ID: 1032519079

View in Genome Browser
Species Human (GRCh38)
Location 7:132529128-132529150
Sequence TGGACTGGGGCTGGCTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 295}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032519079_1032519084 -6 Left 1032519079 7:132529128-132529150 CCAGCAAAGCCAGCCCCAGTCCA 0: 1
1: 0
2: 1
3: 23
4: 295
Right 1032519084 7:132529145-132529167 AGTCCATAATAACCCCACCCTGG 0: 1
1: 0
2: 0
3: 5
4: 84
1032519079_1032519090 8 Left 1032519079 7:132529128-132529150 CCAGCAAAGCCAGCCCCAGTCCA 0: 1
1: 0
2: 1
3: 23
4: 295
Right 1032519090 7:132529159-132529181 CCACCCTGGAAGGCCCTACCTGG No data
1032519079_1032519093 18 Left 1032519079 7:132529128-132529150 CCAGCAAAGCCAGCCCCAGTCCA 0: 1
1: 0
2: 1
3: 23
4: 295
Right 1032519093 7:132529169-132529191 AGGCCCTACCTGGCAGCCACTGG 0: 1
1: 0
2: 0
3: 22
4: 245
1032519079_1032519086 -2 Left 1032519079 7:132529128-132529150 CCAGCAAAGCCAGCCCCAGTCCA 0: 1
1: 0
2: 1
3: 23
4: 295
Right 1032519086 7:132529149-132529171 CATAATAACCCCACCCTGGAAGG 0: 1
1: 0
2: 2
3: 4
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032519079 Original CRISPR TGGACTGGGGCTGGCTTTGC TGG (reversed) Intronic
900297481 1:1959275-1959297 TGGACAGGGTCTGGCTCTGTTGG + Intronic
900316723 1:2060714-2060736 TGGTCTGGGGCTGGACCTGCCGG + Intronic
900486857 1:2926764-2926786 TGGGCTGGGCCGGGCTGTGCTGG + Intergenic
900569665 1:3352090-3352112 TGGCCTGGGGCTGTCTGAGCTGG - Intronic
901391189 1:8947349-8947371 TGAACTGGGGCAGACTCTGCAGG - Intronic
901656165 1:10770908-10770930 GGGACTGGGGCTTGGGTTGCTGG - Intronic
901703869 1:11059609-11059631 TGGGCTGGGGCTGGGACTGCGGG - Intronic
905233282 1:36529034-36529056 TGGACTGGGCAGGGCGTTGCTGG + Intergenic
905837484 1:41139344-41139366 TGGTCTGGTACTGGCTCTGCTGG + Intronic
906124611 1:43420028-43420050 GTAACTGGGGCTGGCTCTGCTGG + Intronic
906382894 1:45344140-45344162 GGGAGTGGGGCTGGTTTTGTAGG - Exonic
907402806 1:54235179-54235201 TGTCCAGGGGCTGGCTTTGGAGG + Intronic
911897655 1:103458029-103458051 TGGACTAGGACTGGCATTCCTGG - Intergenic
913045959 1:115073610-115073632 CTGACTGGGGATGGTTTTGCTGG + Intronic
913326898 1:117635364-117635386 TCCAGTGGGGCTGACTTTGCTGG - Intergenic
913487759 1:119349117-119349139 TGGACGGGGGAGGGCCTTGCTGG - Intergenic
913695327 1:121319258-121319280 TGGCATGAGGCTGGCATTGCTGG - Intronic
914142237 1:144960802-144960824 TGGCATGAGGCTGGCATTGCTGG + Intronic
915334248 1:155131477-155131499 TGGACTGGGGCTGGCACAGCTGG - Exonic
917211652 1:172637891-172637913 GGGACTGGGGCAGACTGTGCTGG + Intergenic
917351332 1:174081079-174081101 GGGAGTGAGACTGGCTTTGCTGG + Intergenic
917436876 1:175031079-175031101 GTGACCTGGGCTGGCTTTGCAGG - Intergenic
918972098 1:191433040-191433062 AGGAGTGAGACTGGCTTTGCTGG + Intergenic
920482658 1:206337637-206337659 TGGCATGAGGCTGGCATTGCTGG - Intronic
921518765 1:216132470-216132492 TGGCCTAGGGCTGGCTCTGCAGG - Intronic
923173958 1:231445501-231445523 AGGAGTGAGACTGGCTTTGCTGG + Intergenic
