ID: 1032513725

View in Genome Browser
Species Human (GRCh38)
Location 7:132491960-132491982
Sequence CACCCCAGGCTGCCCTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 1, 2: 0, 3: 29, 4: 285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032513725_1032513736 25 Left 1032513725 7:132491960-132491982 CCTTCCAAGGGCAGCCTGGGGTG 0: 1
1: 1
2: 0
3: 29
4: 285
Right 1032513736 7:132492008-132492030 GTTCCTGCTTCTGGTTCACAAGG No data
1032513725_1032513734 16 Left 1032513725 7:132491960-132491982 CCTTCCAAGGGCAGCCTGGGGTG 0: 1
1: 1
2: 0
3: 29
4: 285
Right 1032513734 7:132491999-132492021 CCCTTGAATGTTCCTGCTTCTGG No data
1032513725_1032513731 -7 Left 1032513725 7:132491960-132491982 CCTTCCAAGGGCAGCCTGGGGTG 0: 1
1: 1
2: 0
3: 29
4: 285
Right 1032513731 7:132491976-132491998 TGGGGTGCTAGGGGTCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032513725 Original CRISPR CACCCCAGGCTGCCCTTGGA AGG (reversed) Intronic
900157850 1:1210745-1210767 CACCCCTTGCTGCACCTGGAAGG - Intergenic
900312550 1:2041206-2041228 CACCCCAAGCGTCCCTGGGAAGG + Intergenic
900933660 1:5752101-5752123 CAGCCCCTGCTGCCCTGGGACGG - Intergenic
902797304 1:18807977-18807999 TTCCCTAGGCTGCCCCTGGAAGG + Intergenic
903233381 1:21935263-21935285 CACCCCAGGCTGCTGGTGGTGGG - Intronic
903623401 1:24714532-24714554 CACCCCAGGCTCCGTCTGGAAGG + Intergenic
904430376 1:30460349-30460371 GACCCCAGGCTGAACTTGAATGG - Intergenic
905106501 1:35566224-35566246 TGCCCCAGGTTGCCCTAGGATGG - Exonic
905285813 1:36879667-36879689 GAGCCCAGGCTGGACTTGGAAGG + Intronic
905894362 1:41535416-41535438 CACCCAAGGCAGCCCTTTGGAGG + Intronic
906656004 1:47548787-47548809 CACTCCAGGCTTCCAGTGGAGGG + Intergenic
906704112 1:47882235-47882257 CTCCCCATGCTGCCGTTGCATGG + Intronic
907470177 1:54668697-54668719 CACCCCAAGCTCCCCTTGTGGGG + Intronic
907751469 1:57267537-57267559 CTCCAGAGGCTGCCCTTGGGAGG - Intronic
907883509 1:58572898-58572920 GACCTGGGGCTGCCCTTGGAAGG - Intergenic
909869590 1:80722784-80722806 CTCCACAAGCTGCCCCTGGAAGG - Intergenic
915325126 1:155078118-155078140 CAACCCTGGCTGCCCCGGGAGGG + Intergenic
916723795 1:167505073-167505095 CACCAGAGGAAGCCCTTGGAAGG - Intronic
916764083 1:167843602-167843624 CTTCCCAGGGTGCCCTTGGGAGG - Intronic
920380892 1:205534014-205534036 GACCCCAGGCTACCCCTGGGAGG - Intergenic
921055153 1:211537714-211537736 CTCCCCAGCCTGCCCTGGGAAGG - Intergenic
922890992 1:229061968-229061990 CTCCCCAGGCTGCCACTGAAGGG - Intergenic
922894916 1:229092447-229092469 CTCTCCTGGCTCCCCTTGGAGGG - Intergenic
924029128 1:239868965-239868987 CACCCCAGGCTCTCCTTGTAAGG - Intronic
1063974860 10:11406950-11406972 CACCCCAGTCCGCCCTGGGAGGG - Intergenic
1066591342 10:36998047-36998069 CACCCCTGGCTGGCCTTAGCTGG - Intergenic
1067069971 10:43124164-43124186 CAGCCCAGGCTGCCCCTGCCTGG - Intronic
1069610227 10:69767976-69767998 CACCTCTTGCTGCCCTTGGCTGG - Intergenic
