ID: 1032520853

View in Genome Browser
Species Human (GRCh38)
Location 7:132543824-132543846
Sequence AGGGGCATGAGACCAAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032520852_1032520853 -10 Left 1032520852 7:132543811-132543833 CCAAACTGATTAGAGGGGCATGA 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1032520853 7:132543824-132543846 AGGGGCATGAGACCAAAATCAGG 0: 1
1: 0
2: 0
3: 18
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032520853 Original CRISPR AGGGGCATGAGACCAAAATC AGG Intronic
902713322 1:18255477-18255499 AGGGGCATGATGGCAGAATCAGG - Intronic
903436966 1:23357312-23357334 AGGCTGATGACACCAAAATCTGG - Intergenic
903739901 1:25552723-25552745 ATGGGCATGAGGGCAAAAGCAGG - Intronic
903802721 1:25981653-25981675 AGGGGCATGAGACCCACGTAGGG + Intronic
906352225 1:45071597-45071619 AGGTGCATGCCACCAACATCTGG + Intronic
907984497 1:59517216-59517238 AAGGGCCTGAGACAGAAATCAGG - Intronic
909580824 1:77232608-77232630 ATGGGCATGTGACCAAACCCTGG - Intergenic
910846253 1:91607160-91607182 TGGGGAATGAGTCCAAAATTGGG + Intergenic
911222479 1:95263513-95263535 AGGGCCATAAGACCAAATTCTGG + Intergenic
913068337 1:115277758-115277780 AGAGCCAGAAGACCAAAATCTGG - Intergenic
917332383 1:173894909-173894931 AGGAGAATGAGACAAATATCTGG + Exonic
918326242 1:183413375-183413397 AGGAGAATGTGACCAAAAACAGG - Intronic
919931591 1:202224778-202224800 GGGGGCAGCAGACCAAAACCAGG - Intronic
920367047 1:205453646-205453668 AGGGGCAGGAGAGCAAACACGGG + Intronic
920712200 1:208306019-208306041 AAGGGCATGAGGGAAAAATCAGG + Intergenic
921785777 1:219228202-219228224 ATGGGCATGTGACCCACATCTGG - Intergenic
1067904646 10:50278234-50278256 TGGGGCATGAGAGCAGGATCTGG - Intergenic
1069596742 10:69676898-69676920 AGGGGGATATGACCAAAAGCAGG - Intergenic
1069691395 10:70355389-70355411 AGGGGCATGAGACAGGAAACAGG - Intronic
1070371114 10:75782884-75782906 AGAGGCATGAGAGCAACAGCAGG - Exonic
1071357978 10:84817707-84817729 AGGGGCCTGAGAACAAAGCCAGG - Intergenic
1073958458 10:108898655-108898677 ACAGGCATGAGACAAAAATCAGG - Intergenic
1079509570 11:21195323-21195345 AAGGACTTGAGACCAAACTCAGG - Intronic
1080766834 11:35305078-35305100 AGGGGCATTTGGCCAAAACCTGG - Intronic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1083162955 11:60867071-60867093 AGGGGCATTAGAGCAAGACCAGG - Intergenic
1083903935 11:65658042-65658064 AGGGTCATGAGATTAAAATCAGG + Intronic
1087317441 11:96619554-96619576 AGGGGAATGGAACCAAAACCAGG - Intergenic
1087424677 11:97971505-97971527 ATGGTATTGAGACCAAAATCTGG + Intergenic
1087679901 11:101209101-101209123 AGGGGCAGGAAATCAAAGTCTGG + Intergenic
1087918033 11:103832252-103832274 AGGGACAAGAGAACAAAACCAGG + Intergenic
1089118708 11:116117009-116117031 ATGGGCATGTGACCAAACCCTGG - Intergenic
1095963574 12:47851431-47851453 GGGGGCATGAGACCAACGTGGGG - Intronic
1101646736 12:106637803-106637825 AGGGTCATGTGAGCTAAATCTGG + Intronic
1104050716 12:125191790-125191812 CAGTGCATGAGACCAAAATTCGG - Intronic
1105830261 13:24157827-24157849 AGGAGCATGAGATCAAATCCTGG + Intronic
1106506856 13:30378062-30378084 AGGGTTTTGAAACCAAAATCTGG + Intergenic
1106590973 13:31098323-31098345 AGGGGGATGAGAGCAACCTCTGG + Intergenic