923415019 1:233748448-233748470 TGGATTGGGCCAGGCTTGGCAGG - Intergenic
924593100 1:245422003-245422025 TCAACTGGGGCAGGCTCTGCAGG + Intronic
1063075812 10:2715178-2715200 TGGACGGTGACTGGCTTTGCTGG + Intergenic
1064244308 10:13657104-13657126 TGGGCTGGCTCTGGCTGTGCAGG + Exonic
1065199127 10:23297099-23297121 AGTACTGGGGCTTGCTTTCCTGG + Intronic
1066370296 10:34814490-34814512 AGGCCTGGGGCTGGATTTCCCGG + Intronic
1067557499 10:47282989-47283011 GCCACTGGGGCTGGCATTGCTGG - Intergenic
1070158438 10:73850940-73850962 TGGGCTTGGCCTGGCTCTGCTGG - Intronic
1070596084 10:77834195-77834217 TGCACTGGGGCTGGCCTAGGTGG - Intronic
1070877446 10:79826634-79826656 TTGGCTGGTGCTGGCTTTACGGG + Intergenic
1071643938 10:87342675-87342697 TTGGCTGGTGCTGGCTTTACGGG + Intergenic
1071845935 10:89521248-89521270 TCGACTTGGACTGGCTTTGTTGG - Intronic
1072426922 10:95337657-95337679 TGCACAGGGGCTGGGTTGGCTGG - Intronic
1072654068 10:97318680-97318702 TGGACTGGGGTTGGCATTGCTGG - Intergenic
1073076194 10:100827028-100827050 TGTACTGGGGGTGGCTGTACGGG - Exonic
1074110160 10:110417311-110417333 TGGACTGGGCATAGCCTTGCAGG - Intergenic
1074481036 10:113820842-113820864 AGGACTGGGGAAGGGTTTGCTGG + Intergenic
1075015710 10:118908739-118908761 TGGACGGGAGCTGGCGTTTCAGG + Intergenic
1075232045 10:120688700-120688722 TGAAATGGAGCTGGCTTTGGAGG + Intergenic
1075423977 10:122327524-122327546 AGGACTGTGGCTGGCTGGGCTGG + Intronic
1075445200 10:122508200-122508222 TGGAGTGGAGATGGCTTTGCTGG + Intronic
1076192809 10:128494842-128494864 TTGACTGGACCTGGTTTTGCAGG + Intergenic
1076796624 10:132801520-132801542 TGGACTTGGGGTAGCTGTGCAGG + Intergenic
1076838391 10:133032631-133032653 GGGAGTGGGGCTGCCTCTGCTGG + Intergenic
1076982354 11:211351-211373 TAGGCTGGGGATGGCTGTGCAGG + Intronic
1077317215 11:1924958-1924980 GGGCCTGGGGCTCGCTTGGCAGG - Intronic
1077630558 11:3808577-3808599 GGGTCGGGGGCTGGCTCTGCGGG - Exonic
1078053469 11:7987386-7987408 GGGACTGGGGTTGGCGTGGCCGG - Exonic
1078431344 11:11290885-11290907 GTGAGTGGGGCTGACTTTGCTGG - Intronic
1080567548 11:33525786-33525808 GGGAATGAGACTGGCTTTGCTGG + Intergenic
1081581177 11:44353157-44353179 TGATCTGGGGCTGGCTATGCAGG + Intergenic
1081852896 11:46285918-46285940 TTGACAGGGGCTCGCTTTGGAGG + Intronic
1083703794 11:64499426-64499448 TGGGCTGGGGCTGGCACTGTGGG + Intergenic
1083896958 11:65624807-65624829 TGGGCTGGGGGTGCCTTTCCAGG + Intronic
1084020365 11:66413692-66413714 TTGACTGGGCCAGGCTGTGCTGG - Intergenic
1084085393 11:66852778-66852800 GGGGCTGGGGCTGGCCTTGACGG + Exonic
1084115480 11:67040550-67040572 AGGACTGGGGCTGGTTGTGGTGG + Intronic
1084361099 11:68669251-68669273 TGGGTTGGGGCCAGCTTTGCGGG + Intergenic
1084504001 11:69553849-69553871 TGGAGTGGGGGTGCCTGTGCTGG + Intergenic
1084509925 11:69597134-69597156 CGAACTGGAGGTGGCTTTGCTGG - Intergenic
1084751041 11:71204679-71204701 TAGACTGGGGCTGTCTTGGAAGG - Intronic
