGGGGAAGATCCAGGAGGG + Intronic
1060746439 9:126136375-126136397 CATGAGAGAAAGAGAAGGGAAGG + Intergenic
1062395117 9:136349689-136349711 GCTGAGAGGAGGCCCCGGGAGGG + Exonic
1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1193627388 X:83837727-83837749 CATGGGAGGAAAATCCTGGAAGG + Intergenic
1197675514 X:129325702-129325724 CAAGAGAGGAAGAACAGGTATGG + Intergenic