1069890070 10:71647023-71647045 CACCCCCAGCTGCCCATGGCTGG + Intronic
1070319353 10:75343275-75343297 CAGCCCAGGCTGCTGTGGGATGG + Intergenic
1071291647 10:84193575-84193597 CTTCCCAGGATGCCCTTGGGTGG - Intergenic
1071411646 10:85402808-85402830 CACCCAAGGGTGTCCTTGGCAGG + Intergenic
1072578525 10:96720750-96720772 CACCTCGGGCTGCCCTTTGGTGG - Intergenic
1072685258 10:97532904-97532926 GACTCCAGGCTGCCCTTGGTAGG - Intronic
1072741457 10:97912460-97912482 CAACCAAGGCTGCCCTTTGGGGG - Intronic
1073242402 10:102067010-102067032 CACCCCAGGCTGCTGTAGGAAGG - Exonic
1073393312 10:103197270-103197292 CACCCCACTGTGGCCTTGGATGG + Intergenic
1075056438 10:119222374-119222396 CAGCACAGGCAGCACTTGGAGGG - Intronic
1075213939 10:120515590-120515612 TACCGCAGGCTGCCCTTGTGTGG + Intronic
1075489742 10:122856492-122856514 TCCCCCAGGCTGCCCCTTGAAGG - Intronic
1075521579 10:123146711-123146733 CACCCTTGGCTGCACTTGGGGGG + Intergenic
1075909939 10:126115479-126115501 GAACCCAGGCTGCCCCTCGAAGG - Intronic
1076236239 10:128865363-128865385 AAAGCCAGGCTGCCCATGGAAGG + Intergenic
1076348805 10:129800701-129800723 AAACACAGGCTGGCCTTGGATGG - Intergenic
1076357806 10:129865641-129865663 CACCCCAGGGTGTGCCTGGATGG - Intronic
1076410083 10:130242777-130242799 CACCACAGGCTTCCCCAGGAGGG - Intergenic
1076481294 10:130786750-130786772 CTCCCCAGTGTCCCCTTGGAGGG + Intergenic
1076493756 10:130883145-130883167 TACCCCAAGAAGCCCTTGGATGG - Intergenic
1076539695 10:131206322-131206344 CACTCCAGGACCCCCTTGGAGGG - Intronic
1076598977 10:131645024-131645046 GACCCCGGGCTGCCTTTGGAAGG + Intergenic
1077052807 11:575445-575467 CAGCCCAGGCAGCCCCTGCACGG + Intergenic
1077092738 11:787029-787051 CACCCCAGGCTTTCCAGGGAGGG - Intergenic
1077464166 11:2725691-2725713 TTCCCCAGGCTGCCCTCGGCTGG - Intronic
1078546790 11:12252785-12252807 AACCCAAGACTGCCCTTGGGAGG - Intronic
1078758707 11:14234635-14234657 CACCGGAGGCAGCCCTTGGGCGG + Intronic
1079027661 11:16961540-16961562 CACCCCTGGCTGTGCCTGGAGGG + Intronic
1079648909 11:22901880-22901902 TGCCCTAGGCTGCTCTTGGAGGG + Intergenic
1083125269 11:60559438-60559460 CAACAGAGGCTGCCTTTGGAGGG - Intergenic
1083644951 11:64166550-64166572 CACCCCAGCCTGCCCTCCTAGGG + Intergenic
1083800646 11:65044536-65044558 GCCCACGGGCTGCCCTTGGACGG + Exonic
1084297994 11:68225696-68225718 CATGCCAGGCTGTCCTGGGAAGG + Intergenic
1084447719 11:69213364-69213386 CACCCCTGGCAGCTCTTGGGAGG - Intergenic
1084744267 11:71157980-71158002 CCCCCCAGGCTGTCCGTGGCTGG - Intronic
1085456214 11:76666657-76666679 CACCCCTGGCTGCTCTTAGAGGG - Intronic
1086581790 11:88408359-88408381 TAGCCCAGGATGCCCTTGAAGGG + Intergenic
1088115124 11:106304374-106304396 CAGCCCAGGATTCCCCTGGATGG + Intergenic
1089190306 11:116648793-116648815 CAGCCCAGGCTGCCCTGGCAAGG + Intergenic
1089494943 11:118903137-118903159 CACCCCACCCTGCCCCTGCACGG + Intronic
1089628069 11:119764320-119764342 CAATCCAGGCTGCCCTTAAAAGG + Intergenic