1084943193 11:72625265-72625287 TGCACTGGTGCTGGCTCTACTGG + Intronic
1085084216 11:73655958-73655980 TGGACTGGGCCTGGTTTTGGAGG - Intronic
1087666590 11:101056350-101056372 TGGCCTGGGGCTGGGTGTGGTGG + Intronic
1089299471 11:117489951-117489973 TGGACTGGGGCAGGCTGCCCTGG - Intronic
1089765010 11:120756899-120756921 TGGGCAGGGGCTGGCTGGGCTGG - Intronic
1092001092 12:5032992-5033014 GGGGCTGGGGCTGGCGTGGCTGG - Intergenic
1092118866 12:6029637-6029659 TGGCGTGGGGCTGGCCCTGCAGG - Intronic
1092290753 12:7158308-7158330 TGCACTGGGGCTGGCTGGGTTGG + Exonic
1093638973 12:21503059-21503081 TGGACTGGGGCTGCCTCTTGGGG + Intronic
1093662695 12:21775009-21775031 TGGAAAGGAGCTGGCTCTGCAGG - Intronic
1093974891 12:25410856-25410878 GGGACTAGGGCTGGAGTTGCAGG + Intronic
1095780128 12:46049678-46049700 AGGACAGGGGCAGGCTTGGCAGG - Intergenic
1096630965 12:52926493-52926515 GTGACTGGGGCAGGCTTTGTGGG - Intronic
1096849959 12:54429068-54429090 TTCACTGGTGCTGGCTTTGGGGG + Intergenic
1097228000 12:57490319-57490341 TGGGCTGGGGCTGCTTTTGGAGG - Exonic
1097777041 12:63658973-63658995 TTGACTGGTGATGGTTTTGCAGG + Intronic
1102721536 12:115020802-115020824 TGGGCTGGGGCTGGCATAGGAGG + Intergenic
1103873829 12:124111825-124111847 TGGACTGGGGTTGCATTTTCTGG - Intronic
1104289664 12:127455882-127455904 TGGGCTGGGGCAGGGTCTGCAGG + Intergenic
1104770051 12:131355917-131355939 AAGCCCGGGGCTGGCTTTGCAGG + Intergenic
1104862267 12:131929835-131929857 TGGACTGGGGTGGGCTGGGCTGG - Intronic
1105542272 13:21326126-21326148 GGGACCGGGGCTGACTTTGAAGG + Intergenic
1106269591 13:28139418-28139440 TGGAAAGGGGCTGGGTTTGCAGG + Intronic
1106561921 13:30854201-30854223 TGGTCAGGGGCTGGCTTAGAGGG + Intergenic
1108208057 13:48111162-48111184 TGGACTGGGGCTGGCTGAAAGGG - Intergenic
1110158081 13:72342501-72342523 GGGAGTGAGGCTGGCCTTGCTGG - Intergenic
1110484037 13:76017129-76017151 TGGACTTGGCCTGCCATTGCTGG + Intergenic
1110799703 13:79680752-79680774 TGCACTGGTGCTTGCTTTACTGG + Intergenic
1113633570 13:111904758-111904780 TGGGCTGGAGCGGGCTCTGCGGG - Intergenic
1116649015 14:47565931-47565953 TGGAGTGGGGGTGGTGTTGCTGG + Intronic
1119029608 14:71181511-71181533 TGAGCTGGGGCTGGGTCTGCAGG + Intergenic
1119318549 14:73715675-73715697 TTCACTGGGGCTCGCTTTTCTGG - Exonic
1119446718 14:74670846-74670868 TGGACTGGGGAGGGCCTCGCCGG - Exonic
1119592426 14:75902300-75902322 TGAACTGGGGCTCTCTTTGGAGG - Intronic
1119959153 14:78834946-78834968 TGGACTGGGGGTGGGTTGGGAGG - Intronic
1120223733 14:81766535-81766557 CTGACTGGGGCTGGCATTGTGGG + Intergenic
1122351683 14:101098564-101098586 GTGATTGGGGCTGGCGTTGCGGG + Intergenic
1122409280 14:101517826-101517848 TGGGGTGGGGCTGTCTGTGCAGG - Intergenic
1123039748 14:105485656-105485678 TGGCCTTGGGCTGGGTGTGCTGG + Intergenic
1123063218 14:105603747-105603769 TAGACTGGGGCAGGCTGGGCTGG - Intergenic
1123084573 14:105711490-105711512 TGGACTGGGCCGGGCTGAGCTGG - Intergenic
1123505738 15:20940664-20940686 AGGACTGCGGCTGGCCTCGCTGG + Intergenic
