ID: 1032518179

View in Genome Browser
Species Human (GRCh38)
Location 7:132522348-132522370
Sequence AGCAATAATCCTAATGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032518179_1032518184 -8 Left 1032518179 7:132522348-132522370 CCCAACCCATTAGGATTATTGCT 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1032518184 7:132522363-132522385 TTATTGCTGAGGCATGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032518179 Original CRISPR AGCAATAATCCTAATGGGTT GGG (reversed) Intronic
900825729 1:4925188-4925210 AGCCATGATCCTAATGGTTATGG - Intergenic
903391622 1:22967810-22967832 AACAACAATCCTTATGGGATGGG - Intergenic
905271161 1:36788610-36788632 ATCAATAATGATAATGGGCTGGG - Intergenic
905794100 1:40805753-40805775 TGCAATCATGCTAAGGGGTTTGG + Intronic
913244542 1:116860108-116860130 AGCAATAATCTGAATGAGGTAGG - Intergenic
915223420 1:154393116-154393138 AGCCATCATCCTAATGGCTATGG + Intergenic
917184072 1:172332646-172332668 GGCAATAATCCTACTGGCCTGGG - Intronic
918179181 1:182071056-182071078 AGGAAGAATCCTAATGGGTGAGG - Intergenic
920040861 1:203095579-203095601 AGCAAAAATAATAATGTGTTGGG + Intronic
921477231 1:215626724-215626746 AGCAATTATTTTTATGGGTTTGG - Intronic
923185594 1:231569893-231569915 AGTTAAAATCCTAATAGGTTTGG - Intronic
1072085348 10:92073724-92073746 ACCTATAATCCTAATGTTTTGGG - Intronic
1072234044 10:93438116-93438138 AGCAAGAATCCTGTTAGGTTGGG + Intronic
1075361054 10:121834459-121834481 AGCTATAATTCTTATGGATTTGG + Intronic
1076366460 10:129924092-129924114 AGCAGCCATCCTAATGGGTGAGG - Intronic
1077620259 11:3715448-3715470 AGTAACCATCCTAATGGGTATGG + Intronic
1078794928 11:14582977-14582999 AGCAAAAATCCAGCTGGGTTTGG - Intronic
1079587105 11:22139664-22139686 AGCCATAATCCCAATGCGTTGGG + Intergenic
1081486229 11:43531703-43531725 AGCATTAATCTTATTGGATTAGG - Intergenic
1083129796 11:60614467-60614489 AGAATTACTCCTAATGGGTTTGG - Intergenic
1083132886 11:60642818-60642840 AGCAATAATAATAAAGGGTGTGG - Intergenic
1083469814 11:62876220-62876242 AGTAATAATCCTCATGTGTTAGG + Intronic
1100397721 12:94199343-94199365 AGCAATAATGATAATGGAATTGG + Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1110929545 13:81197437-81197459 AGTAATAATAATAATGGGCTGGG + Intergenic
1113270604 13:108669353-108669375 AGCAAGAATTTTAATGGATTAGG + Intronic
1114046288 14:18879431-18879453 TACAAGAATCCTTATGGGTTTGG + Intergenic
1114117923 14:19640019-19640041 TACAAGAATCCTTATGGGTTTGG - Intergenic
1115088959 14:29550938-29550960 TGCAATTATGCTATTGGGTTAGG - Intergenic
1115686320 14:35800035-35800057 AGAAATAATCCTAAAGGTTTAGG + Intronic
1120126542 14:80750726-80750748 AACAATAATACTAATGGTTCTGG + Intronic
1120436163 14:84485493-84485515 AGCACTTATCCTAATGTTTTGGG + Intergenic
1124346673 15:28927569-28927591 AAAAATAATAATAATGGGTTGGG - Intronic
1125824911 15:42668025-42668047 TGCAAGAATGCTAATGAGTTTGG - Intronic
1126448455 15:48778304-48778326 AGCAATAATTTTCATGTGTTGGG - Intronic
1130686117 15:86039341-86039363 AGCAAGAATCCTGCTGCGTTTGG + Intergenic
1132232863 15:100197446-100197468 AGCATAAATCAGAATGGGTTTGG - Intronic
1133381222 16:5332044-5332066 AGCTTTAATCATAATGGCTTTGG + Intergenic
1135958079 16:26973010-26973032 AGCAATAATCCAAAATGGATTGG - Intergenic
1141484774 16:84331461-84331483 AGTAATAATCATAATGAGGTTGG - Intergenic
1144476266 17:15591732-15591754 AGCAATAGTAATATTGGGTTTGG - Intronic