1091821838 12:3481245-3481267 CCCCCAAGGCTTCCCTTGCATGG + Intronic
1092635159 12:10437780-10437802 CTTCACAGGCTGCCCTTTGAAGG + Intronic
1093641145 12:21527930-21527952 CAACCCGGGCTGCCCTCGGGCGG - Intronic
1096522312 12:52191374-52191396 GACCCCAGGATGGCCTTTGAGGG - Intronic
1099422063 12:82473546-82473568 CCCTACAGGCTGCCCCTGGAGGG - Intronic
1099453726 12:82839207-82839229 CTCCCCAGGATGCCCTCAGAGGG + Intronic
1101060131 12:100962538-100962560 CACCCTGGGGTGGCCTTGGAGGG - Intronic
1101745470 12:107538203-107538225 CACACCACGCTGCCCTGTGAAGG - Intronic
1103118754 12:118362404-118362426 CACCCCAGGATGGCTTTGAATGG - Intronic
1103608771 12:122108014-122108036 CAGGCCAGGCTGCCCTTCGCAGG - Intronic
1103870902 12:124090904-124090926 CACCTAAGGCTGCCCTTGTCAGG + Intronic
1103945987 12:124526696-124526718 CACCCCAGGCTGGCTTTGCTGGG - Intronic
1104809345 12:131611168-131611190 CACTCCAGCCTGCCCTGTGAAGG - Intergenic
1104814358 12:131637407-131637429 CACCCCAACATGCCCTTGGGTGG + Intergenic
1106379678 13:29224052-29224074 CACACCTGGTTGCCCTTGGCAGG + Intronic
1107132509 13:36911599-36911621 CCCCCCAGGCAGCCTTTGGCCGG - Intronic
1113460634 13:110479670-110479692 CCCAGCAGGCAGCCCTTGGACGG + Intronic
1115648870 14:35388911-35388933 CACCACGGCCTTCCCTTGGAGGG + Intergenic
1117827397 14:59717960-59717982 CACCCCAGGATTTCCTAGGAAGG - Intronic
1118159474 14:63274134-63274156 CAACCCAGGCTCCACTTGGAAGG + Intronic
1119483334 14:74973460-74973482 CAGCCCAGGCTGCACGTGGCTGG + Intergenic
1119668188 14:76499379-76499401 CCCCCCGGGGTGCTCTTGGATGG - Intronic
1122470412 14:101962303-101962325 CACCCCAAGCTGACCCTGGTGGG - Intergenic
1122863752 14:104594362-104594384 GACCCCAGGCTGGCCTCTGAAGG - Intronic
1122881734 14:104693356-104693378 GCCCCCAGGCAGCCCTTGGTGGG + Intronic
1123125144 14:105940911-105940933 CACCCCAGGATGGGGTTGGATGG + Intergenic
1123667259 15:22617488-22617510 CACCCCAGGGTGACTTTGGGTGG - Intergenic
1123945259 15:25235842-25235864 CACCCCATTCTCCCCATGGAGGG + Intergenic
1124215941 15:27807123-27807145 TCACCCAGGCTGCCCGTGGATGG - Intronic
1124321100 15:28712055-28712077 CACCCCAGGGTGACTTTGGGTGG - Intronic
1124481398 15:30083300-30083322 CACCCCAGGGTGACTTTGGGTGG + Intronic
1124487853 15:30135396-30135418 CACCCCAGGGTGACTTTGGGTGG + Intronic
1124522196 15:30413894-30413916 CACCCCAGGGTGACTTTGGGTGG - Intronic
1124536469 15:30552324-30552346 CACCCCAGGGTGACTTTGGGTGG + Intronic
1124542942 15:30604373-30604395 CACCCCAGGGTGACTTTGGGTGG + Intronic
1124755676 15:32402925-32402947 CACCCCAGGGTGACTTTGGGTGG - Intronic
1124762182 15:32455268-32455290 CACCCCAGGGTGACTTTGGGTGG - Intronic
1124776447 15:32593800-32593822 CACCCCAGGGTGACTTTGGGTGG + Intronic
1125719057 15:41836387-41836409 CACCCCAGCCAGCCCTGGGCAGG - Intronic
1125746473 15:42000673-42000695 CACCCCATGTTGCCCATGCAAGG - Intronic
