ID: 1032514048

View in Genome Browser
Species Human (GRCh38)
Location 7:132493880-132493902
Sequence CAGGATTAAGTGGCAGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 431}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032514048 Original CRISPR CAGGATTAAGTGGCAGAGTT GGG (reversed) Intronic
901107759 1:6770603-6770625 CAAGAAAAAGTGGCAGAGGTGGG + Intergenic
901468359 1:9438220-9438242 CAGGATTACGAGGCTGAGTGCGG + Intergenic
901489629 1:9589930-9589952 CAGCAGCAAGTGGCAGAGCTGGG + Intronic
902204686 1:14859388-14859410 CAGCAGGAAGTGGCAGAGCTGGG + Intronic
902798282 1:18813934-18813956 CAAGAATCAGTGGCTGAGTTAGG - Intergenic
902830027 1:19006467-19006489 CAGAACTAAATGGCAGAGCTGGG + Intergenic
902990963 1:20186599-20186621 CAGGCTTAAGAGGCAGAGGAGGG - Intronic
903582831 1:24385078-24385100 CAGGCCTGAGTGGCAGAGATTGG - Intronic
903898867 1:26628009-26628031 AACAATTTAGTGGCAGAGTTAGG + Intergenic
903919476 1:26789013-26789035 CATGGTCAAGTGGCAGAGGTGGG + Intronic
903998957 1:27327004-27327026 AAGGATTAGGGGGCAGAGATGGG + Intronic
904866619 1:33584257-33584279 CATTAGTAAGTGGCAGAGGTGGG - Intronic
904901205 1:33858475-33858497 CAGCAATAAGTGGCAGAGCCAGG - Intronic
905392246 1:37644266-37644288 CAAGATTAAGAGGCAGAGCGGGG - Intergenic
906126785 1:43431841-43431863 CAAAACTCAGTGGCAGAGTTTGG - Exonic
906154639 1:43606742-43606764 CAGGATTAATAGGCAGAGGGTGG + Intronic
906560303 1:46751737-46751759 CAGGGATAGCTGGCAGAGTTGGG - Intergenic
906704269 1:47883222-47883244 CTGGGTTAAGCAGCAGAGTTGGG + Intronic
907724742 1:57008853-57008875 CACTATTAAGTAGCTGAGTTAGG + Intronic
909057868 1:70844383-70844405 CAGGAAAAAGTGGGAAAGTTTGG + Intergenic
909092633 1:71245793-71245815 CAGTTTTAAGTGGCAGAGCAAGG - Intergenic
910438752 1:87231244-87231266 CAGGAGTAAGTGGCTGGGGTAGG - Intergenic
911094930 1:94047430-94047452 TAGGCATGAGTGGCAGAGTTGGG + Intronic
911638536 1:100263426-100263448 AACAATAAAGTGGCAGAGTTGGG - Intergenic
911701228 1:100954260-100954282 TAAGAGTTAGTGGCAGAGTTGGG - Intronic
911765530 1:101670094-101670116 CATGATGTAGTGGCAGAGTCTGG - Intergenic
911818776 1:102389131-102389153 AAGTAATAAGTGGCAGAGCTAGG + Intergenic
912603810 1:110966738-110966760 CAGGATTACCTGCCAGTGTTGGG + Intergenic
912793369 1:112674778-112674800 CAGGATCAGGGGTCAGAGTTAGG + Intronic
914340103 1:146753037-146753059 CAGTTTTAAGTGGCAGAATCAGG + Intergenic
915826936 1:159087894-159087916 TAGTGATAAGTGGCAGAGTTTGG + Intronic
915936386 1:160092482-160092504 CAGGATGGTGTGGCAGAGCTGGG - Exonic
916261651 1:162848287-162848309 TAGGATTAAATGGCAAAGTATGG + Intronic
916470589 1:165118845-165118867 CAGGAATCAGTGGCAGAATTTGG + Intergenic
917649627 1:177063770-177063792 CAGGGTTAGGAGACAGAGTTTGG - Intronic
918250257 1:182697083-182697105 CAGTAAAAAGTGGCAGAGTGAGG - Intergenic
918422661 1:184379762-184379784 CAGCTATAAGTGGCAGAGCTGGG - Intergenic
918841048 1:189540076-189540098 CAGGACTAAGTACTAGAGTTAGG - Intergenic
919251301 1:195059770-195059792 CAGGAATGAGGGGAAGAGTTGGG + Intergenic
919526805 1:198663686-198663708 AAGCAGTAAGTGGCAGAGTTGGG - Intronic
920209513 1:204317838-204317860 AAAGATTAAGTGGCTGAGTCAGG - Intronic
921069667 1:211648686-211648708 CATGATTAAGTGGCTGGATTTGG + Intergenic
921425215 1:214993526-214993548 CACTAGTAAGTGGCAGAGCTAGG + Intergenic
921760301 1:218905990-218906012 CAGGATAAAGAGGCAGAGAATGG - Intergenic
921878249 1:220224236-220224258 AATTAGTAAGTGGCAGAGTTGGG + Intronic
922362804 1:224838654-224838676 GAGGCTTGTGTGGCAGAGTTGGG - Intergenic
922512441 1:226180458-226180480 CAAAATTAAGTGGCAGAGCAAGG + Intronic
922898486 1:229118746-229118768 CAGGTGAAACTGGCAGAGTTGGG + Intergenic
923396583 1:233571737-233571759 AAGTAGTAAGTAGCAGAGTTGGG + Intergenic
1064503212 10:15997514-15997536 CAGCACTTACTGGCAGAGTTAGG + Intergenic
1065405256 10:25356911-25356933 CAGGAAAATGTGGGAGAGTTTGG + Intronic
1066752784 10:38676146-38676168 CAGGATTAAATGACAGAATCTGG + Intergenic
1068501936 10:57850662-57850684 GAGGATTAAGTGGAAGAGCCAGG + Intergenic
1069125798 10:64631165-64631187 TAGGACTAAGTGAAAGAGTTTGG + Intergenic
1073129514 10:101178113-101178135 CAGGAATAAGAGTCAGGGTTGGG - Intergenic
1074043029 10:109810966-109810988 CAGGATAATGTGGGAAAGTTTGG - Intergenic