1107389216 13:39945649-39945671 AGGGGCCAGAGACCAAAACCAGG + Intergenic
1109648386 13:65291621-65291643 AGGGTCATGTGAACAAACTCAGG + Intergenic
1110596108 13:77322299-77322321 AGGGGATTGTGACCAAAATGGGG - Intronic
1114590322 14:23858771-23858793 AGGGGCATGACACCTGAATTTGG + Intergenic
1114634254 14:24178482-24178504 AGGGTCATGAGCGCAAAAGCTGG + Intronic
1115307267 14:31945600-31945622 ATGGGCCTGGTACCAAAATCAGG - Intronic
1115525566 14:34277122-34277144 ATGGGCATGAGACCCAGTTCTGG + Intronic
1115677840 14:35700179-35700201 AGGGGAGTGAGAACAATATCAGG + Intronic
1117713036 14:58552048-58552070 AGAGGCATATGACCAAAAGCAGG - Intergenic
1121556189 14:94839545-94839567 AGGGGCATGTGACACAATTCTGG + Intergenic
1123121499 14:105918999-105919021 CGGGCCATGAGACCAGACTCGGG - Intronic
1123157042 14:106237165-106237187 AGGGGCAAGCCACCAAAACCAGG + Intergenic
1124475015 15:30025690-30025712 AGGGGCATGAAACCCAACTCAGG + Intergenic
1124623404 15:31293137-31293159 AGGGGAATGAGGCCAGAAGCCGG - Intergenic
1129162963 15:73757388-73757410 AAGGCCATGAGAACAAAAACTGG - Intergenic
1129515707 15:76155996-76156018 AAGGGTATGAGACCAACATCTGG - Intronic
1131811301 15:96176315-96176337 ATGGGCATGAGAGAACAATCTGG + Intergenic
1133512180 16:6470674-6470696 AGGGGCATCAGACAAATACCTGG - Intronic
1133818165 16:9213929-9213951 AGCCTCATGAGGCCAAAATCAGG + Intergenic
1134268009 16:12708271-12708293 AGGGGCAAGAGACCAACCCCAGG - Intronic
1138385022 16:56630535-56630557 AGGGGCATGATACTAACCTCTGG + Intergenic
1138481143 16:57304108-57304130 AGGTCCCTGAGACCAAAATTGGG + Intergenic
1138530583 16:57632164-57632186 AGGGACAAGAGCCCAAATTCTGG - Intronic
1138562621 16:57810953-57810975 AGGGGCATGAGACCCAGAACAGG - Intronic
1140301248 16:73759409-73759431 ATGGTCATGTGACTAAAATCTGG - Intergenic
1143136979 17:4717563-4717585 AGGGTCGTGAGACCACAATGAGG + Intronic
1144452029 17:15389120-15389142 ATGGCCATGAGACCAAGTTCTGG + Intergenic
1146651497 17:34609630-34609652 AGGGGAATGAGACCACAAGGTGG - Intronic
1150207928 17:63422969-63422991 AGGGCCACTAGAACAAAATCTGG - Exonic
1150939044 17:69670272-69670294 ATGAGTATGAGACAAAAATCAGG + Intergenic
1152864800 17:82716351-82716373 AGGGGCATCAGCCCAAGGTCTGG - Intergenic
1155110893 18:22713262-22713284 AGGGGCATGAGAGAAATATTTGG - Intergenic
1156019252 18:32580828-32580850 GTGGGTATGTGACCAAAATCTGG + Intergenic
1162959151 19:14116118-14116140 TGGGGTTTGAGACCAAAAACTGG + Intronic
1163257244 19:16164180-16164202 AGGAGCTTGAGACCAAACTGGGG - Intronic
1163918244 19:20261781-20261803 AGAGGCCTGAGAACAAATTCTGG + Intergenic
1166348649 19:42182907-42182929 AGGGCCCTGAGACCACAAGCGGG + Intronic
1167031858 19:46967525-46967547 AAGGACATGAGACCAGAAACAGG - Intronic
925531106 2:4863521-4863543 ATGGGCATGAGAGCAATGTCTGG + Intergenic
926396104 2:12443793-12443815 AGGGGCAAGAGAGAAAGATCAGG + Intergenic
926562922 2:14437532-14437554 AGGGGCATGAGGGAAAAGTCTGG + Intergenic
927038510 2:19204820-19204842 AGGGCCATGAGTGCAAATTCAGG - Intergenic
928008529 2:27584922-27584944 AGTGGCCTAAGACCAATATCTGG - Intronic
932839964 2:75072789-75072811 AGGAGGATGAGACCAACTTCAGG + Intronic
933625663 2:84595843-84595865 ATGCTAATGAGACCAAAATCAGG + Intronic
935539613 2:104334156-104334178 AGGAGCATGGCACCAACATCTGG - Intergenic