1127257746 15:57306396-57306418 CCCCCCAGGCTGTCTCTGGAGGG + Intergenic
1127260019 15:57320607-57320629 CTCCCCAGGCTGCTCTGGGGGGG - Intergenic
1128144497 15:65325206-65325228 CTCCCCAGGCTGCCCTTGGATGG + Intergenic
1128643548 15:69358478-69358500 CACCAGAGGCTGCCCCTGGACGG - Intronic
1129153784 15:73704947-73704969 CCACCCAGGCAGCCGTTGGATGG + Intronic
1129389633 15:75214112-75214134 CACCCCAACCTGGCCTTGGCAGG + Intergenic
1129453568 15:75664118-75664140 CGCACCAGGCTGCCTTTTGAAGG + Intergenic
1129474513 15:75775876-75775898 CACCCCAGGGTGACTTTGGGTGG + Intergenic
1130483921 15:84387120-84387142 CACCCCAGGGTGACTTTGGGCGG + Intergenic
1131144148 15:90000842-90000864 CGCCCCTGGCTTCCCTTGGGGGG + Intergenic
1132669071 16:1095337-1095359 CACCCCAGGCCAGCCTTGGGGGG - Intronic
1132746601 16:1438812-1438834 CACCTCATGCTGCCCCTGCAGGG + Exonic
1132853314 16:2034387-2034409 GCCCCCAGGCTGGCCTGGGACGG - Intronic
1132853340 16:2034460-2034482 GCCCCCAGGCTGGCCTGGGACGG - Intronic
1132853366 16:2034533-2034555 GCCCCCAGGCTGGCCTGGGACGG - Intronic
1132853393 16:2034606-2034628 GCCCCCAGGCTGGCCTGGGACGG - Intronic
1132853419 16:2034679-2034701 GCCCCCAGGCTGGCCTGGGACGG - Intronic
1132853446 16:2034752-2034774 GCCCCCAGGCTGGCCTGGGACGG - Intronic
1133361113 16:5174448-5174470 CACCCCCAGCTGCCTTTGGCTGG - Intergenic
1133565849 16:6992542-6992564 GAACCCAAGCTGACCTTGGAAGG - Intronic
1136110605 16:28062257-28062279 CAGCCCAGGCTGCCTCTGGAGGG + Intronic
1136143410 16:28301468-28301490 AACCCCAGACTGCCCCTGGTGGG + Intronic
1136746441 16:32595829-32595851 CACTCCAAGCTGTCCTTAGAGGG + Intergenic
1137721626 16:50630750-50630772 CACGCCAGGCAGCCCTGGGGAGG + Intronic
1137983142 16:53086492-53086514 CGCCCCAGACTAACCTTGGAAGG + Intronic
1138117826 16:54374402-54374424 GACCACATGCTGCCCCTGGAGGG - Intergenic
1138237780 16:55399750-55399772 CGCCTCAGCCTGCCCTTGCAAGG - Intronic
1138348698 16:56335171-56335193 CCCCCCAAGGTGACCTTGGAAGG - Intronic
1139422439 16:66856923-66856945 CACCACTGGCTGCCCAGGGAGGG - Intronic
1140125301 16:72113135-72113157 CACCCCAGCCTTCCCTGGGGTGG + Intronic
1141990419 16:87606070-87606092 GTCCCCAGGCAGCCCATGGAAGG + Intronic
1142108679 16:88319574-88319596 CTCCCCAGGCTGCCCTCCTAGGG + Intergenic
1142157586 16:88539692-88539714 CACCCCAGCCTGCCTGAGGAAGG + Intergenic
1142378680 16:89720210-89720232 CACACCCGGCTGCCCAAGGAGGG - Intronic
1203048570 16_KI270728v1_random:855033-855055 CACTCCAAGCTGTCCTTAGAGGG + Intergenic
1143554597 17:7652296-7652318 CTCCCCAGGCTGACCATGGCAGG + Intronic
1144384727 17:14738760-14738782 CATCCCAGGCTGGGATTGGATGG - Intergenic
1144701530 17:17343954-17343976 CACCCCTGGCTGCACTGGGGTGG + Intronic
1144737236 17:17561954-17561976 CACCCCAGGCTCCGGTGGGAGGG + Intronic
1145869245 17:28259926-28259948 TTCCCTAGGCTGCCCTTGGGGGG + Intergenic
1146281485 17:31547994-31548016 AATCCCAGGCTTCCCTTGGGAGG - Intergenic
1146484147 17:33229831-33229853 CAGCCCTGGCTGCTCCTGGAGGG + Intronic