1074161937 10:110842753-110842775 GACCAGTAAGTGGCAGAGTTGGG + Intergenic
1074540985 10:114364991-114365013 CAGGATGAAGAGCCAGAGTCCGG + Intronic
1075782912 10:125028302-125028324 CAGGAATCAGTGGCAGGGGTGGG - Intronic
1077629925 11:3804477-3804499 CAGGAGGCAGTGGCAGAGCTTGG + Intronic
1077922068 11:6648913-6648935 CATGCTTAAGTGGCCGAGTCAGG - Intronic
1078051916 11:7972825-7972847 CATGCTTAAGTGGCATATTTTGG + Intronic
1078497629 11:11835219-11835241 ATGGAGGAAGTGGCAGAGTTTGG + Intergenic
1079942836 11:26703322-26703344 CAGCAGGAAGTGGCAGAGGTGGG - Intronic
1080750139 11:35143504-35143526 CAGGATCCAGTGGTGGAGTTGGG + Intronic
1083902799 11:65651823-65651845 CAGGAAAAAGTGGCAGTCTTGGG - Intergenic
1084574649 11:69981259-69981281 CAGCAGTAAGTGGGAGAGTGGGG - Intergenic
1085121674 11:73971386-73971408 CAGGAGAAAGTGGCAGGGCTGGG - Intergenic
1085213094 11:74800445-74800467 CACTATTAAGTGGCAGAGCCAGG - Intronic
1085230239 11:74961372-74961394 CAGTATTAAGTGGAAAAGTGAGG + Intronic
1086054953 11:82635656-82635678 AACAATAAAGTGGCAGAGTTGGG - Intergenic
1087105451 11:94402712-94402734 CAGGATTAAATGGCTGAAATAGG + Intergenic
1087302960 11:96456988-96457010 CAGGAATACGAGGCAAAGTTTGG + Intronic
1087541802 11:99531059-99531081 CAGGAAAATGTGGAAGAGTTTGG + Intronic
1087550350 11:99640130-99640152 CAGGAAAATGTGGGAGAGTTTGG - Intronic
1088501555 11:110488401-110488423 AACTATTAAGTGGCAGAATTGGG + Intergenic
1088559131 11:111095230-111095252 CAGAATCAAGTGGCAAAATTGGG - Intergenic
1088604865 11:111519063-111519085 AAATAGTAAGTGGCAGAGTTAGG - Intronic
1089090692 11:115872375-115872397 CAGCATTGAGAGGCAGAATTTGG - Intergenic
1089190878 11:116652418-116652440 CAGTAGAAAGTGGCAGAGCTGGG + Intergenic
1089412574 11:118258785-118258807 CAGGAGAAAGTGAGAGAGTTGGG - Intronic
1089968721 11:122675090-122675112 CATGATTAAGTGGCAGAGCTGGG + Intronic
1091168872 11:133503180-133503202 CACCTTTAAGTAGCAGAGTTAGG + Intronic
1091663603 12:2402505-2402527 CAGCAGCAAGTGGCAGAGTGAGG - Intronic
1091719238 12:2800605-2800627 CAGCATTCACAGGCAGAGTTGGG + Intronic
1091900044 12:4137247-4137269 GACCATTAAGTGGCAGAGTGGGG + Intergenic
1092072415 12:5642382-5642404 AAGGAATAACTGGCAGATTTTGG + Intronic
1092099058 12:5868344-5868366 AGGGAGTAAGTGGCAGAGCTGGG - Intronic
1092139197 12:6171310-6171332 CAGCAGTAAGTGGCAGAGTCAGG - Intergenic
1093127165 12:15344472-15344494 TAGTCTTAAGTGGCTGAGTTAGG - Intronic
1093438579 12:19166065-19166087 AGGCAGTAAGTGGCAGAGTTGGG + Intronic
1094419013 12:30250894-30250916 CAGAATTAAGTGCCTGAATTTGG - Intergenic
1094638521 12:32250177-32250199 CAGGATTAAGTGGTTGAGATGGG + Intronic
1096105597 12:48995536-48995558 TAGGATTGAGTGGCAGAGCCGGG + Exonic
1096183733 12:49565314-49565336 CAGGATGCAATGGCAGGGTTGGG + Intronic
1096491935 12:52017515-52017537 CAGGATATAGTTGCAGAGGTTGG - Intergenic
1096814331 12:54192147-54192169 CATGAGTAAGTGGCAGAGCTTGG - Intergenic
1097032211 12:56097863-56097885 CAGGTTCAGGTGGCAGATTTTGG + Exonic
1098150273 12:67539331-67539353 CACGTCTCAGTGGCAGAGTTGGG - Intergenic
1100767681 12:97885817-97885839 CATGACTAATTGGCAGAGTCAGG - Intergenic
1101190355 12:102326126-102326148 CAGGAAGAAGTGGGAAAGTTTGG + Intergenic
1101346965 12:103894788-103894810 CTAGCTTAAGTGGCAGAGCTGGG + Intergenic
1101436628 12:104669820-104669842 GAGGAGGAAGTGGCAGAGCTGGG - Intronic
1102080360 12:110092894-110092916 GAAGATTAAGCGGCAGAGATGGG - Intergenic
1102234302 12:111284657-111284679 AATGAGTAAGTGGCAGAGATGGG + Intronic
1102393695 12:112570020-112570042 CAGGGTCAAGTGGTAGAGCTAGG + Intergenic
1102452866 12:113054795-113054817 AAGGAGTAAGTGGCAGAGCTAGG - Intergenic
1102594222 12:113980149-113980171 CAGCATGAAGTGTCAGAGATGGG - Intergenic
1102738952 12:115188897-115188919 CAAGACTCAGTGGCAGAGCTGGG - Intergenic
1102884349 12:116510286-116510308 CACTAGTAAGTGGCAGAGATGGG - Intergenic
1103156339 12:118688342-118688364 CATGACTAAGTGGCAGACCTGGG + Intergenic
1103462388 12:121115345-121115367 CAAGATGAAGGGGCAGAGCTGGG + Intergenic
1104542990 12:129684704-129684726 CAGGAATATGTGGAAAAGTTTGG + Intronic
1105488118 13:20857790-20857812 CAGAGTTAAGTGGCAGAAGTAGG + Intronic
1107678316 13:42819515-42819537 CAGGAATATGTGGAAAAGTTTGG - Intergenic
1108544482 13:51478811-51478833 CAAGATTGAGCGGCAGAGTGAGG - Intergenic
