ID: 1032513351

View in Genome Browser
Species Human (GRCh38)
Location 7:132489423-132489445
Sequence CCTGGACATGAATGCTCCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032513351_1032513354 -1 Left 1032513351 7:132489423-132489445 CCAGGGGAGCATTCATGTCCAGG 0: 1
1: 0
2: 0
3: 15
4: 125
Right 1032513354 7:132489445-132489467 GCCACAGAAGTTATCGTCAATGG 0: 1
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032513351 Original CRISPR CCTGGACATGAATGCTCCCC TGG (reversed) Exonic
903103107 1:21050876-21050898 CCGGGACATGCATCGTCCCCTGG - Exonic
903676903 1:25070143-25070165 CCTGCACTGGAATGCTCCCTGGG + Intergenic
904886388 1:33741860-33741882 CCTGGATAAGTGTGCTCCCCAGG + Intronic
907866544 1:58404816-58404838 CCTGGACATGACTGTTTCCTGGG - Intronic
910545901 1:88418416-88418438 CCTGGACATGATGGCTTCACTGG + Intergenic
911482210 1:98458370-98458392 CCTGCTCCTGAATTCTCCCCAGG + Intergenic
911621244 1:100068152-100068174 CCAGGAAATGGGTGCTCCCCAGG - Exonic
912744514 1:112234241-112234263 CATGGACTTGATGGCTCCCCTGG + Intergenic
914248641 1:145904151-145904173 CCTGTACATGAGTGGTCCCTGGG - Exonic
915061919 1:153193219-153193241 CCTGGAGGTGACAGCTCCCCAGG + Intergenic
916662873 1:166938129-166938151 CCTCGGCATGAATGCTCTCTAGG - Intronic
920441452 1:205983639-205983661 CCTGGATTTGAATCCTCCCCTGG - Intronic
922244179 1:223778715-223778737 GCTGGAAATGAATCCTCCCCAGG - Intergenic
1063805197 10:9631114-9631136 CCTGGAGGTGGATTCTCCCCAGG - Intergenic
1064694995 10:17956155-17956177 CACGGACATGTGTGCTCCCCGGG + Intronic
1070381555 10:75884932-75884954 CCTGGACTGGAGTTCTCCCCAGG - Intronic
1074267940 10:111924028-111924050 CCTGGACATCAATGGGCACCTGG - Intergenic
1074349047 10:112716959-112716981 CCTTGCCATGAATGCTGCCAGGG + Intronic
1075794744 10:125111846-125111868 CCTGGACATGCCTGCTGCACAGG - Intronic
1075941686 10:126395474-126395496 CCTGGACAAAAGTGCTCACCAGG - Intergenic
1077352113 11:2097821-2097843 CCTGGCCTGGACTGCTCCCCCGG + Intergenic
1077621784 11:3731390-3731412 CTTGGGCATGAATGCTCCATTGG + Exonic
1079122070 11:17693178-17693200 GCTAGACATGGATCCTCCCCTGG + Intergenic
1079164114 11:18021824-18021846 CCTGGACATGATTGTTCCTGGGG - Intronic
1081491119 11:43569683-43569705 CCTGGAAATGAACACTCCCAGGG + Intronic
1083504181 11:63139785-63139807 CCTAGAAATGCATGCTCTCCTGG + Intronic
1090142169 11:124277053-124277075 CCTGGCCATGAATGGTGCCTGGG + Intergenic
1096546480 12:52343675-52343697 CCTGGAAACAGATGCTCCCCTGG - Intergenic
1099331723 12:81297183-81297205 CCTTGAGATGACTGCTGCCCTGG + Intronic
1100347237 12:93744226-93744248 CCTGGAAGTGGATTCTCCCCTGG - Intronic
1101095357 12:101333521-101333543 CCCAGACATGAATGCTTACCTGG + Intronic
1103177872 12:118880149-118880171 CCTGGCCATGAATGCTTTTCTGG - Intergenic
1103892145 12:124247635-124247657 CCTTGACATTAAAGCTCCCCAGG - Intronic
1104164684 12:126216386-126216408 CCAGGACATGAATGCTCAAGAGG - Intergenic
1106544304 13:30716988-30717010 CCTGGACACCAAGGCTTCCCTGG - Intronic
1112019502 13:95359424-95359446 CCTGGGCCTGAAGGGTCCCCAGG + Intergenic
1118493030 14:66280204-66280226 CCTGGGCATTTATGCTCCCAAGG - Intergenic
1121726924 14:96159028-96159050 CCTGTACCTGAAGGCCCCCCTGG + Intergenic
1121999268 14:98633173-98633195 CCTGGAAAGGGATGCTTCCCAGG - Intergenic
1122910996 14:104827500-104827522 CCTGGACGTGAGTCCACCCCAGG - Intergenic
1124146948 15:27136801-27136823 CCAGCACCTGAATGCTCCCAGGG + Intronic
1130096852 15:80862464-80862486 CCTGGTAATGAATGCTGCTCTGG - Intronic
