ID: 1032514607

View in Genome Browser
Species Human (GRCh38)
Location 7:132497396-132497418
Sequence GTAAACACGATGTCATCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 84}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032514607_1032514616 25 Left 1032514607 7:132497396-132497418 CCTTGAGATGACATCGTGTTTAC 0: 1
1: 0
2: 1
3: 9
4: 84
Right 1032514616 7:132497444-132497466 GGTAAGTGGAGAGTGTCCACAGG 0: 1
1: 0
2: 1
3: 11
4: 114
1032514607_1032514608 -4 Left 1032514607 7:132497396-132497418 CCTTGAGATGACATCGTGTTTAC 0: 1
1: 0
2: 1
3: 9
4: 84
Right 1032514608 7:132497415-132497437 TTACTCCACAATACCTCCTCAGG 0: 1
1: 0
2: 1
3: 5
4: 111
1032514607_1032514617 26 Left 1032514607 7:132497396-132497418 CCTTGAGATGACATCGTGTTTAC 0: 1
1: 0
2: 1
3: 9
4: 84
Right 1032514617 7:132497445-132497467 GTAAGTGGAGAGTGTCCACAGGG 0: 1
1: 0
2: 0
3: 13
4: 128
1032514607_1032514610 -2 Left 1032514607 7:132497396-132497418 CCTTGAGATGACATCGTGTTTAC 0: 1
1: 0
2: 1
3: 9
4: 84
Right 1032514610 7:132497417-132497439 ACTCCACAATACCTCCTCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 101
1032514607_1032514609 -3 Left 1032514607 7:132497396-132497418 CCTTGAGATGACATCGTGTTTAC 0: 1
1: 0
2: 1
3: 9
4: 84
Right 1032514609 7:132497416-132497438 TACTCCACAATACCTCCTCAGGG No data
1032514607_1032514612 4 Left 1032514607 7:132497396-132497418 CCTTGAGATGACATCGTGTTTAC 0: 1
1: 0
2: 1
3: 9
4: 84
Right 1032514612 7:132497423-132497445 CAATACCTCCTCAGGGGTAGAGG No data
1032514607_1032514614 11 Left 1032514607 7:132497396-132497418 CCTTGAGATGACATCGTGTTTAC 0: 1
1: 0
2: 1
3: 9
4: 84
Right 1032514614 7:132497430-132497452 TCCTCAGGGGTAGAGGTAAGTGG 0: 1
1: 0
2: 2
3: 19
4: 220
1032514607_1032514618 29 Left 1032514607 7:132497396-132497418 CCTTGAGATGACATCGTGTTTAC 0: 1
1: 0
2: 1
3: 9
4: 84
Right 1032514618 7:132497448-132497470 AGTGGAGAGTGTCCACAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032514607 Original CRISPR GTAAACACGATGTCATCTCA AGG (reversed) Intronic
904042578 1:27593117-27593139 GTAGACACGGTGTCTCCTCAGGG + Intronic
907664025 1:56418445-56418467 GGAAACAGGATGTCTTCTCCAGG - Intergenic
908186827 1:61660475-61660497 GAAAACAGGATGTCATCATACGG + Intergenic
913524039 1:119674172-119674194 TTACACACGATAACATCTCATGG - Intronic
916480558 1:165210800-165210822 GTAGACACACTGGCATCTCAGGG + Intronic
918636160 1:186776898-186776920 GCTAACAGGATGTCATCTTATGG + Intergenic
920392333 1:205615927-205615949 GTAAACAAGATGCCTTTTCATGG + Exonic
920440450 1:205977206-205977228 GTGGACAAGATGTCCTCTCAGGG - Exonic
923707812 1:236359415-236359437 TTAAACACTATGTCCTCACATGG - Intronic
923764396 1:236879716-236879738 GTAAACATGCAGTCATCACAGGG + Intronic
1065694975 10:28371376-28371398 GCAGACTCGGTGTCATCTCAAGG - Intergenic
1076372148 10:129962820-129962842 GTAAACACGAAATCTTCTCATGG - Intronic