1144921988 17:18771668-18771690 AGCAATAGTAATATTGGGTTTGG + Intronic
1145815357 17:27791478-27791500 AGCAAGAATCCTGTTAGGTTGGG + Intronic
1147731050 17:42602482-42602504 AGAAAGAATACTAATGGGTATGG - Intronic
1150385658 17:64757631-64757653 AGAAATAAACCAAATGGGCTGGG + Intergenic
1153101128 18:1470834-1470856 AGCTTTCATCCTAATGGGTCAGG + Intergenic
1154088185 18:11328021-11328043 AGCAATAATCCTAATTACATTGG - Intergenic
1155560104 18:27066340-27066362 AGCAATAATACTAAACTGTTAGG + Intronic
1157846767 18:51010870-51010892 AACAAAAAACCTAATGGATTTGG - Intronic
1157872673 18:51245089-51245111 ATTAAAAATACTAATGGGTTGGG - Intergenic
1160472936 18:79155209-79155231 AGCAATAATCCTAACTGTATAGG + Intronic
1163721924 19:18902222-18902244 ACCTATAATCCTAATGCTTTGGG + Intronic
925146727 2:1587363-1587385 AGCTTTTATCCTAATGGGCTGGG + Intergenic
926671184 2:15578290-15578312 AGAAATAATGCTAAAGAGTTTGG - Intergenic
929477680 2:42268695-42268717 AGCTATAATCCTAACGCTTTGGG - Intronic
931664504 2:64600497-64600519 GGCAGTAATCCTGCTGGGTTTGG - Intergenic
932006194 2:67929526-67929548 AATAATAATCCTCATAGGTTAGG - Intergenic
933739653 2:85523512-85523534 TGCAACAATCCTAATGAGGTAGG + Intergenic
938267085 2:129935499-129935521 TACAAGAATCCTTATGGGTTTGG - Intergenic
941711276 2:168716157-168716179 AAAAATAGTCCTAATGGGCTAGG + Intronic
943884785 2:193202530-193202552 AGGAATAAACCTCATGGATTAGG + Intergenic
945255974 2:207803573-207803595 AGAAATAACCCAAATGGGCTGGG - Intergenic
945291986 2:208135776-208135798 AGCCATCATCCTCATGGGTCAGG - Intergenic
1171295614 20:24014326-24014348 AGCAAGAATCCTACTAGGTCGGG + Intergenic
1173091870 20:39979908-39979930 AGTGATAATATTAATGGGTTCGG + Intergenic
1173525792 20:43731616-43731638 AGCAATTATCATTATGGGGTGGG + Intergenic
1178454319 21:32733216-32733238 AGTAATTAGTCTAATGGGTTTGG + Intergenic
1178885573 21:36482277-36482299 AGCAACTATCCTGATGGGCTGGG + Intronic
1179042781 21:37818729-37818751 AGAAATATTCCTAATGTTTTTGG + Intronic
1179086480 21:38222759-38222781 AGCAATCGTCCTATTGGTTTAGG + Intronic
1180464825 22:15602067-15602089 TACAAGAATCCTTATGGGTTTGG + Intergenic
1183129000 22:35814793-35814815 AGCTGTAATCCTAATGCTTTGGG + Intronic
1184737081 22:46405703-46405725 AGCAATTATCCAAATTGCTTGGG + Intronic
949601280 3:5600714-5600736 AACAATACTCCTACTGGGTGGGG - Intergenic
951781188 3:26364521-26364543 AGAGATAATGATAATGGGTTAGG - Intergenic
952072852 3:29659916-29659938 AGCAGCCATCCTAATGGGTGTGG + Intronic
953396326 3:42573572-42573594 ATCTATAATCCTAATGCTTTGGG + Intronic
955052036 3:55422304-55422326 TGCAATCATCCTAATGCTTTTGG + Intergenic
955404168 3:58615104-58615126 AACAAAAATCCTATTGGCTTGGG - Intronic
958500876 3:94906942-94906964 AGCAATATGCCTCAGGGGTTTGG - Intergenic
972243106 4:37215316-37215338 AGCAATAATTTTAAATGGTTAGG - Intergenic
972679548 4:41292213-41292235 AGTAATCATCCTAGTGGGTATGG + Intergenic
974435322 4:61849802-61849824 AGAAATAAACTAAATGGGTTTGG - Intronic
975494211 4:75020232-75020254 AGCAATAATCCTAACAAGTATGG + Intronic
982475423 4:155844201-155844223 AGCAATCGTCCTATTGGTTTGGG - Intronic
984509927 4:180667110-180667132 AGCAATAATACTAATTAATTTGG - Intergenic
985436421 4:189934293-189934315 AGAAATAAACCAAATGTGTTGGG - Intergenic
986396839 5:7339252-7339274 AGGAATGATACTAATGGGTATGG + Intergenic
986817222 5:11425994-11426016 AGCAAAAATCCTATTAGGTCAGG + Intronic