1146669064 17:34724366-34724388 ACTCCCAGGCTGCCCTTGGCTGG + Intergenic
1147306302 17:39566734-39566756 CACCCCAGGCAGCACTAGAAGGG + Intergenic
1148189975 17:45671721-45671743 TACCATAGGCAGCCCTTGGAGGG + Intergenic
1148736109 17:49865796-49865818 CACTCCAGCCTGTGCTTGGAAGG + Intergenic
1150295797 17:64006721-64006743 CCCTCCAGGCAGCCCTTGGCTGG - Exonic
1151234765 17:72711759-72711781 CTCCCCTGGCTGCCCCTTGATGG + Intronic
1151311213 17:73293465-73293487 GACCAGAGGCTGCCCCTGGAAGG - Intronic
1151578661 17:74965203-74965225 CAGCTCAGGCTGCCCTTGCCAGG + Intronic
1151901745 17:77020447-77020469 CCCCTCAGGCTGCCCCTTGAGGG + Intergenic
1152270095 17:79319476-79319498 CTGCCCAGGCTGCTCTTGGAGGG - Intronic
1152324525 17:79627837-79627859 CTCCGCCGGCTGCCCTTGCAGGG - Intergenic
1152472853 17:80500005-80500027 CTCCCCAGGCAGCCCTAAGAGGG + Intergenic
1152637105 17:81434728-81434750 CCCCCCAGGCTGCCCTTCCAGGG - Intronic
1152719209 17:81914688-81914710 CACCACATGCTGCACCTGGAAGG + Exonic
1152904559 17:82963135-82963157 CCCCCAAGGCTGCCCGAGGATGG - Intronic
1152993696 18:386288-386310 CACCCCTGCCTGCCCATGTATGG - Intronic
1157579047 18:48762932-48762954 CAGCCCAGGCTGGCCAGGGAGGG - Intronic
1158524755 18:58202636-58202658 CACACCAGCCTCCCCCTGGAAGG + Intronic
1158534173 18:58292419-58292441 CTCCACAGGCTCCCCTGGGAGGG + Intronic
1158534196 18:58292485-58292507 CAGCCCAGGGAGCCCTTGGATGG - Intronic
1159659771 18:71079577-71079599 CACGCCAAGGTGCCCTGGGAGGG - Intergenic
1160707255 19:535441-535463 GGCTCCAGGCTCCCCTTGGATGG - Intronic
1160874353 19:1290308-1290330 CACCCCAGGATGCCCAGAGATGG - Intronic
1161483986 19:4525022-4525044 CGCCCCGGCCTGCCCTGGGAAGG - Exonic
1161542633 19:4861244-4861266 CACCCCAGGGTGCCCTGGCAGGG - Intronic
1161592632 19:5135668-5135690 CTCCCCAGGCTGCACTTTCAGGG + Intronic
1162805710 19:13137095-13137117 CTCCCCTGACTGCCCTTGGTGGG + Intronic
1163182347 19:15613507-15613529 ATCCCATGGCTGCCCTTGGAGGG + Intergenic
1163415863 19:17186115-17186137 CATCCCCGGCTGCCTCTGGATGG - Intronic
1163645344 19:18486091-18486113 CACCCCCTGCTGACCTTGGCAGG + Intronic
1167608329 19:50493499-50493521 CACCCCACCCTGACCTGGGAGGG + Intergenic
1168130065 19:54312259-54312281 CACCCCCAGCTGCCCATGGGTGG + Intronic
927047790 2:19297580-19297602 CACCCCAAGTAACCCTTGGATGG + Intergenic
927904352 2:26846801-26846823 CAGGCCAGGCTGGCCTTTGAGGG - Intergenic
928442625 2:31304814-31304836 CATCCCAGGTTCCCCTTTGAAGG + Intergenic
929547720 2:42866570-42866592 CTCCCCTGGCAGCCCTTGCAGGG - Intergenic
930457611 2:51625879-51625901 CACAACATGCTCCCCTTGGAGGG - Intergenic
931629390 2:64285368-64285390 CAGCCCTGGCTGCCCTGTGAGGG + Intergenic
932485094 2:72079903-72079925 CATCCCAGCCCACCCTTGGATGG - Intergenic
932577304 2:72969871-72969893 CACCCCAGGAATCCCTTGGGAGG - Intronic
936008389 2:108909574-108909596 CACTGCAGGCTGCGCCTGGAAGG - Intronic