1130294553 15:82635934-82635956 GCTGGACAGGAAGGCTCACCAGG + Intronic
1130653274 15:85774347-85774369 CTTGGACATCGCTGCTCCCCAGG + Intronic
1136022457 16:27448869-27448891 CCTGGACCTGGATGCTGGCCTGG + Exonic
1136574242 16:31113818-31113840 CGTGGACATGAATCCTCTCAGGG - Intergenic
1140289573 16:73640182-73640204 GCTGGACATTGATGCTCCCCAGG + Intergenic
1141726805 16:85794994-85795016 CCTGTACATGAATTTTCCACGGG - Intronic
1145081889 17:19901059-19901081 CCTGAACATGAATGCCCTCAGGG + Intergenic
1145280856 17:21466037-21466059 CCTGGAGAACAATGGTCCCCTGG - Intergenic
1147486534 17:40820360-40820382 TGTGGAAATGAATGCTGCCCCGG - Exonic
1147688569 17:42301368-42301390 CGTGCACATGAATCCCCCCCAGG + Exonic
1148465830 17:47864784-47864806 CCTGGACGTGATTGCTCTCCTGG + Intergenic
1149482478 17:57015077-57015099 CCTTGAGATGACTGCTGCCCTGG - Intergenic
1151667948 17:75556327-75556349 CCTGGGCATGAGTGCATCCCTGG + Intronic
1152828024 17:82479642-82479664 CCTGGACATGGCTGCTTCCCCGG - Intronic
1155247840 18:23927100-23927122 CCTGGACGTGAATGCTCAGCAGG - Intronic
1155312800 18:24540931-24540953 CCAGGACCTGAATGCTCTCTTGG + Intergenic
1161592373 19:5134620-5134642 CCTGGGCATGCAGCCTCCCCAGG + Intronic
1163570027 19:18075830-18075852 CCTGGAGATGAATGTGGCCCAGG - Exonic
1165765684 19:38349538-38349560 CCAGGAAACGAATCCTCCCCTGG + Intronic
1166936248 19:46334964-46334986 CCTGAACCTGAATGAGCCCCTGG + Exonic
926782438 2:16486046-16486068 CCTGGATAGGAATGCTACCCAGG + Intergenic
926855151 2:17247917-17247939 CTTGGACATGAAGTTTCCCCAGG + Intergenic
929673141 2:43895367-43895389 CCTGGACCTGCATCCTCCCAGGG + Intronic
933183360 2:79251740-79251762 CCTGGACATGACTGCAGCCCTGG + Intronic
933695197 2:85212469-85212491 CAAGCACATGAATGCTTCCCAGG - Intronic
936799118 2:116244765-116244787 CCAGGAGGTGAATGATCCCCTGG - Intergenic
943674032 2:190699042-190699064 CCAGGACATGAATGCATACCGGG + Intergenic
946035319 2:216737396-216737418 CCTGGACATAAAGTCTCCCCAGG - Intergenic
946406848 2:219496414-219496436 CCTGGACATCAATGACCCACAGG + Intronic
947996646 2:234533691-234533713 CCCGAACATGAATGTCCCCCAGG - Intergenic
948716725 2:239870041-239870063 CCTGGACATGCAGCCTCACCCGG + Intergenic
948716755 2:239870185-239870207 CCTGGACATGCAGCCTCACCTGG + Intergenic
1169934438 20:10867527-10867549 CCTAGACATGAACCCTCACCAGG - Intergenic
1170716084 20:18832265-18832287 CCTGGACATTAACCCTCCCCAGG - Intergenic
1171423955 20:25038047-25038069 CTTGAACATGAATGGTCCCCTGG + Intronic
1174391524 20:50220969-50220991 GCTGGGTTTGAATGCTCCCCAGG + Intergenic
1175881723 20:62263151-62263173 CCTGGAAAGAAATGCTCCTCAGG + Intronic
1180036177 21:45251456-45251478 CCTGAACATTAATGAGCCCCAGG - Intergenic
1181134064 22:20751939-20751961 CCTGGTCAGAAAGGCTCCCCAGG + Intronic
1181484605 22:23222772-23222794 CCAGGACAGGAATTCTGCCCAGG - Intronic
1181493742 22:23276450-23276472 CCTGGATCTGCATCCTCCCCAGG + Intronic
1181727270 22:24820240-24820262 CCTTGACCAGAAGGCTCCCCCGG - Intronic
1184373485 22:44097431-44097453 CCTGGACATGAAACCCCCGCAGG - Intronic
950336324 3:12196797-12196819 TGTGTAAATGAATGCTCCCCAGG + Intergenic
953449861 3:42997064-42997086 CCTGGACATGATTCCAGCCCAGG - Intronic
956583237 3:70836977-70836999 CCTGGAGATGAGTGCTCTCTGGG - Intergenic
960907991 3:122620769-122620791 CCTGGTCATGGGTGCTCCTCAGG + Intronic
961201054 3:125045738-125045760 GTTGGTCATGAATGCTTCCCGGG - Intronic
967165088 3:186773152-186773174 CTGGGACATGAATGCACCCCAGG - Intergenic