1108944471 13:56003676-56003698 CAGGATAATGTGGAAAAGTTTGG - Intergenic
1109169355 13:59076467-59076489 CAGGAAAATGTGGGAGAGTTTGG - Intergenic
1109609716 13:64748552-64748574 CAGCATTAAGGGGCAGAATTGGG - Intergenic
1110596833 13:77328757-77328779 AAGTATTAAGTAGCAGAGTCAGG - Intergenic
1112743055 13:102496360-102496382 CAGGAATACGTGGAAAAGTTTGG - Intergenic
1113424712 13:110198519-110198541 CAGGACCAAGTGGAAGAGATGGG - Exonic
1114416882 14:22550782-22550804 CAGGAAGAAGTAGGAGAGTTTGG - Intergenic
1114986188 14:28231472-28231494 CAGGAATATGTGGGACAGTTTGG - Intergenic
1115199214 14:30835100-30835122 CAGGAAAATGTGGCAAAGTTTGG - Intergenic
1115227742 14:31121932-31121954 CAGAGTTAAGTGGAAGAGTGAGG - Intronic
1115343789 14:32320336-32320358 GAGGATTAAGTTGCTGAGTTTGG + Intergenic
1116160517 14:41262193-41262215 AACTATTAAGTGGCAAAGTTAGG - Intergenic
1117481704 14:56152223-56152245 CAGCCTTAAGTGGCAGAACTGGG - Intronic
1118908184 14:70038566-70038588 CACAAGTAAGTGGCAGAGCTGGG - Intergenic
1120096303 14:80391983-80392005 CAGAATTAAATGGAATAGTTTGG - Intergenic
1121434963 14:93913086-93913108 CAGGCTCACTTGGCAGAGTTGGG + Intergenic
1121887576 14:97558591-97558613 CAGTAGTAAGTTGCAGAGTTGGG - Intergenic
1121942088 14:98080692-98080714 CACAAGCAAGTGGCAGAGTTGGG - Intergenic
1121991144 14:98558798-98558820 CACGCTTCAGTGGTAGAGTTGGG - Intergenic
1124833459 15:33172696-33172718 GAGAAGGAAGTGGCAGAGTTGGG + Intronic
1124877190 15:33606138-33606160 AAACATTAAGTGGCAGAGCTAGG - Intronic
1125104578 15:35955573-35955595 AGAAATTAAGTGGCAGAGTTAGG + Intergenic
1125203791 15:37128039-37128061 AAGGATTCAGAGGCACAGTTTGG - Intergenic
1126200221 15:45977066-45977088 CATGATGAAATGGCAAAGTTGGG + Intergenic
1127408403 15:58679148-58679170 CAGAGTGAAATGGCAGAGTTCGG + Exonic
1128128145 15:65207885-65207907 CAGCAATAAGTAGCAGAGTGGGG - Intronic
1128477297 15:68008190-68008212 CAGGAGTAAGAGACAGAGTCGGG - Intergenic
1128788888 15:70418172-70418194 GACGAGTAAGTGGTAGAGTTGGG - Intergenic
1129182069 15:73883899-73883921 CAGGATTCAGGTGCAGCGTTTGG + Intronic
1129323904 15:74789567-74789589 CAGAATTAAGTTTCAGATTTGGG - Intronic
1129905549 15:79184791-79184813 CAGGAGTTAGTGGCAGAGCCAGG - Intergenic
1130294144 15:82631735-82631757 AATGATTAAGAGGAAGAGTTAGG - Intronic
1131491464 15:92866894-92866916 CAGGAAGAAGAGGGAGAGTTGGG + Intergenic
1131606407 15:93908458-93908480 AAGGATTCAGTGGCCTAGTTCGG - Intergenic
1134332120 16:13260672-13260694 CAGGAAAATGTGGGAGAGTTTGG - Intergenic
1134826737 16:17290881-17290903 CAGGATTTGGTGGCAGAGCCAGG - Intronic
1135035977 16:19077130-19077152 CTGGTTACAGTGGCAGAGTTGGG + Intronic
1135142095 16:19930532-19930554 CAAGAGTAAGTGGCAGAGTTGGG - Intergenic
1135201946 16:20445134-20445156 CAGCTGTAAGTGGCAGAGCTGGG + Intergenic
1135217158 16:20582732-20582754 CAGCTGTAAGTGGCAGAGCTGGG - Intergenic
1137910041 16:52368536-52368558 CATAATTAAGTGGCAGAGTCAGG - Intergenic
1138184583 16:54966598-54966620 CAGTAGTAAGTAGCAGAGTCAGG - Intergenic
1139083988 16:63561959-63561981 CAGGAATATGTGGGAAAGTTTGG - Intergenic
1139994185 16:70964371-70964393 CAGTTTTAAGTGGCAGAATCAGG - Intronic
1141272963 16:82557617-82557639 CAGGAATATGTGGGAAAGTTTGG + Intergenic
1141795425 16:86270226-86270248 CAGTAGTAAGTGGCAGAACTGGG + Intergenic
1143856731 17:9856724-9856746 GAGCAGTAAGTCGCAGAGTTGGG - Intronic
1144021890 17:11245217-11245239 CAGGATTGAAAGGCAGAGCTGGG + Intronic
1144267532 17:13585728-13585750 CAGGAGTAAGGGTCAGATTTGGG - Intronic
1144351554 17:14401960-14401982 CAGGAATATGTGGGAAAGTTTGG + Intergenic
1146002087 17:29137127-29137149 AACTATTAAGTGGCAGAGCTGGG + Intronic
1146220631 17:31016123-31016145 CAGTAGTAAGTGGCAGAGCCAGG - Intergenic
1147410917 17:40251682-40251704 CAGGAATAAAGTGCAGAGTTAGG - Intronic
1147607882 17:41784706-41784728 CAGGATAAAGGGGCTGAGTCTGG + Intronic
1148640214 17:49181940-49181962 CAGGGTTGAGTGGAAGAGGTAGG - Intergenic
1149366622 17:55951825-55951847 CAGGAAAACGTGGCAAAGTTTGG + Intergenic
1150483045 17:65525175-65525197 CAGGATTGAGAGGCCGAGGTGGG + Intergenic
1150960093 17:69903168-69903190 CAAGACTAGGTGGCAGAGCTCGG - Intergenic
1151063757 17:71127058-71127080 CAGGATTAAGTGTCAAATTCCGG + Intergenic