1123562972 15:21514370-21514392 AGGACTGCGGCTGGCCTCGCTGG + Intergenic
1123599219 15:21951653-21951675 AGGACTGCGGCTGGCCTCGCTGG + Intergenic
1124635423 15:31361712-31361734 AGAGCTGGGGCTGGCTGTGCAGG + Intronic
1127067805 15:55258437-55258459 TGGACAGGGCCTGGCCTTTCTGG - Intronic
1128681011 15:69651661-69651683 TGGACTGGGGCAGGATGTGATGG - Intergenic
1129266395 15:74395737-74395759 TGGCCTGGGGCTGGCTCTCCTGG - Intergenic
1130538576 15:84804212-84804234 AGGTCTAGGTCTGGCTTTGCAGG - Exonic
1130828591 15:87576279-87576301 TTGCCTGGGGCTGGGTTTGGGGG + Intergenic
1202971324 15_KI270727v1_random:241505-241527 AGGACTGCGGCTGGCCTCGCTGG + Intergenic
1132990114 16:2787972-2787994 TGGAAGGGGGCTGGCCATGCTGG - Intergenic
1133269837 16:4605485-4605507 GGGGCTGGGGCTGGCAGTGCAGG - Intergenic
1133763829 16:8821516-8821538 TGGAGTGGGGCTGGCCTTCCAGG + Intronic
1134095030 16:11413387-11413409 TGGACTGGGGCAGGGGTTGCTGG + Intronic
1135419987 16:22299235-22299257 TGGACTGGGGCTTGCCTTGTTGG + Intronic
1137591552 16:49696905-49696927 AGGAGGGGGGCTGGCTTTGATGG + Intronic
1137976449 16:53036369-53036391 TGGACTGGGGCTTGGATTGATGG - Intergenic
1138458567 16:57134715-57134737 TGGCCTGGGTCTGGGTTTGGGGG + Intronic
1139364561 16:66425896-66425918 TGGCCAGGGACTGGCCTTGCAGG - Intergenic
1139951830 16:70676211-70676233 GGCACTGGGGCTGGGTTTGGAGG - Intronic
1141184647 16:81778990-81779012 TGGACTGCGGCCGGCTCTCCAGG + Intronic
1141590471 16:85065441-85065463 TGGACGGAGGCTTGCTTTGCGGG + Intronic
1141754291 16:85981064-85981086 TGGAGTGGGGACGTCTTTGCAGG - Intergenic
1141850736 16:86644084-86644106 TGATCTTGGGCTGGCTTTGATGG + Intergenic
1142898765 17:2999309-2999331 TGGACTGAGGCAGGCTTTCAAGG + Intronic
1143456598 17:7071831-7071853 TGGCTGGGGGCTGGGTTTGCAGG + Intergenic
1143747265 17:9003575-9003597 AGGGCCGGGGCTGGCTTGGCCGG - Intergenic
1144209721 17:13003876-13003898 GAGCCTGGGTCTGGCTTTGCAGG - Intronic
1145272760 17:21413482-21413504 TGGACTGGGACTGGGGGTGCTGG + Intronic
1145310968 17:21700945-21700967 TGGACTGGGACTGGGGGTGCTGG + Intronic
1146581024 17:34039242-34039264 CGGACTGGGTCTGTCTGTGCTGG + Intronic
1147573187 17:41583921-41583943 TGGACTGTCCCTGGCTGTGCAGG - Exonic
1147652710 17:42071466-42071488 AAGACAGGGGCTGGCTCTGCTGG + Intergenic
1149092073 17:52795502-52795524 AGGCCTGGGGCTGCCTTTTCAGG - Intergenic
1151684181 17:75637119-75637141 TGGACTGAGGCTGAATTTACTGG - Exonic
1151898503 17:76996619-76996641 TGGACTGGAGCAGGCTGAGCTGG - Intergenic
1152528157 17:80901501-80901523 ATGAATGAGGCTGGCTTTGCAGG - Intronic
1152687549 17:81701977-81701999 TGGCCTGGGGCTCCCTCTGCAGG + Exonic
1153948668 18:10038781-10038803 TGCACTGGAGCTGGTTTGGCAGG + Intergenic
1154283813 18:13032969-13032991 TGCCCTGTGGCTGGCTCTGCAGG - Intronic
1154416261 18:14177582-14177604 GGGACTGCGGCTGGCCTCGCTGG + Intergenic
1159118385 18:64140895-64140917 TGCAGTGTTGCTGGCTTTGCAGG + Intergenic
1159153326 18:64549235-64549257 TGGACTTGTTCTTGCTTTGCTGG + Intergenic