1081214989 11:40385266-40385288 GGAAACATTAAGTCATCTCAAGG + Intronic
1081337086 11:41880082-41880104 GTGAACACTATGTCCTCACATGG - Intergenic
1098721000 12:73897189-73897211 GTAAAAACGGTGTAATCTCTGGG + Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101742431 12:107511055-107511077 GCAAACACATTTTCATCTCAGGG - Intronic
1105811987 13:24003342-24003364 GTAAACCTGCTGTTATCTCATGG - Intronic
1109092012 13:58059601-58059623 GAAAAAACCAAGTCATCTCATGG + Intergenic
1111954738 13:94743922-94743944 GTAAACCCAACATCATCTCAAGG + Intergenic
1114135516 14:19844553-19844575 GAAAACATGAGGTCATCTAAAGG + Intergenic
1117532869 14:56676227-56676249 GGAAACACTCAGTCATCTCAAGG - Intronic
1119139045 14:72248330-72248352 GTAAAAAGAATGTCTTCTCATGG + Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1126988890 15:54347313-54347335 GTAAACAAGTTTTGATCTCAGGG - Intronic
1131434235 15:92410522-92410544 GTATACAGGATGTCATTTGACGG - Intronic
1131869386 15:96745846-96745868 GTAAAGAAGGTGACATCTCAGGG - Intergenic
1142778558 17:2162004-2162026 GTATAAACGATGCCATCTCAGGG - Intronic
1142944035 17:3409893-3409915 TTAAGCAGGAAGTCATCTCAGGG + Intergenic
1146583242 17:34058781-34058803 GTGAGCATGATGTCACCTCATGG - Intronic
1148392320 17:47281425-47281447 GAAAACACTGTGTCATCTAAAGG + Intronic
1154250945 18:12744539-12744561 TTAAAAACCATGTCATCTCAAGG - Intergenic
1154459622 18:14568048-14568070 GAAAACATGAGGTCATCTAAAGG + Intergenic
1157171287 18:45408471-45408493 AGACACACCATGTCATCTCATGG - Intronic
1157706123 18:49808435-49808457 GCAACCACGATGTCCTATCATGG + Intronic
1160661572 19:302059-302081 TTAAACACGGTCTCATCACACGG + Intergenic
1164127998 19:22336125-22336147 GTAGAGAAGATGTCATCACAGGG - Intergenic
1164171499 19:22729269-22729291 GTAGAGAGGATGTCATCACAGGG + Intergenic
925071785 2:974857-974879 GTAGACACTATGCCTTCTCATGG + Intronic
928102952 2:28450017-28450039 GTAATGATGATGTCATCACAGGG - Intergenic
929464176 2:42129863-42129885 GTAAGCATGATGTAATCACAAGG + Intergenic
935859357 2:107311142-107311164 TTGAAAACGATGTCATCTTATGG + Intergenic
938855877 2:135309909-135309931 GTAAACACTATATAATTTCAAGG + Intronic
940557097 2:155243099-155243121 GTAAACCCAATGTAATCACAAGG - Intergenic
944972599 2:205011287-205011309 GTAGCCAAGCTGTCATCTCAAGG + Intronic
947357710 2:229314372-229314394 GTAAGCATGATGTCATTCCAAGG + Intergenic
1169132132 20:3171825-3171847 GGCAACAGGCTGTCATCTCAGGG - Intronic
1175146630 20:56901430-56901452 GTGGGCCCGATGTCATCTCAAGG + Intergenic
1176814504 21:13584784-13584806 GAAAACATGAGGTCATCTAAAGG - Intergenic
1178110194 21:29362686-29362708 GTAAAAACGAGGTCATTTTAGGG + Intronic
1179821115 21:43937476-43937498 GCAGCCACGATGTCACCTCAAGG - Intronic
1184908651 22:47510313-47510335 CAAAACACCATGTCATCTCTTGG - Intergenic
949130009 3:488349-488371 GTAATCACAGTATCATCTCATGG - Intergenic
949202612 3:1396861-1396883 GTAATCTTGATGTCATCTCAAGG - Intronic