937155424 2:119715552-119715574 CTTCCCAGGCTGCCCTCAGAGGG + Intergenic
937976177 2:127583349-127583371 CACCCCCGGCTGGCCCTGGGAGG - Intronic
938259623 2:129885947-129885969 AACCCCAGGCAGCCTCTGGATGG - Intergenic
942004912 2:171688058-171688080 CTCCCCAGGCCGCCTCTGGAGGG - Intronic
943041554 2:182811169-182811191 CACAGCAGGCTGCCCCTGCATGG - Intergenic
946199714 2:218064650-218064672 CACCCCAGGCAGCTTTAGGAGGG + Intronic
946949032 2:224852024-224852046 CACCCCAGCCGGCCCTCGTATGG - Intronic
948233577 2:236370258-236370280 CACCCCAGGCTGCACCTGCACGG - Intronic
948459481 2:238122239-238122261 CACCCCTGGCTCCCATAGGAAGG - Intronic
1168799860 20:637473-637495 CTCCCCAGGCTGCCCTTCTCTGG + Intergenic
1169316172 20:4592664-4592686 CACTCCAGGCTGCCTTGGGGAGG - Intergenic
1170480655 20:16761861-16761883 CACCCCATGGTGCCCCTGGAGGG - Intronic
1170594753 20:17796726-17796748 GACCCCAGGATGCACTGGGAGGG - Intergenic
1171492610 20:25532023-25532045 GAGCCCTGGCTGCCCTTAGAAGG + Intronic
1172042636 20:32056715-32056737 CAAACCAGGCTGCCCTCTGAGGG + Intronic
1172527194 20:35607049-35607071 AACCCCAGGTTGGACTTGGATGG + Intergenic
1173566083 20:44039586-44039608 GAACCCAGGAAGCCCTTGGAGGG + Intronic
1175309736 20:58003491-58003513 CACCCCAGGCTGAGGCTGGAGGG + Intergenic
1175486590 20:59351303-59351325 CCCCGCAGGCTGCCCTTTCAGGG + Intergenic
1175923206 20:62459450-62459472 CAGCCCAGGCTCCCCGTGGCAGG - Intergenic
1175947817 20:62566859-62566881 AACCCCAGGCTGCACTGGAAGGG - Intronic
1176124246 20:63468444-63468466 CACCCCAGCCAGCCCTTCGAGGG + Intronic
1176157470 20:63628890-63628912 CACCCCAGGCCGACCTCGGTGGG - Intergenic
1176189285 20:63800317-63800339 CAGCCCAGGCAGCCCCTGGCCGG - Intronic
1176305047 21:5118916-5118938 GACCCCAGGCTGCCCTGCCACGG + Intronic
1179548557 21:42127996-42128018 CACGGCAGGCAGCCCTTGGACGG + Intronic
1179594354 21:42432095-42432117 CCCCCCAGGCTACCGTTGCAAGG + Exonic
1179635744 21:42707581-42707603 CAGCCCAGGAAGCCCTGGGAGGG - Intronic
1179852008 21:44143114-44143136 GACCCCAGGCTGCCCTGCCACGG - Intronic
1180967700 22:19799147-19799169 CACCCCAGGCAGCCCTGGTCTGG - Intronic
1181775809 22:25159376-25159398 TTCCCCGGGGTGCCCTTGGAGGG + Intronic
1182361564 22:29749473-29749495 CACCCAAGGCTCCCCAGGGAGGG + Intronic
1182421940 22:30252820-30252842 GGCCTCAGGCTGCCCTGGGAAGG - Intergenic
1182476044 22:30576867-30576889 CAGCCCTCGCTTCCCTTGGATGG - Exonic
1183706646 22:39478547-39478569 GTCCCCAGGGTGCCCTTGGCTGG - Intronic
1183922178 22:41178007-41178029 CATGCCAGGCTGCCCAGGGATGG - Exonic
1184458800 22:44625763-44625785 CAGCCCTGCCTGCCCTGGGATGG - Intergenic
1184516895 22:44967804-44967826 CTCCCCAGGCTGCCCTGGGCTGG + Intronic
1184653999 22:45932117-45932139 CTGGCCAGACTGCCCTTGGAGGG - Intronic
1184785680 22:46670549-46670571 ACCCCCAGGCTCCCCGTGGAGGG - Intronic
953554312 3:43931325-43931347 CACACCAGGCTGCCCTTCTGGGG + Intergenic
954259611 3:49429150-49429172 CACGCCAGGCCGGCCTTGGGAGG + Exonic