1151130349 17:71890291-71890313 CAGAATTCAGTGGGAGAATTAGG - Intergenic
1151351622 17:73535265-73535287 CAGCACAAAGTGGCAGAGTGGGG - Intronic
1152396126 17:80034935-80034957 CAGGATCAAGTCGCAGAGGCTGG + Intronic
1152597396 17:81244446-81244468 CAGGGTTTCGTGGCAGGGTTGGG + Intergenic
1153389003 18:4533572-4533594 CAGGATGATGTGGAAAAGTTTGG - Intergenic
1155704932 18:28797806-28797828 CAGCATTATATGGGAGAGTTTGG + Intergenic
1155818737 18:30348420-30348442 CAGGAAGATGTGGGAGAGTTTGG - Intergenic
1156288219 18:35721151-35721173 CAGGAATAAGTTTCAGAGCTTGG - Intergenic
1157309831 18:46544203-46544225 CAGTGGTAAGTGGCAGAGCTAGG - Intronic
1159157424 18:64602140-64602162 CAGGAAAATGTGGCAGAGTTTGG - Intergenic
1159944415 18:74433332-74433354 CAGCAGTAAGTGGAGGAGTTGGG - Intergenic
1160269871 18:77373618-77373640 CAGGACAAGGTGGCAGAGGTGGG + Intergenic
1160741874 19:690064-690086 CAGGATTGGGAGGCAGAGGTGGG + Intronic
1160878805 19:1310419-1310441 CAGAATTAAGTTGCCCAGTTGGG + Intergenic
1161061459 19:2217219-2217241 TAGGATGTTGTGGCAGAGTTGGG + Intronic
1161841962 19:6687501-6687523 AGGAAATAAGTGGCAGAGTTAGG + Intronic
1162086195 19:8250822-8250844 CAGTGTTAAAAGGCAGAGTTGGG - Intronic
1162482107 19:10933726-10933748 GAGGATTAAGTCACAGAGCTGGG - Intergenic
1163115732 19:15187752-15187774 CAGGACCCAGTGACAGAGTTGGG - Intronic
1163529629 19:17842036-17842058 CAAGACTAAGAGGCAGAGTGAGG - Intronic
1164789073 19:30960641-30960663 CGTGAGTAAGTGGCAGAGCTGGG + Intergenic
1165412192 19:35668818-35668840 CAGGCTTGAGTAGCAGAGCTGGG + Intronic
1165834731 19:38747228-38747250 CAGGTGTAGGTGGCAGAGCTGGG - Intronic
1166340580 19:42134524-42134546 GAGGATAGAGGGGCAGAGTTTGG + Intronic
1168466295 19:56604644-56604666 CAGGATTCCGTTGCAGAGTGTGG + Intronic
925778810 2:7360626-7360648 CAGGAATAAATGGCAGTGCTTGG - Intergenic
926363996 2:12116241-12116263 AACTACTAAGTGGCAGAGTTGGG - Intergenic
926691567 2:15738118-15738140 CACCAGTAAGTGGCAGAGCTGGG - Intronic
926938840 2:18114443-18114465 CAGGAAGATGTGGCAAAGTTTGG + Intronic
927255937 2:21041045-21041067 CAGGATGAAGCTGCAGAGCTGGG + Exonic
927872174 2:26630628-26630650 AACTATTAAGTGGCAGAGTCAGG - Intronic
928341757 2:30448791-30448813 TATTTTTAAGTGGCAGAGTTTGG - Intronic
928897758 2:36284437-36284459 AAGAATCTAGTGGCAGAGTTTGG - Intergenic
928971408 2:37033710-37033732 CAGGAATAAGTGACAGAGCCAGG - Intronic
929404307 2:41624219-41624241 AAGGGTTAAGTGACAGAATTAGG + Intergenic
929486882 2:42362525-42362547 CAGGGATAAGTGGCAGAGCTAGG + Intronic
930059365 2:47275508-47275530 AAGGATTGAGAGGCAGAGATAGG - Intergenic
930520036 2:52454179-52454201 CAGGTTTAAGTGGCATACATTGG + Intergenic
931734526 2:65181800-65181822 CAGGATAATGTGGGAAAGTTTGG + Intergenic
932008265 2:67949382-67949404 CAGGTTTAACTGACAGAGGTTGG - Intergenic
932308722 2:70722951-70722973 CAGAATCAAATGGCAGATTTGGG - Intronic
932696153 2:73958532-73958554 TAGCATCAAGTGGCAGAGCTGGG - Intronic
932797026 2:74704806-74704828 CAGGATTATGGGGCCGGGTTTGG - Intergenic
933381176 2:81547838-81547860 GGAGAGTAAGTGGCAGAGTTAGG + Intergenic
936549698 2:113426614-113426636 CAGGAATATGTGGGAAAGTTTGG + Intergenic
936907405 2:117553069-117553091 CTGCATGAAGTGGAAGAGTTGGG - Intergenic
936978543 2:118242715-118242737 CAGAATTGAGAGGCAGAGCTGGG + Intergenic
937005118 2:118504608-118504630 CAGCAGTAAGTGGCAGAGCCAGG - Intergenic
937008833 2:118543416-118543438 CAGGAAAATGTGGGAGAGTTTGG + Intergenic
937682529 2:124659461-124659483 CAAAAATAAGTGGCAGAGTGGGG - Intronic
937944937 2:127324511-127324533 CATAGTTAAGTGGCAGAGCTTGG - Intronic
939824992 2:147003224-147003246 AACTAATAAGTGGCAGAGTTAGG + Intergenic
940313246 2:152301478-152301500 CAAGAAGAAGTGGCAGAATTAGG - Intergenic
941226817 2:162860098-162860120 CAAGATTAAGTGGTAGAGGAGGG + Intergenic
941430351 2:165407271-165407293 CAGAATTGAGTGGCAGAGCCAGG + Intergenic
943143860 2:184017567-184017589 CTGGATTAACAGGAAGAGTTTGG + Intergenic
943988094 2:194648900-194648922 CAGGTGAAAGTGGCAGAGTAGGG - Intergenic
945689920 2:213020875-213020897 CAGTATTAAATGGTATAGTTGGG - Intronic
945874443 2:215263693-215263715 CAGTGTTAAGAGGCAGAGGTGGG - Intergenic
946060911 2:216940844-216940866 CAGGTATAAGTGGCAGAGCTGGG - Intergenic
947275589 2:228388115-228388137 CATGACTAAGTGGCAGAGGTAGG + Intergenic