968252964 3:197239356-197239378 CCTGGACCTGAAGGCTTCACTGG + Intronic
968809122 4:2792306-2792328 CCTGGCCCTGAGAGCTCCCCAGG + Intergenic
969560338 4:7942615-7942637 CCTGGAAATGGATTCTGCCCTGG + Intergenic
970322569 4:14889446-14889468 CCTAGACATGAAGCCTTCCCTGG + Intergenic
981031390 4:140129010-140129032 CCTGGACATTATTGCTCCTGAGG - Intronic
982106713 4:152017701-152017723 CATGAAAATGAATGTTCCCCAGG - Intergenic
982758351 4:159251131-159251153 CCTGCACTTGAATTCTCGCCAGG + Intronic
983865237 4:172758742-172758764 CCAGGACATGAATCATCCCTTGG + Intronic
988662704 5:33290726-33290748 CATGCACATGAATGATCCCATGG - Intergenic
989561330 5:42855475-42855497 GCTGGACATGAATACCACCCAGG - Intronic
991980628 5:72226786-72226808 TCTGGACATGAATGTTTCTCTGG + Intronic
995754740 5:115491033-115491055 CCTGGACAGGAGGGCCCCCCTGG - Intergenic
1001028492 5:168244503-168244525 CCTGGTCATAAATGATCCTCAGG - Exonic
1001542862 5:172551358-172551380 GCTGGCCAAGAATGCTGCCCTGG - Intergenic
1002025468 5:176393657-176393679 CTGGGGCATGAATGCTCCACTGG + Intronic
1003308400 6:4948319-4948341 CCTGGAGCTGAATGCTGCTCAGG + Intronic
1004381071 6:15133034-15133056 CCTGGATCTGATTCCTCCCCAGG - Intergenic
1004440579 6:15647790-15647812 CCTGGACTTGATTGCTTCACTGG + Intronic
1006662260 6:35657369-35657391 CCAGGAGATGAGTGCTCTCCCGG - Intronic
1006734837 6:36266172-36266194 CCTTGAGATGACTGCACCCCTGG + Intronic
1006898227 6:37484190-37484212 CCTGGCCATGAATCAGCCCCAGG - Intronic
1009588374 6:65635798-65635820 CCTGGACCTGATTGCTCCTATGG + Intronic
1013337804 6:109182590-109182612 CCTAGACATGAGTGCTCAGCAGG + Intergenic
1017340364 6:153314452-153314474 CCTGGATAAGAATCCTCTCCTGG + Intergenic
1018636328 6:165862303-165862325 CTTGGACATGAAACCTTCCCTGG - Intronic
1019421453 7:953113-953135 CCTGTTCAGGAACGCTCCCCAGG - Intronic
1019621798 7:1996142-1996164 CCTGGGCATGCAGGGTCCCCCGG + Intronic
1020349625 7:7204187-7204209 CCTGGACATGATGGCTTCACTGG - Intronic
1032513351 7:132489423-132489445 CCTGGACATGAATGCTCCCCTGG - Exonic
1034364616 7:150535620-150535642 TCTAGACATGAAGGCTCCACTGG - Intergenic
1035371523 7:158382150-158382172 CCTGCACATGTATGCCCACCAGG - Intronic
1036169068 8:6465562-6465584 CCTGGGAAGAAATGCTCCCCGGG + Intronic
1037695340 8:21218539-21218561 CCTTGACATGGACGTTCCCCAGG - Intergenic
1040940816 8:52830896-52830918 CCTTGAGATGAATGCAGCCCAGG + Intergenic
1045489587 8:102657920-102657942 CCTGGATCTGATTGTTCCCCAGG + Intergenic
1046080164 8:109362101-109362123 CTTGGTCATTAATCCTCCCCAGG - Intergenic
1049683940 8:143931779-143931801 CTTGGACAGGGGTGCTCCCCAGG - Intronic
1050924967 9:11253124-11253146 CCTGGACCTGATTGCTTCACTGG + Intergenic
1051140117 9:13969713-13969735 CCTTGACATGACTGCAGCCCTGG - Intergenic
1052830955 9:33215130-33215152 CCTGAAAATGAATGCTCACCTGG + Intergenic
1055086419 9:72318534-72318556 GCTGGAAATGAATTCTCCTCTGG + Intergenic
1055858373 9:80719242-80719264 CCTGGAAATGAATAGTTCCCAGG + Intergenic
1056570443 9:87810085-87810107 CCTGGAGACAAATTCTCCCCTGG + Intergenic
1060133236 9:121125783-121125805 CCTGGCCTTTAATGGTCCCCAGG - Exonic
1062017111 9:134296536-134296558 CCTGGAGGTGGGTGCTCCCCAGG - Intergenic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1190834493 X:54087843-54087865 CATGGACAGCAATGCTCCCAAGG + Exonic
1193523181 X:82555739-82555761 CCTGGACCTGAATGATCCTGGGG + Intergenic
1193560098 X:83008032-83008054 CCTGGACATGCCTGGTCCCCAGG + Intergenic
1195879151 X:109574714-109574736 CGTAGACATGAATGCTGCCAAGG - Intergenic