954390381 3:50265354-50265376 CAGTCCAGGCTGCACTGGGAGGG + Intergenic
960152162 3:114261509-114261531 GAGCCCAGGCTGCCATTGGATGG + Intergenic
961168769 3:124781064-124781086 CATCCCAGGCTGCCCTGGCTCGG - Intronic
961193553 3:124982747-124982769 CACCCCCGGCTGCAGATGGAAGG - Intronic
961332211 3:126149088-126149110 CACCAGAAGCTGCCTTTGGACGG + Intronic
961459700 3:127042639-127042661 CACTCCAGGCAGCCAGTGGAGGG - Intergenic
962352603 3:134666639-134666661 CCTCCCAGGCTGCCCTTCCAGGG - Intronic
963345934 3:144096770-144096792 CACCACAGGCTGCTTTTGGTTGG + Intergenic
968199211 3:196738118-196738140 CCCCCCAGTCTGTTCTTGGAGGG + Intergenic
968235068 3:197026588-197026610 CTCTCCAGGCTGCCCTTGCTGGG - Intronic
968549262 4:1213968-1213990 GACCCCAGGCAGCCCTGGGTTGG - Intronic
968757452 4:2424125-2424147 CACGCCAGGCTGTCCTTTTAGGG - Intronic
969706661 4:8796070-8796092 CATCCCAAGCTGCCTTTGCATGG - Intergenic
973979572 4:56296706-56296728 CAACACAGGCAGCACTTGGAGGG - Intronic
983453026 4:167930402-167930424 ATCCCAAGGCTGCCCTGGGAGGG - Intergenic
985733702 5:1565510-1565532 CACGCCAGGATGCGCTGGGATGG - Intergenic
985791563 5:1931045-1931067 CACCGCCGGCTGCCCTAGGCAGG - Intergenic
991404612 5:66289667-66289689 CTCCCCAGGGAACCCTTGGAAGG + Intergenic
995198755 5:109402912-109402934 CACCTCAGGCAGTGCTTGGAAGG + Intronic
997637913 5:135428277-135428299 CTCCCCAGGCTGCCCATGGCTGG + Intergenic
997690619 5:135825466-135825488 CCCAGCAGGGTGCCCTTGGATGG + Intergenic
998193065 5:140043176-140043198 CTCCCCGGGCTGCCGGTGGAGGG - Exonic
998566923 5:143223983-143224005 CTCCCCAGGAGCCCCTTGGATGG + Exonic
999709066 5:154300377-154300399 CAACCCTGGCTGCACCTGGATGG + Intronic
999772029 5:154783010-154783032 GTCCCCAGGCTGGCCTGGGAGGG + Intronic
1000013160 5:157252775-157252797 CAGGCCAGGCTGCCTCTGGAGGG - Exonic
1001985884 5:176074220-176074242 CACTCCAAGCTGTCCTTAGAGGG + Intronic
1002264352 5:178019844-178019866 CACTCCAAGCTGTCCTTAGAGGG + Intronic
1003160335 6:3628947-3628969 CAGCCCAGGCTGCCATTTAATGG - Intergenic
1005317924 6:24622105-24622127 CTCCCCAGGCAGCCACTGGAAGG - Intronic
1005869803 6:29966302-29966324 CATCCCAGAGTGCCCTTGGCCGG - Intergenic
1006639949 6:35484754-35484776 CACCCCAAGCTGCACATGCAGGG + Intronic
1007298219 6:40845070-40845092 CAGCCCAGCCTGGGCTTGGAGGG + Intergenic
1013710832 6:112896179-112896201 CTCCCCAGGATGCCCTTCAAGGG - Intergenic
1014206314 6:118659813-118659835 CACCCCAGCTTGCCCTAAGATGG + Intronic
1015903100 6:138087680-138087702 CAGCCCAGGGTGCTCTTGGTGGG + Intergenic
1016185826 6:141196620-141196642 AACCCCAGGCTGCCCTTGTTTGG - Intergenic
1017603129 6:156105033-156105055 CACCCAATGCTGCCCTTGACAGG + Intergenic
1017631354 6:156398968-156398990 CACCCCTGCCTGCCCCTGGATGG + Intergenic
1018391322 6:163343837-163343859 CCATCCAGGCTGCCCTTGGCCGG - Intergenic
1018952971 6:168391110-168391132 AAACACAGGCTGCCCTTGGGAGG - Intergenic