947780153 2:232752923-232752945 GAGTAATAAGTGGCAGAGTTTGG - Intronic
948052081 2:234986263-234986285 CAGCATTTAGTGGCAGAGCCAGG + Intronic
1171302442 20:24075506-24075528 CAGGAGTAAGTGGCAGGGACAGG + Intergenic
1171967686 20:31542885-31542907 CACTAATAAGTGGCAGAGTTAGG + Intronic
1173086748 20:39926958-39926980 CAAAATTAAGTGGCAGATGTGGG + Intergenic
1173642071 20:44610265-44610287 CAGGGTTAGGTGGCAGAGCTTGG + Intronic
1175180546 20:57143467-57143489 CAGGTACAAGTGGCAGAGTGGGG - Intergenic
1175193894 20:57229325-57229347 AAGGAGTGAATGGCAGAGTTGGG + Intronic
1176929654 21:14792935-14792957 TAGGATTTTATGGCAGAGTTGGG - Intergenic
1177189394 21:17833373-17833395 AAGGATTAAGTGTGAGATTTTGG + Intergenic
1177778366 21:25595180-25595202 CACAATTATGTGGCAAAGTTAGG + Intronic
1178185245 21:30211205-30211227 CAGGAATAAGTGACACAGCTGGG + Intergenic
1179956559 21:44743146-44743168 CAGGATTACCTGACACAGTTAGG + Intergenic
1181530243 22:23513170-23513192 CAGGAATAAGAGGCAGAGGAGGG + Intergenic
1181580886 22:23827470-23827492 CAGGATTTAGAGGCAGAGGCGGG + Intronic
1181620412 22:24087305-24087327 CATTAGTGAGTGGCAGAGTTGGG + Intronic
1182420262 22:30245486-30245508 CAGAATCAAGTGGCAGGTTTGGG - Intronic
1182661075 22:31925706-31925728 CAGGATTAAGTAGAAGAATTGGG + Intergenic
1182799440 22:33019412-33019434 CATGAGTAAGTGGCAGAGCTGGG - Intronic
1183144363 22:35976061-35976083 CGTCATGAAGTGGCAGAGTTAGG - Intronic
1183148694 22:36019369-36019391 ATTGATTAAGTGCCAGAGTTGGG - Intronic
1183226465 22:36553562-36553584 CAGGATAAGGTGGAAGAGGTGGG - Intergenic
1183354484 22:37350942-37350964 CAGGATTAGAGGGCAGAGCTTGG - Intergenic
1184663213 22:45975083-45975105 CAGAATTCAGTGACAGAGCTGGG - Intronic
949397268 3:3628379-3628401 CATAATTAAGTGGCAGGATTAGG - Intergenic
949636050 3:5982397-5982419 CAGGAATATGTGGGAAAGTTTGG - Intergenic
950126902 3:10515133-10515155 CAGTGGTAAGTGGCAGAGCTGGG - Intronic
950861065 3:16148084-16148106 AGGGAATGAGTGGCAGAGTTTGG + Intergenic
950873480 3:16249455-16249477 CACTAATAAGTGGCAGACTTAGG + Intergenic
951678352 3:25267494-25267516 AAGAAGTAAGTGGTAGAGTTAGG - Intronic
951734224 3:25846237-25846259 CAGGAGTCAATGACAGAGTTGGG + Intergenic
951997719 3:28749544-28749566 CAGGAATATGTGGAAAAGTTTGG + Intergenic
952410587 3:33046595-33046617 CAGGATTAACAGTCAGAGATGGG - Intronic
952569401 3:34696258-34696280 CAACTTTAAGTGGCAAAGTTGGG + Intergenic
952818411 3:37465460-37465482 CACCAGTAAGTGGCAGAGCTGGG - Intronic
953142444 3:40241285-40241307 CTGGATTCAGTGGCAGAGCTGGG - Intronic
953272765 3:41461418-41461440 CTGAATTAGGTGGAAGAGTTGGG - Intronic
954856185 3:53645915-53645937 CATGAATCAGTGGCTGAGTTGGG + Intronic
956558897 3:70551808-70551830 CAGGAAAAAGTGGGAAAGTTTGG - Intergenic
957676852 3:83378113-83378135 CAGGAATATGTGGGAAAGTTTGG - Intergenic
959815564 3:110670067-110670089 CAGGAAAATGTGGGAGAGTTTGG + Intergenic
962221436 3:133567576-133567598 AATGAATGAGTGGCAGAGTTAGG + Intergenic
962912520 3:139866390-139866412 CAAAAGTCAGTGGCAGAGTTGGG + Intergenic
963736355 3:149021584-149021606 CACAACTAAGTGGCAGAGATGGG - Intronic
963837968 3:150076133-150076155 CAGTAAAAAGTGGCAGAGCTGGG - Intergenic
964023828 3:152047283-152047305 CATGATTATGTGTTAGAGTTTGG + Intergenic
964088176 3:152843584-152843606 AAGTAGTAAGTGGCAGAGGTGGG - Intergenic
964408494 3:156374722-156374744 CAGCCATAAGTGGCAGAGCTGGG - Intronic
965371893 3:167873080-167873102 CATGAATAAGTGGCAGAGTCAGG + Intergenic
966571669 3:181450966-181450988 CACCAATAAGTGGCAGAGTTGGG - Intergenic
967134511 3:186502105-186502127 CAGTAGTAAGTGGCAGAGTCAGG - Intergenic
967380781 3:188855454-188855476 CAGGATAAAGAGACAGAGTCTGG + Intronic
969066392 4:4485118-4485140 CACTAGTAAGTGGCAGAGCTGGG - Intronic
970249757 4:14101973-14101995 TAGAAATAAGTGGTAGAGTTGGG + Intergenic
970351587 4:15206894-15206916 CAGGATGATGTGGGAAAGTTTGG + Intergenic
970386652 4:15563264-15563286 CAGGACCATGGGGCAGAGTTCGG + Intronic
971087272 4:23293196-23293218 GAGGAGTAAGTGGTAGAGTAAGG + Intergenic
971684556 4:29747451-29747473 CAAGATTATGTGGGAAAGTTTGG - Intergenic
971939697 4:33199214-33199236 TAGGAAAATGTGGCAGAGTTTGG + Intergenic
972832603 4:42832121-42832143 CAGGAATATGTGGGAAAGTTTGG + Intergenic
973594635 4:52474246-52474268 CTGGAGTAAGTAGCAGAGTCAGG - Intergenic
