ID: 1032514361

View in Genome Browser
Species Human (GRCh38)
Location 7:132495757-132495779
Sequence GCCCCACCATGGGTGAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032514361_1032514373 28 Left 1032514361 7:132495757-132495779 CCCAAGCTCACCCATGGTGGGGC No data
Right 1032514373 7:132495808-132495830 CACCAAACCTTTGGTTCCTTGGG No data
1032514361_1032514372 27 Left 1032514361 7:132495757-132495779 CCCAAGCTCACCCATGGTGGGGC No data
Right 1032514372 7:132495807-132495829 CCACCAAACCTTTGGTTCCTTGG 0: 1
1: 0
2: 4
3: 17
4: 151
1032514361_1032514368 19 Left 1032514361 7:132495757-132495779 CCCAAGCTCACCCATGGTGGGGC No data
Right 1032514368 7:132495799-132495821 ACCTTTTCCCACCAAACCTTTGG 0: 1
1: 0
2: 0
3: 17
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032514361 Original CRISPR GCCCCACCATGGGTGAGCTT GGG (reversed) Intronic