986928180 5:12784206-12784228 ACCAATAATACTATTGGATTAGG - Intergenic
991562370 5:67967429-67967451 AGCACTAATACTAATGTATTAGG + Intergenic
992490180 5:77235011-77235033 AAGAATAGCCCTAATGGGTTGGG - Intronic
995244650 5:109922183-109922205 AGCATTAGCCCTAATAGGTTTGG + Intergenic
995436531 5:112142479-112142501 AGCAAAAATGCTTATGGGTGTGG + Intronic
995729065 5:115216520-115216542 ACTAATAATCCTAACGGCTTTGG + Intronic
998741631 5:145209707-145209729 AAAAATAATTCTAATGAGTTTGG + Intergenic
1004266523 6:14152785-14152807 AGCAATAATCCTATTAACTTTGG + Intergenic
1004761547 6:18672226-18672248 AACAATAATCCTATTGAATTGGG + Intergenic
1006736934 6:36280371-36280393 AGCAATAATCCTAGGGTGTTTGG - Intronic
1009287266 6:61835598-61835620 AGCAAAATTCCTCAAGGGTTTGG - Intronic
1010840360 6:80642403-80642425 GAGAATAATCCTAATGGGGTTGG + Intergenic
1011877912 6:91984806-91984828 AGCAATAACCCAAATGAGCTTGG + Intergenic
1014442008 6:121484398-121484420 AGCAAAAATCCTAATTAATTAGG - Intergenic
1015717524 6:136207829-136207851 AACTATAATCCTAATGCTTTGGG + Intergenic
1015978936 6:138819493-138819515 AGCCATCATTCTAATGGGGTAGG - Intronic
1016617162 6:146064511-146064533 AAGAATAATCCAAATGGATTTGG - Intronic
1016771917 6:147861459-147861481 AGAAATAATCACAGTGGGTTGGG - Intergenic
1018313642 6:162535229-162535251 ACTACCAATCCTAATGGGTTGGG + Intronic
1020098197 7:5380060-5380082 AGCCATGACCCTAATGGGTGAGG + Intronic
1021742307 7:23699378-23699400 AGCTATAATCCTAGTGCTTTGGG - Intronic
1021789721 7:24192616-24192638 AGAAATAAGCCTATTGGTTTGGG + Intergenic
1023859826 7:44211921-44211943 ACCAATAATACAAATGGGATTGG - Intronic
1030923995 7:115428532-115428554 AGTAATCATCCTAATGAGCTTGG + Intergenic
1032518179 7:132522348-132522370 AGCAATAATCCTAATGGGTTGGG - Intronic
1032616579 7:133479065-133479087 AGCAACAGTGCTAATGGGATAGG - Intronic
1035978418 8:4339762-4339784 ACCAAAAATCCTAATGCTTTGGG + Intronic
1036707304 8:11055364-11055386 AGCAAGAATCCTGCTGGGTCAGG - Intronic
1043520896 8:81044298-81044320 GACATCAATCCTAATGGGTTAGG - Intronic
1045209580 8:100082774-100082796 AGCAATAATCCTATGAAGTTAGG + Intronic
1045355201 8:101380994-101381016 AACAATAATAATAATGGATTAGG - Intergenic
1045718556 8:105078116-105078138 TGCACTAATCCAAATGGGTCAGG + Intronic
1045766340 8:105675291-105675313 AGAAATTTTCCTAATGGCTTGGG - Intronic
1045777407 8:105821899-105821921 AGCAATACTCCTCATGGACTGGG - Intergenic
1047979837 8:130169589-130169611 AGCAATAATACCAACGGGTTTGG + Intronic
1051435969 9:17032308-17032330 AGTAACCATCCTAATGGGTGTGG + Intergenic
1055899148 9:81214287-81214309 AACAATAATATTAATAGGTTTGG + Intergenic
1057461745 9:95269263-95269285 AGCAGTAGTCCTAAAGGGTCTGG + Intronic
1057730942 9:97607641-97607663 ACCTATAATCCTAATGCTTTGGG + Intronic
1057868704 9:98701853-98701875 AGGAATAAGTCTAATGGGTGGGG - Intronic
1058106146 9:100974131-100974153 AGCAATAAACATAATGGCTCTGG + Intergenic
1188580807 X:31710610-31710632 ATCAATAATGGTAATGTGTTCGG - Intronic
1188999348 X:36926150-36926172 AGCACTATTCCTAATGGCTAAGG - Intergenic
1193209051 X:78784045-78784067 AGCAATAAACCTAATGACTAAGG + Intergenic
1195030715 X:100925117-100925139 AGCAATAGTACTGATGGGTTGGG - Intronic
1198450314 X:136760710-136760732 AGCAATAAACCTGATGAATTTGG - Intronic
1202346144 Y:23930171-23930193 ATCAATCATATTAATGGGTTGGG - Intergenic
1202524627 Y:25739919-25739941 ATCAATCATATTAATGGGTTGGG + Intergenic