974355003 4:60800534-60800556 AGTAATTAAGTGGCAGAGTTGGG - Intergenic
977119451 4:93079563-93079585 CACTAGTAAATGGCAGAGTTGGG - Intronic
977800057 4:101217308-101217330 TACTATTAAGTAGCAGAGTTTGG + Intronic
979049458 4:115911159-115911181 CAGGAAGAAGTGGGAAAGTTTGG - Intergenic
979390217 4:120118722-120118744 CAGGATAATGTGGGAAAGTTTGG - Intergenic
979806230 4:124975026-124975048 AATAAGTAAGTGGCAGAGTTTGG + Intergenic
980920059 4:139075241-139075263 CAGAAATAAGTGGCAGAGACTGG - Intronic
980972486 4:139580112-139580134 CAGTACAAAGTGGCAGAGTCAGG - Intronic
981050477 4:140304815-140304837 CAGGAATAAAGGGCAGCGTTAGG - Intronic
981106825 4:140891322-140891344 CAGTAGTAAGTGGCAGAACTAGG + Intronic
981481796 4:145246157-145246179 TAGTATTAAGTAGCAGAATTTGG - Intergenic
981747393 4:148064633-148064655 CTGGATTAAGCGGCTGCGTTAGG + Intronic
981781300 4:148433650-148433672 AACAATTAAGTAGCAGAGTTGGG + Intronic
981812014 4:148786322-148786344 CAGTAGTAAGTGCCAGAGCTAGG + Intergenic
982750817 4:159159080-159159102 CAGCAATAAGTAGCAAAGTTAGG + Intronic
982799925 4:159692738-159692760 CAGGAATATGTGGCAAAGTTTGG + Intergenic
983393834 4:167168370-167168392 CAGGAAGATGTGGCAAAGTTTGG + Intronic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
984812543 4:183807627-183807649 CAGGATTAAGAAGCTGAGCTGGG - Intergenic
985159864 4:187033453-187033475 CAGGAAAATGTGGAAGAGTTTGG + Intergenic
985415473 4:189732013-189732035 CAGGATGCAGAGGAAGAGTTTGG - Intergenic
985523642 5:390999-391021 CAGGAGGCAGTGGCAGAGATGGG + Intronic
986131785 5:4938985-4939007 CAGGAGGAAGGAGCAGAGTTGGG - Intergenic
986316474 5:6592050-6592072 CTGCATGACGTGGCAGAGTTGGG - Intergenic
986430036 5:7672798-7672820 CAGTCTACAGTGGCAGAGTTGGG + Intronic
986545069 5:8888120-8888142 CAGGATTCAGTGACAGACTGAGG + Intergenic
987810311 5:22826536-22826558 CAGGAAAATGTGGGAGAGTTTGG + Intronic
988149877 5:27363966-27363988 CAGGAATATGTGGGAAAGTTTGG + Intergenic
988414959 5:30934767-30934789 AAGCATTAAGTGGCAAAGTGGGG + Intergenic
989141126 5:38202552-38202574 CAGTCTTAAATGGCAGAGCTGGG + Intergenic
989252120 5:39329475-39329497 CAGCACTAAGGGGCAGAGGTGGG + Intronic
989311787 5:40027260-40027282 CAGGAGTATGTGGGAAAGTTTGG - Intergenic
989731438 5:44654676-44654698 CAGGAATATGTGGGAAAGTTTGG - Intergenic
990343815 5:54851589-54851611 CAGGGAAAAGTGGCAGAGTGTGG + Intergenic
990422925 5:55654667-55654689 AAATATTAAGTGGCAGAGTTGGG - Intronic
991344822 5:65652995-65653017 CAGAATTAGGTTGCTGAGTTTGG + Intronic
991642381 5:68768067-68768089 CAGGATGAAGGGCCAGTGTTTGG - Intergenic
991676171 5:69091872-69091894 AATTACTAAGTGGCAGAGTTGGG + Intergenic
993451187 5:88073688-88073710 CAGGAAAAAGTGGGACAGTTTGG + Intergenic
993866902 5:93206464-93206486 AATTAGTAAGTGGCAGAGTTGGG + Intergenic
995001019 5:107130023-107130045 CTGGATTAAGTGGCAGACCTTGG + Intergenic
995135116 5:108672366-108672388 CAGCAGTAAGTGGTAGAGCTGGG + Intergenic
995160992 5:108981775-108981797 AACTATTAAGTGGCAGAGCTTGG + Intronic
995244080 5:109917716-109917738 CAGGAAGATGTGGGAGAGTTTGG + Intergenic
996783114 5:127210104-127210126 CAGGAACATGTGGCACAGTTTGG + Intergenic
997091650 5:130865242-130865264 CAGGAAGATGTGGCAAAGTTTGG - Intergenic
997480000 5:134177598-134177620 AACGGTTAAGTGGCAGAGCTAGG + Intronic
998179839 5:139928978-139929000 CAGGATAAAGGGGGAAAGTTGGG - Intronic
998407966 5:141884652-141884674 GAGTAGTAAGTGGCAGAGTCAGG - Intergenic
999077208 5:148807565-148807587 CAGCAGCAAGTGGCAGAATTGGG + Intergenic
999183213 5:149685260-149685282 CAGCATTCACTGGCAGAGCTGGG + Intergenic
999248664 5:150168463-150168485 CAGAAGCAAGTGGCAGAGTCTGG - Intronic
999640084 5:153663626-153663648 CATGAGTAAGTGACAGAGTTAGG - Intronic
999665635 5:153910311-153910333 CAGTAATAAGTGACAGAGCTGGG + Intergenic
1000030591 5:157397947-157397969 CAGGATAATGTGGGAAAGTTTGG - Intronic
1000628146 5:163563004-163563026 AAGTAATAAGTGGCAGAGGTTGG + Intergenic
1000818890 5:165958987-165959009 CAGGTTTAAGTGACAGATTCAGG + Intergenic
1000844202 5:166258706-166258728 CATGACTAAATGGCAGTGTTTGG + Intergenic
1001118643 5:168960517-168960539 CAGATTTAAGTGGCAGAGCTGGG + Intronic
1001193626 5:169652634-169652656 CAGTAGTGAGTGGCAGAGCTGGG + Intronic