1160077431 18:75691733-75691755 GGGAGTGGGGCTGTCTTGGCGGG + Intergenic
1160316133 18:77849424-77849446 TGGACAGGGGCAGCCTGTGCAGG - Intergenic
1161170866 19:2811931-2811953 TGGCCTGGGCCTGGGTGTGCCGG + Intronic
1161291763 19:3497559-3497581 TGCTCTGGGCCTGGCTTAGCTGG - Intronic
1161794498 19:6378625-6378647 TGGGCTGGGGCTGGCGCTCCTGG + Intronic
1162041797 19:7975243-7975265 TGGACTGGGGCAGTATTTGGGGG + Intronic
1162573637 19:11486415-11486437 AGGACTGGGACTGGATTTGAGGG + Intronic
1162969893 19:14174289-14174311 TGGACTGGGAATGCCTATGCAGG + Intronic
1163847337 19:19645238-19645260 TGGCTTGGGGCTGGTTCTGCTGG + Exonic
1163887381 19:19978572-19978594 TGGACTGGGACTGGGGTTGTAGG + Intergenic
1166314648 19:41982241-41982263 TGAATTGGGGGTGGCATTGCTGG - Intronic
1168146340 19:54421645-54421667 TGGACAGGGGCTGGTGTCGCTGG - Intronic
926043793 2:9694813-9694835 TGGTCAGGGGCTGGCGCTGCGGG + Intergenic
926215975 2:10905586-10905608 TGTACTGGGGCTGGAGTTGGGGG + Intergenic
926851208 2:17199452-17199474 TGCCCTGAGGCTGCCTTTGCTGG - Intergenic
929205561 2:39288171-39288193 GGAACTTGGGATGGCTTTGCTGG + Exonic
930519493 2:52447201-52447223 TTTACTGGGGCTTGCTTTACAGG + Intergenic
931036623 2:58251473-58251495 GGGACTGGGGCTGGCGTGGCCGG - Intergenic
934046447 2:88176477-88176499 TGGCCTTGGGCAGGCTTTCCAGG + Intronic
937248187 2:120507248-120507270 TGGGCTGGGACTGCCTTTCCAGG - Intergenic
937322323 2:120968305-120968327 TGACCTGGGGCTGGCTTCCCAGG + Intronic
937902617 2:127032869-127032891 TGGCCTGTGGCTGAATTTGCAGG + Intergenic
938018453 2:127886246-127886268 TTGGCTGGTGCTGGCTTTACGGG + Intergenic
940907599 2:159183246-159183268 TGGTATGTGGCAGGCTTTGCAGG + Intronic
945033691 2:205686519-205686541 TCGACTCGGGCTGGCTGTGCCGG + Intronic
946039825 2:216773951-216773973 TGGCCTGGAGCTGGTTTTCCAGG + Intergenic
946190247 2:218003989-218004011 AGGCCTGGGGCAGACTTTGCTGG - Intergenic
947092381 2:226526824-226526846 TAGACTGAAGCTGACTTTGCAGG + Intergenic
947210443 2:227703641-227703663 TGGAATGCTGCTGGGTTTGCTGG + Intronic
947614759 2:231548691-231548713 TGGACTTGGGATAGCTTTGTGGG - Intergenic
947715456 2:232336844-232336866 AGGACTGGGGCCTGCTCTGCTGG - Exonic
949056865 2:241932510-241932532 TGGCCTGGGGCGGGGTTTGGGGG + Intergenic
1169002477 20:2177998-2178020 TGGAGCAGGGCTGGCTTTGTGGG - Intergenic
1169104365 20:2981706-2981728 TGTACTGGTGCTGGGTTGGCAGG + Intronic
1169247443 20:4034625-4034647 TGGACGGTGCCTGGCTTTCCTGG + Intergenic
1171226657 20:23447144-23447166 TGGACAGAGGCTGCCTTTGGAGG - Intergenic
1171908302 20:30919662-30919684 TGAGCTGAGGCTGGCTTTGCCGG - Intergenic
1172359536 20:34302760-34302782 CGGCCTGGGGCTCGCTTTCCAGG + Intronic
1172933415 20:38601769-38601791 TGGGGCGGGGCTGGCTTGGCCGG - Intergenic
1174912590 20:54623016-54623038 TTCACTGGGGCTGGCTTCACAGG - Intronic
1175140473 20:56857230-56857252 TGGAGTGCAGCTGGGTTTGCAGG - Intergenic
1175357364 20:58379328-58379350 TTGACTGGGGTGGGCTTTGGGGG + Intergenic
