ID: 1032518667

View in Genome Browser
Species Human (GRCh38)
Location 7:132525998-132526020
Sequence GTACACACCTTGGGAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032518661_1032518667 9 Left 1032518661 7:132525966-132525988 CCTATTATGACCTCTGGGAACAC 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1032518667 7:132525998-132526020 GTACACACCTTGGGAAATGCTGG No data
1032518660_1032518667 10 Left 1032518660 7:132525965-132525987 CCCTATTATGACCTCTGGGAACA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1032518667 7:132525998-132526020 GTACACACCTTGGGAAATGCTGG No data
1032518662_1032518667 -1 Left 1032518662 7:132525976-132525998 CCTCTGGGAACACTGTTCCATGG 0: 1
1: 0
2: 3
3: 27
4: 275
Right 1032518667 7:132525998-132526020 GTACACACCTTGGGAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032518667 Original CRISPR GTACACACCTTGGGAAATGC TGG Intronic
No off target data available for this crispr