1002137833 5:177119138-177119160 CACTATTAAGTGGCAGAGCTGGG + Intergenic
1003394883 6:5744509-5744531 CAGGACTAAGTAGCAGAGCTGGG + Intronic
1004728081 6:18330377-18330399 CAGGAAGAGTTGGCAGAGTTGGG + Intergenic
1005660166 6:27990146-27990168 TACAACTAAGTGGCAGAGTTGGG + Intergenic
1007256740 6:40534974-40534996 CATGATATAGTGGCAGAGCTGGG + Intronic
1008388867 6:50925623-50925645 CAGAAGTAAATGTCAGAGTTGGG + Intergenic
1008562269 6:52734840-52734862 TAGGAGCAAGAGGCAGAGTTTGG + Intergenic
1009316190 6:62223911-62223933 CAGGAAAATGTGGGAGAGTTTGG - Intronic
1009528249 6:64775405-64775427 CAGTTTTAAGTGGCAAAGTTGGG - Intronic
1009983839 6:70758720-70758742 CAGGATTAAATTGGAGAGATTGG + Intronic
1010677956 6:78766745-78766767 CAGGAGGAAGTGGGAGAGTGGGG - Intergenic
1011845091 6:91553025-91553047 CAGGAAAATGTGGCAAAGTTTGG - Intergenic
1012537750 6:100319777-100319799 AAGGAATAAGAGGCAGTGTTTGG - Intergenic
1012663911 6:101942441-101942463 CAGGAATATGTGGGAAAGTTAGG + Intronic
1013287003 6:108690460-108690482 CAGCTTTCAGTGGCAGAGTCAGG - Intergenic
1013559557 6:111290851-111290873 CAGGAATATGTGGGAAAGTTTGG - Intergenic
1014260616 6:119212439-119212461 CAGTCTTAAGTTGCTGAGTTTGG - Intronic
1014488979 6:122038171-122038193 CAGAATCCAGTGGCCGAGTTAGG + Intergenic
1014558451 6:122862003-122862025 AAGGAGTAAATGGCAGAGTCTGG - Intergenic
1014778582 6:125537894-125537916 CAGGAATTAGTGGGAGGGTTGGG - Intergenic
1014804253 6:125811601-125811623 GAGGATAAAGGTGCAGAGTTGGG + Intronic
1017023642 6:150162353-150162375 CAGGAAGAAATGGCAGAGGTTGG - Intronic
1017914769 6:158823092-158823114 CAGGCTCAAGAGGCAGACTTAGG - Intergenic
1018733291 6:166669224-166669246 CAGGAATATGAGGCAGAGCTGGG + Intronic
1020426900 7:8077515-8077537 CATAATTAAGTGGCAGAGCAGGG - Intronic
1020731603 7:11888033-11888055 CAGGAATATGTGGGAAAGTTTGG + Intergenic
1022360355 7:29650790-29650812 GAGGAAGAAGTGGAAGAGTTGGG + Intergenic
1023472538 7:40540027-40540049 CAGAAATAAGTGGTATAGTTGGG + Intronic
1024021517 7:45374903-45374925 CAGGATAATGTGGGAAAGTTTGG - Intergenic
1024237792 7:47411135-47411157 CAGAAGTGAGTGGCCGAGTTAGG + Intronic
1025631703 7:63278444-63278466 CAAGATGAAGTGGTAGTGTTTGG - Intergenic
1025650876 7:63467943-63467965 CAAGATGAAGTGGTAGTGTTTGG + Intergenic
1027485501 7:78756693-78756715 CAGGATTGAAGGGCTGAGTTGGG - Intronic
1027990785 7:85358403-85358425 TAGGATTAAGTTACAGATTTAGG + Intergenic
1028826431 7:95278837-95278859 AAGAAGTAAGTGGCAGAGTTGGG - Intronic
1031765038 7:125767440-125767462 AACTATTTAGTGGCAGAGTTCGG - Intergenic
1032345521 7:131112959-131112981 ATGAATAAAGTGGCAGAGTTGGG - Intronic
1032514048 7:132493880-132493902 CAGGATTAAGTGGCAGAGTTGGG - Intronic
1032736230 7:134695007-134695029 CAGGGACAAGTGGCAAAGTTGGG + Intergenic
1033520839 7:142158811-142158833 CAGGGGTAAGTGGCAAAGTGTGG + Intronic
1033653435 7:143358935-143358957 CATGATTGAGTGGCAGGGCTGGG - Exonic
1036480356 8:9133861-9133883 CAAGATCAAGTGGCCGGGTTGGG - Intergenic
1037089374 8:14895240-14895262 CAAGATTACATGGCAGAGGTAGG - Intronic
1037483342 8:19325408-19325430 CATGAGTCAGTGGTAGAGTTAGG + Intronic
1038190731 8:25317982-25318004 CAGGAGTTAGTGGCAGAGCTGGG + Intronic
1038525751 8:28271686-28271708 CAGGATTGAGCGTCAGAATTTGG + Intergenic
1039748293 8:40453128-40453150 CAGGATCAGGTGGCATAGCTTGG - Intergenic
1041266712 8:56072663-56072685 AAGGATTAAGTGGCAGAGGCAGG - Intronic
1042090089 8:65149484-65149506 CAAGGTTAAGTGGTAGGGTTAGG - Intergenic
1044159847 8:88899465-88899487 CAAGATGAAGAGGCAGAGTAAGG - Intergenic
1044525141 8:93242469-93242491 CAGGAATAAATGGTAGAGTGGGG + Intergenic
1044737337 8:95292689-95292711 AGTGAATAAGTGGCAGAGTTGGG - Intergenic
1045425239 8:102059779-102059801 CAGTCTTAAGTGACAGATTTTGG + Intronic
1045511978 8:102818779-102818801 TAGGAGTAAGTGGTAGAGTTAGG - Intergenic
1045522718 8:102917173-102917195 CAGCAATAAGTGGCAGAGCCAGG - Intronic
1046065274 8:109189085-109189107 CTAGCTTAAGTGGCAGAGCTAGG + Intergenic
1046519783 8:115309422-115309444 CAGGAAAAAGTGGGAAAGTTTGG - Intergenic
1046880280 8:119299877-119299899 CAGGAAAATGTGGGAGAGTTTGG - Intergenic
1047123132 8:121928791-121928813 AAGTAATAAATGGCAGAGTTGGG - Intergenic
1048070358 8:131014487-131014509 CTGTGTTAAGTGGCAGAATTAGG - Intronic