1176857084 21:13981715-13981737 GGGACTGCGGCTGGCCTCGCTGG - Intergenic
1176867518 21:14062512-14062534 GGGACTGCGGCTGGCCTCGCTGG + Intergenic
1178144880 21:29727892-29727914 TGGACTCAGACTGGCTTTTCCGG - Intronic
1181582767 22:23837208-23837230 GGGCCTGGGGCAGGCTCTGCTGG - Intronic
1181624378 22:24113453-24113475 TGGCCTGGGGACTGCTTTGCAGG - Intronic
1183377211 22:37472339-37472361 TGGAGTGGGACAGGCTTTGGTGG - Intronic
1184340142 22:43881512-43881534 TGGAGAGGGGGTGGCTGTGCTGG - Intronic
1185235728 22:49711847-49711869 TGGCCTTGGGCTGCCTTGGCAGG - Intergenic
1185270706 22:49928309-49928331 TGGGCTGTGGCTGCCTCTGCGGG - Intergenic
1185292564 22:50034589-50034611 TGGTCTGGGGCTGGCCTGGCGGG + Intronic
949635096 3:5974031-5974053 AGGTCTGGGGCTGGTTTTACAGG + Intergenic
949908325 3:8878075-8878097 TGCACTGCGGCTGGCCCTGCTGG - Exonic
950270466 3:11610573-11610595 TGGACTGGGAAGGGCTGTGCAGG + Intronic
950968170 3:17161020-17161042 AGGACTGGAGCTGGGGTTGCTGG + Exonic
952312336 3:32201500-32201522 TGGGCTGGGGCAGGCTCTACTGG - Intergenic
952733901 3:36668904-36668926 TGGACTTGAACTGGCTTTCCTGG - Intergenic
954123764 3:48516803-48516825 TGCCCTGGAGCTGGCTTTCCGGG - Intergenic
954434868 3:50490595-50490617 GGGACAGAGCCTGGCTTTGCTGG - Intronic
954696422 3:52429688-52429710 GGGGCTGGGGATGGCTTTGATGG - Intergenic
956110620 3:65866921-65866943 TGGACTGCTGCTGGCTGTCCCGG + Intronic
956726758 3:72162874-72162896 TGGGCTGGAGCTGCCTGTGCTGG - Intergenic
960029137 3:113040170-113040192 CTGGCTGGGGCTGGCGTTGCAGG + Intergenic
960200706 3:114832174-114832196 TGGACTGGGCCAGGTGTTGCAGG - Intronic
962310635 3:134324514-134324536 AGGCCTGGGGCTGGCATTGAAGG - Intergenic
962610836 3:137074780-137074802 TGGACTGAGGCTGGGTGTGGTGG + Intergenic
962832752 3:139158706-139158728 TGGTCTGGGGCTGACTGTGTAGG + Intronic
967176564 3:186866129-186866151 TGGACGGTGCCTGGCTTTCCTGG + Intergenic
968889975 4:3363696-3363718 TGGGTTGGGGCAGGCTTGGCGGG + Intronic
969447944 4:7256032-7256054 CCCACTGGGGCTGGCCTTGCTGG + Intronic
969704917 4:8786377-8786399 TGGGCTGGGGCTGGTGTTGCTGG - Intergenic
970319686 4:14862969-14862991 GCGACTCGGGCTGGCCTTGCTGG - Intergenic
971558990 4:28050704-28050726 TGCACTGAGCCTGGCTTTGTGGG - Intergenic
972277389 4:37569866-37569888 TGGTCTAGCGCTGGCTTTGACGG - Intronic
972668913 4:41195272-41195294 TGGAATGGAGCTGGTTTTGGTGG - Intronic
975541195 4:75514130-75514152 TGGGCTGGGGCGGGCTGGGCAGG - Intronic
977773585 4:100889976-100889998 TGGACTGGGGAAGGCTTCCCAGG + Intergenic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
983238742 4:165207818-165207840 TGGAATGGTGCTGGCTGTGTTGG + Intronic
987877476 5:23697196-23697218 GTGAGTGGGGCTGGCTTAGCGGG - Intergenic
992174488 5:74136248-74136270 CAAATTGGGGCTGGCTTTGCTGG + Intergenic
993254367 5:85569727-85569749 TGCAGTGTGGCTGGCTTTGAAGG + Intergenic
995964004 5:117882148-117882170 TGGACTGGAGCTGCCTGTACTGG - Intergenic
997457271 5:134026662-134026684 TGGAATGCAGCTGGCTTGGCTGG - Intergenic