1019300322 7:299841-299863 CACCCCATGCAGCCCCAGGACGG - Intergenic
1019660389 7:2220696-2220718 CACCCCACGCCGCTCTGGGAAGG + Intronic
1020104869 7:5418064-5418086 CACCCTAGGCTGGCCCTGGAGGG - Intronic
1023207869 7:37770444-37770466 CATCTGAGCCTGCCCTTGGATGG + Intronic
1026675647 7:72425926-72425948 CATCCCAGGGTGCCCTCGGAGGG + Intronic
1027687382 7:81294798-81294820 CACCCATGGCTGCGCCTGGATGG - Intergenic
1029109816 7:98207250-98207272 TACCCCAGGCGGCCCCTGCACGG - Exonic
1029906941 7:104101962-104101984 CTCCACAGGCTGCCCTAGGGAGG - Intergenic
1030334297 7:108307841-108307863 CATCCCTGGCTGCTTTTGGAGGG - Intronic
1032513725 7:132491960-132491982 CACCCCAGGCTGCCCTTGGAAGG - Intronic
1032690479 7:134281973-134281995 GTCCCCAGAGTGCCCTTGGAGGG - Intergenic
1032692998 7:134308155-134308177 CTCCCCATCCTGCCCTTTGAGGG - Intronic
1033471241 7:141651541-141651563 AACCCCAAGCTGCACGTGGAGGG + Exonic
1033548533 7:142424401-142424423 CACCGCAGCCTGAGCTTGGATGG + Intergenic
1033615473 7:143010256-143010278 GTGCCCAGCCTGCCCTTGGAAGG + Intergenic
1034159595 7:148983236-148983258 CACCCCCGGTTCCCCGTGGAGGG - Intergenic
1034274500 7:149818108-149818130 CAGCCCAGACTGCCCTGGTAAGG + Intergenic
1034435744 7:151062073-151062095 CACCCAAGGCTGCCCAGGGAGGG - Intronic
1035289404 7:157827985-157828007 CACCCCAAGCTGCCGTCTGAGGG - Intronic
1035732650 8:1863690-1863712 CGTCTCAGGCTGTCCTTGGATGG + Intronic
1039444373 8:37619314-37619336 CACCCCCTGCTGTCCTTTGAGGG + Intergenic
1045111885 8:98944430-98944452 CTCCCCAGGCTGCCCCAGGCCGG - Exonic
1046916634 8:119684640-119684662 TACCCCAGCTGGCCCTTGGAAGG + Intergenic
1048502773 8:134993853-134993875 CACCTCAGCCTCCACTTGGAGGG + Intergenic
1049210657 8:141385041-141385063 CCCACCAGGCTCCCCATGGAGGG + Intergenic
1049358698 8:142201614-142201636 CCCCCCAGCCTCCCCCTGGAAGG + Intergenic
1049804511 8:144532826-144532848 CACTCCAGGCTACCCATGGCTGG + Intronic
1052796899 9:32931297-32931319 CACTGCAGGCTGCCCTCTGATGG - Intergenic
1053222805 9:36325959-36325981 GCCCCCAGGCAGCCCTGGGATGG + Intergenic
1053933174 9:43127188-43127210 CACTCGAGGCCGCCCTGGGAGGG - Intergenic
1057126496 9:92619865-92619887 CACCACAGTCGGCCTTTGGAAGG + Exonic
1058705205 9:107632115-107632137 CACCACAGGCTCCTCTAGGAAGG - Intergenic
1060134172 9:121135828-121135850 CACCTCATGCTGCTCTTGGAGGG - Exonic
1060661900 9:125409359-125409381 CACCCCAGGGAGCCCCTGGAGGG + Intergenic
1061842523 9:133367578-133367600 CCCCCTAGTCTGCCCTGGGAAGG - Intronic
1061881835 9:133572652-133572674 CACCCCAGGCTGTCCTTCTGGGG - Intronic
1062161000 9:135079803-135079825 CACCCCTGGATGCCCCTGGTGGG + Intronic
1062464415 9:136674859-136674881 CACCCCAGGCTGCATGTGGTTGG + Intronic
1062624687 9:137437411-137437433 CACTCCACGCAGCCCTTGGCTGG - Intronic
1197977643 X:132182552-132182574 CACACCAGGCTGCCCCTCCATGG + Intergenic
1201147929 Y:11075653-11075675 CCCCCCAGGCTGTCCGTGGCTGG - Intergenic