1048107607 8:131428274-131428296 CAGGAAAAAGTGGGAAAGTTTGG - Intergenic
1048232501 8:132657871-132657893 CAAGGTTAAGTGGTAGAGCTAGG + Intronic
1048404496 8:134106150-134106172 CAGGAAAAAGTGGGAAAGTTTGG + Intergenic
1048915748 8:139181406-139181428 CAGGAAAATGTGGCAAAGTTTGG + Intergenic
1049374345 8:142281865-142281887 CAGGATGAAGGGGCTGAGCTTGG - Intronic
1049903248 9:190213-190235 CAGGAATATGTGGGAAAGTTTGG - Intergenic
1050614531 9:7388241-7388263 CAGGATCAACTGGCAGAGGGTGG - Intergenic
1050849204 9:10263303-10263325 CAGGAGTATGTGGGAAAGTTTGG + Intronic
1050977104 9:11952742-11952764 CAGAAATATGTGGGAGAGTTGGG + Intergenic
1051996006 9:23219179-23219201 CAGGTGTAAGTGGCAAAGCTGGG + Intergenic
1052005339 9:23341082-23341104 GACAAATAAGTGGCAGAGTTAGG - Intergenic
1052435175 9:28418232-28418254 AAGTAATAAATGGCAGAGTTAGG - Intronic
1052435530 9:28423299-28423321 CAGGATTATTTGGCAAAGATGGG - Intronic
1052899943 9:33784891-33784913 CAGGAGTAAGTGATAGAGTCAGG - Intronic
1053746258 9:41200496-41200518 CAGGAATATGTGGGAAAGTTTGG - Intergenic
1054481008 9:65664721-65664743 CAGGAATATGTGGGAAAGTTTGG + Intergenic
1054682087 9:68230784-68230806 CAGGAATATGTGGGAAAGTTTGG + Intergenic
1054745627 9:68851718-68851740 CAAGTTTAAGTGGGACAGTTTGG + Intronic
1055413238 9:76053753-76053775 CAGGAAAAAGTGGGAAAGTTTGG - Intronic
1055631693 9:78231350-78231372 CAAGAATAAGTGGCAGGGTGTGG + Intergenic
1055831519 9:80384776-80384798 CAGTAGTAAGTGACAGAGCTAGG + Intergenic
1057433074 9:95013063-95013085 CATGATTAGGTGGTACAGTTGGG - Intronic
1058330834 9:103757726-103757748 CAGGATAATGTGGAAAAGTTTGG - Intergenic
1058951551 9:109908426-109908448 CACCAGTAAGTGGCAGAGCTGGG - Intronic
1059012479 9:110477121-110477143 CAGGAGTGAGTGACAGAGTAAGG - Intronic
1059514086 9:114876703-114876725 CAGGAAGATGTGGCAAAGTTTGG - Intergenic
1059523824 9:114969930-114969952 CAGCATTGGGAGGCAGAGTTGGG + Intergenic
1059576170 9:115491112-115491134 CGGCATTAAGTGGCAGAGCTAGG + Intergenic
1059964824 9:119603255-119603277 TATGAGTTAGTGGCAGAGTTAGG + Intergenic
1060435841 9:123592390-123592412 CAGTTTTAATTGGCAGAGTTAGG - Intronic
1061212895 9:129203732-129203754 CAGGGTTCAGTGGCAGAGCCTGG + Intergenic
1061712449 9:132497623-132497645 CAGTAGGAAGTGGCAGAGCTGGG - Intronic
1202782388 9_KI270718v1_random:11269-11291 CAGGAATATGTGGGAAAGTTTGG - Intergenic
1186623361 X:11264949-11264971 ACCAATTAAGTGGCAGAGTTAGG + Intronic
1186688026 X:11945905-11945927 AAGAAGTAAGTGGCAGACTTCGG + Intergenic
1186802999 X:13112267-13112289 CAGTAGAAAGAGGCAGAGTTAGG - Intergenic
1186834929 X:13428410-13428432 CACAATTCAGTGGCAGAGATAGG - Intergenic
1187397936 X:18934329-18934351 CAGGGTTAAGGGCCAGACTTTGG - Intronic
1187610795 X:20940593-20940615 CAGCATACAGTGGCAGACTTTGG + Intergenic
1189266136 X:39717639-39717661 CAGCAGTAAGTGGCAGAGTTGGG - Intergenic
1190025338 X:46917038-46917060 CAAGAGCAAGTGGTAGAGTTAGG - Intronic
1190560062 X:51678272-51678294 CAGGAACAAGTAGCAGAGTTGGG + Intergenic
1190564229 X:51715049-51715071 CAGGAACAAGTAGCAGAGTTGGG - Intergenic
1191760510 X:64643010-64643032 CAGGAAAAAGTGGCAGCTTTGGG + Intergenic
1192585141 X:72313352-72313374 AAGGGTTAAGTGGCAGAGCTGGG + Intergenic
1192723662 X:73725781-73725803 CAGGAAGAAGTGGGAAAGTTTGG - Intergenic
1194032813 X:88836933-88836955 CAGGAATATGTGGGAAAGTTTGG - Intergenic
1195273343 X:103254479-103254501 CCGGATTAAGTGCCAGAGGCCGG - Intronic
1195682807 X:107561441-107561463 CAGGGGAAAGTGGGAGAGTTGGG + Intronic
1195956866 X:110340546-110340568 AACTATTAAGTGGCAGAGATGGG - Intronic
1196407557 X:115380610-115380632 CAGCTTTAAGTGGCTGAGTATGG + Intergenic
1197034027 X:121853576-121853598 CAGGATTAAGTCCCAGTGTGCGG - Intergenic
1197042125 X:121949693-121949715 CAGGAATAAGAGGGAGAGTTTGG - Intergenic
1197645483 X:129012224-129012246 TAAGATTAAGTGACAGAGTCAGG - Intergenic
1197855450 X:130909514-130909536 CATGATTAAGGCACAGAGTTGGG + Intergenic
1198080490 X:133235059-133235081 CATTTTTAAGTGGCAGAGGTGGG + Intergenic
1198311253 X:135426848-135426870 CAGTAGTAAGTGGAAGAGCTGGG - Intergenic
1199810485 X:151343932-151343954 CTGACTCAAGTGGCAGAGTTGGG + Intergenic
1200096488 X:153666728-153666750 GAGGATGCAGTGGCAGAGTGTGG + Intergenic
1202030917 Y:20573255-20573277 CAGGATTATGTGGGAAATTTTGG - Intergenic