999205519 5:149845258-149845280 GTGACTGAGGCTGGCTTTGAAGG + Intronic
999266281 5:150269051-150269073 TAGAGTGGGGCTGGGTTTGGTGG - Intronic
999266408 5:150269639-150269661 TAGAATGGGGCTGGGTTTGGTGG - Intronic
999471379 5:151858052-151858074 GGTATTGGGGTTGGCTTTGCAGG - Intronic
1000394605 5:160760688-160760710 TGGAGTGAGCCTGGCCTTGCTGG + Intronic
1002541484 5:179908828-179908850 TGGACTGGCGCTGCCCCTGCAGG - Intergenic
1002759765 6:192359-192381 GGGTCTGGGGCTGGCTTCGTGGG - Intergenic
1003409761 6:5851745-5851767 GGGACCGGGGCTGACTTTGAAGG - Intergenic
1003715211 6:8638761-8638783 AGGACTGGGGCTGACCTTCCAGG - Intergenic
1005973291 6:30778294-30778316 TGTGCTTGGGCTGGCTTTACAGG + Intergenic
1006091509 6:31631605-31631627 TTGAGTGGGTCTGGCTTTGGGGG - Exonic
1006448334 6:34092145-34092167 GGGAATGGGGCTGGCTAGGCAGG - Intronic
1006993927 6:38240147-38240169 TGGAATGGGCCTGGCCTTGGTGG - Intronic
1010268958 6:73899942-73899964 TAGGCTGGTGCTTGCTTTGCTGG - Intergenic
1012052269 6:94361318-94361340 GGGACTTGGGGTGGCTTTTCTGG - Intergenic
1014549455 6:122772880-122772902 TGGGCAGGAGCTGGCTTAGCTGG + Intergenic
1017311610 6:152982891-152982913 TGCGCTGGGGCTGGCGCTGCAGG + Exonic
1017528710 6:155266459-155266481 GGGACTCAGGCTGGCTTTGTGGG - Intronic
1018383898 6:163285359-163285381 TGGACTGGGGCTGGCGGGGTGGG - Intronic
1018798096 6:167202777-167202799 TGGAAGGGGGCTGGCCTGGCGGG + Intergenic
1018814616 6:167321399-167321421 TGGAAGGGGGCTGGCCTGGCGGG - Intergenic
1018867513 6:167757876-167757898 TGGAGCGGGGAAGGCTTTGCTGG + Intergenic
1019133786 6:169896077-169896099 TGGGCTGGGGCTGGTGTTGCAGG - Intergenic
1019776632 7:2915448-2915470 TGAACAAGGTCTGGCTTTGCCGG - Intronic
1021549794 7:21858699-21858721 TTGACTGGGGCTGGCGATGGTGG + Intronic
1022029554 7:26479846-26479868 GGGACTGGCGTTTGCTTTGCAGG + Intergenic
1022302040 7:29110900-29110922 AGGACTCAGGCTGCCTTTGCAGG + Intronic
1022700066 7:32751239-32751261 TTGACTGGTGATGGTTTTGCAGG + Intergenic
1023645726 7:42312596-42312618 TGCACTGAAGCTGGCTCTGCTGG + Intergenic
1024159546 7:46660180-46660202 TGGACTGGGGCTTACACTGCTGG - Intergenic
1025924786 7:65949003-65949025 TGGAATGGGACTGGTTTTTCTGG - Intronic
1025932145 7:66004365-66004387 TGGAATGGGACTGGTTTTTCTGG - Intergenic
1026849725 7:73717287-73717309 TGGACTGGGGCGGGCTGGGCTGG - Intronic
1028028364 7:85875685-85875707 GGGAGTGAGGCTGGCCTTGCTGG + Intergenic
1028401569 7:90430883-90430905 GGGAGTGGGACTGGCCTTGCTGG + Intronic
1030161165 7:106509904-106509926 TGGAGAGGGGCTGGCGTTGATGG + Intergenic
1030183856 7:106739834-106739856 TAGAGTGGGGCTGGCCGTGCCGG - Intergenic
1032502582 7:132410929-132410951 AGGACTGGGGCTTGCTGTACAGG - Intronic
1032519079 7:132529128-132529150 TGGACTGGGGCTGGCTTTGCTGG - Intronic
1033643774 7:143286023-143286045 CCTACTGGGGCTGGCTTTGCTGG + Exonic
1035037775 7:155906617-155906639 TGTCCTGGGGCTGGCTGTGGGGG + Intergenic
1037725365 8:21478769-21478791 TTCACTGGGGCTGGTTTTGGGGG + Intergenic