953011730 3:39032392-39032414 GTAAACAAGATGCCAACTCTAGG + Intergenic
953246923 3:41201152-41201174 GTCAACACGAAGACATCTGAAGG - Intronic
957179063 3:76852497-76852519 GAGATCATGATGTCATCTCAAGG + Intronic
959014894 3:101122665-101122687 GTAAACACAGTGTCATCTCATGG + Intergenic
959209181 3:103354453-103354475 GAAAACATGATGTTATCTTAAGG - Intergenic
963639733 3:147843875-147843897 GTGAACCCGATGATATCTCAAGG + Intergenic
963714756 3:148790423-148790445 ATAAAGACTATGTGATCTCAGGG - Intergenic
964036866 3:152209592-152209614 GTAAGCACCTTCTCATCTCAAGG - Intergenic
966745441 3:183270747-183270769 GAAAAAATGATGACATCTCATGG + Exonic
971291296 4:25343069-25343091 GTAAACATGATATCATTTGAGGG - Intronic
972714397 4:41631564-41631586 GTTAAAACTATGTCATCTCTAGG - Intronic
974027233 4:56744218-56744240 AAAAACACGATGTCATCAAAAGG + Intergenic
977426586 4:96874260-96874282 GTAAACACGTTTTCCTCTTAAGG + Intergenic
981844927 4:149156552-149156574 GTAAACAGGATAGCATATCAAGG + Intergenic
983499576 4:168483674-168483696 GTAGGCCCGATGTAATCTCAAGG + Intronic
984589959 4:181606184-181606206 GGAAACACGATGTCTGCTTAGGG - Intergenic
986775257 5:11008319-11008341 GTAGGCCCAATGTCATCTCAAGG + Intronic
987381801 5:17292452-17292474 GTAAACCCGAAACCATCTCAAGG - Intergenic
987605333 5:20127231-20127253 GTAAACACCATGTCCTCACATGG - Intronic
997391060 5:133516823-133516845 GTAAATAGGGTGTCATTTCAAGG + Intronic
998842598 5:146271516-146271538 GGAAAGACCATGTCCTCTCAAGG + Exonic
1003094080 6:3128884-3128906 GAAAACATGATGTCATCAAATGG + Intronic
1020249042 7:6452463-6452485 ATAAACATGATGTAATGTCAGGG - Intronic
1025641407 7:63375248-63375270 GTAAACATTCTTTCATCTCAGGG + Intergenic
1032514607 7:132497396-132497418 GTAAACACGATGTCATCTCAAGG - Intronic
1033898823 7:146110801-146110823 GTTAATATGATTTCATCTCAGGG - Intergenic
1035020846 7:155799397-155799419 GTAAACACAGTCTCAGCTCAGGG + Intergenic
1039135384 8:34316870-34316892 GTAGACCCAATGTAATCTCAAGG - Intergenic
1042708724 8:71691150-71691172 GTAAACCCAAGGTGATCTCAAGG - Intergenic
1047519271 8:125582001-125582023 CTAAACACTATGTCAACTCAGGG - Intergenic
1047607917 8:126493036-126493058 GTAGACAAGATGTCATTTCTGGG + Intergenic
1057092991 9:92276985-92277007 GTAAACACAATTTTATTTCAAGG - Intronic
1057752805 9:97805577-97805599 GTAATCACTAAGTCATCCCAAGG - Intergenic
1061595142 9:131624057-131624079 GTAAACTGGATGGGATCTCAAGG + Intronic
1185600255 X:1334341-1334363 GTAAATGTGATGTCAACTCATGG - Intergenic
1186401630 X:9265941-9265963 ATAAACTCGATGTCATCTCTGGG + Intergenic
1188655302 X:32686870-32686892 TTAAACATGATGTCTTCTTAAGG - Intronic
1197398310 X:125955947-125955969 GGAAACACTATGACTTCTCAGGG - Intergenic
1198613403 X:138426639-138426661 GTAAAAACATTGTCATCCCAAGG + Intergenic
1199923191 X:152431667-152431689 GTAAACACAATGTAATCACAAGG + Intronic
1200006034 X:153084869-153084891 TTAAACACGAAGTGATATCAGGG + Intergenic