1040663827 8:49606490-49606512 TGGACTGGGGCTGGAGCTGGTGG + Intergenic
1041411515 8:57561369-57561391 TGGCCTGGGGCTGGTTCTGGAGG - Intergenic
1042178675 8:66062672-66062694 TGGAGTGAGGCTGGCTGTGGTGG + Intronic
1042364646 8:67922711-67922733 TGTACTGGGGCTTGGTTTCCTGG - Intergenic
1042734430 8:71971622-71971644 TGGACTGGGCCTGACATTGCTGG - Intronic
1042958443 8:74277183-74277205 TGGCCTCAGGGTGGCTTTGCAGG - Intronic
1048800539 8:138190166-138190188 TTGGCTGGGGCTGGCATTGCAGG - Intronic
1049453015 8:142672519-142672541 TGGACTGGGGCTCCCATGGCAGG + Intronic
1049602340 8:143513784-143513806 CGGACTAGGCCTGGCTATGCAGG - Intronic
1052512196 9:29435948-29435970 TGGACTGTGGGTGGGTTTCCTGG - Intergenic
1052902651 9:33807348-33807370 TGGACTGGGCTTGGCTTACCTGG + Intergenic
1053428870 9:38028619-38028641 TGCGCTGGAGCTGGCCTTGCCGG - Intronic
1053487933 9:38474537-38474559 TGGACTGGGCTTGGCTTACCTGG - Intergenic
1054443128 9:65284424-65284446 TGGCCTGGGGCGGGCTGAGCTGG + Exonic
1054487153 9:65737077-65737099 TGGCCTGGGGCGGGCTGAGCTGG - Exonic
1054688186 9:68302883-68302905 TGGCCTGGGGCGGGCTGAGCTGG - Exonic
1057518061 9:95738214-95738236 TGGAGTGGGTCAGGCTTTGAGGG - Intergenic
1057714996 9:97486075-97486097 TGGACTGGGGCTGGCTGGAATGG - Intronic
1059724856 9:116997228-116997250 AGGCCTGGTGCTTGCTTTGCAGG + Intronic
1060189590 9:121583582-121583604 TGGGCACAGGCTGGCTTTGCTGG + Intronic
1060404782 9:123367834-123367856 TGAACTGGGACTCGCTTTGGAGG + Intronic
1060540934 9:124429594-124429616 TGGAGTGGGGCTGGCACTGGAGG + Intergenic
1061139148 9:128753722-128753744 TGGGCTGGGGATGGCTGGGCTGG + Intronic
1061445431 9:130634668-130634690 TGCTCTGCGGCTGGCTCTGCTGG - Exonic
1061649707 9:132037640-132037662 TGGGCTTGGGCTGGCTTCGGTGG + Intronic
1061893498 9:133634979-133635001 TGGCCTGAGCTTGGCTTTGCAGG + Intergenic
1062140549 9:134955504-134955526 GGGCCTGGGGCTGGCATGGCAGG + Intergenic
1062475785 9:136726472-136726494 AGGACTGGGGAAGGGTTTGCTGG - Intergenic
1190897342 X:54633728-54633750 GGGACTGAGACTGGCCTTGCTGG - Intergenic
1190928533 X:54929614-54929636 AGCACTGGTGCTGGCTTTGGTGG + Exonic
1192853358 X:74981034-74981056 TGGAGTGAGATTGGCTTTGCTGG + Intergenic
1192914534 X:75638313-75638335 AGGACTGTGGCTGTCTCTGCTGG + Intergenic
1193315053 X:80055355-80055377 TGGAGTGAGACTGGCTTTGTTGG - Intergenic
1194398479 X:93414601-93414623 TGGCCTGGGACTGGCTTTTCAGG - Intergenic
1194788746 X:98119173-98119195 TGGCCTGGGGCTCACTTTTCAGG - Intergenic
1195028270 X:100900346-100900368 AGGACTGGGGCTGGGTGTGATGG - Intergenic
1196767231 X:119257742-119257764 TGAAATGGTGCTGGCATTGCTGG + Intergenic
1197522508 X:127517191-127517213 TTTCCTGGGGCTGGCTTTGGGGG - Intergenic
1198405828 X:136311445-136311467 TGGAGTAGGACAGGCTTTGCTGG + Intronic
1199987683 X:152964235-152964257 CGGACTGGAGCTGGCTTCCCAGG - Intronic
1200045009 X:153396663-153396685 GGGGCTGGGGCTGGGTGTGCTGG + Intergenic
1201252403 Y:12072627-12072649 TGGTCCTGGGCTGGTTTTGCTGG - Intergenic