937434964 2:121872777-121872799 AAGGTCATGAGACCAAACTGTGG + Intergenic
939202730 2:139058964-139058986 AGAGGCTTGCAACCAAAATCTGG - Intergenic
941553339 2:166943600-166943622 AGGGGCATGGGACTGAAGTCAGG + Intronic
941874689 2:170420731-170420753 AGTGCCATGAGACCAGAAACTGG + Intronic
943762875 2:191628966-191628988 ATGGGCCTGAGACCCTAATCTGG + Intergenic
944395395 2:199260722-199260744 AGGAGCGTGGGACCAAGATCTGG + Intergenic
945723864 2:213451529-213451551 TTGGCCATGAGACCAAAACCTGG - Intronic
946054817 2:216891495-216891517 GGGGGCATAATACAAAAATCTGG - Intergenic
947597961 2:231425882-231425904 AGGGGCAGGAGGCTAAAGTCAGG + Intergenic
947795273 2:232890401-232890423 AGGTGCCTGAGACCAAACTCAGG - Intronic
948054855 2:235003434-235003456 CGGGGCATGAGAGCAGAATGAGG + Intronic
948205235 2:236159865-236159887 GGGGGCCTGAGACCGAAACCGGG - Intergenic
1168849741 20:968294-968316 ATGGTCATGTGACCAACATCTGG + Intronic
1168944897 20:1745136-1745158 AGAAGCATGAGACCAGAATGGGG - Intergenic
1170473860 20:16695204-16695226 AAGGGAATGAGAAGAAAATCAGG + Intergenic
1172035103 20:32004982-32005004 AGGGGCATGTGACCCAATTCTGG + Intergenic
1173105955 20:40134027-40134049 AGGGGCTTGAGACCGACATACGG + Intergenic
1173321784 20:41993866-41993888 ATGGGCATGAGGGCAAAAACAGG + Intergenic
1173594734 20:44251409-44251431 AGGGGCAAGAGACCCAAGTCTGG + Intronic
1173597952 20:44271946-44271968 AGGGTCATGAGAGCAGATTCAGG + Intronic
1174073472 20:47915384-47915406 TGGGGCATGAGACCAAATCTAGG - Intergenic
1175502259 20:59458887-59458909 ATGGGCATGTGACCAAATTCAGG + Intergenic
1177500797 21:21951945-21951967 AAGGGCATGAGATCTAAAACTGG + Intergenic
1179095800 21:38313653-38313675 AGAGGCATGAGTCCAATGTCTGG - Intergenic
1182062358 22:27407322-27407344 AGGGGCACGAGAGCAAATTCTGG + Intergenic
1182431460 22:30301362-30301384 CGGGGCATGAGAAGAACATCTGG + Intronic
1184308071 22:43622182-43622204 AGTGCCATGATACCAAAATCAGG + Intronic
949855469 3:8457393-8457415 AGGGGCATGTGACTAATTTCTGG - Intergenic
949916371 3:8967735-8967757 ATGGGCATGTGACCCAATTCTGG - Intergenic
951557090 3:23931779-23931801 AGGGTCATGAGACCCAAATTTGG + Intronic
952419924 3:33121708-33121730 GGAGGCATGAGGCTAAAATCAGG - Intronic
953256280 3:41293339-41293361 AGGAGAATGAGATTAAAATCAGG + Intronic
953696158 3:45161272-45161294 AGGGGACTGAGCCCAAAACCTGG - Intergenic
953761472 3:45690485-45690507 AGGGAAATGACACCAAAATGTGG + Intronic
954471149 3:50696555-50696577 AGAAGCATGAGAGCAAATTCAGG + Intronic
954900540 3:54015356-54015378 TGTGGCCTGAGACCAACATCAGG - Intergenic
958160174 3:89808825-89808847 AGAGGCATAAGACCAAAAAATGG - Intergenic
959080512 3:101796103-101796125 ATGGGCATGTGACCCAATTCTGG - Intronic
968708253 4:2093960-2093982 TGGGGCATGAGACCATGAACAGG + Intronic
974150348 4:57999439-57999461 AGGGCAATAAGACTAAAATCTGG - Intergenic
977482315 4:97593822-97593844 AGGGGCCAGAGAACAAAACCAGG + Intronic
977932773 4:102766801-102766823 AGGGGTATGAGACAAAAATTAGG + Intergenic
978168641 4:105641252-105641274 AGGGGCTGGATACCAAAATAAGG - Intronic
978526185 4:109668929-109668951 AGGGGCATGAGGGAGAAATCAGG - Intronic
979019566 4:115479030-115479052 AGGGGCTTGAGATCAAAAGCTGG + Intergenic
979333293 4:119440387-119440409 AGGGCAATGAGAACAAAATTCGG + Intergenic
981780613 4:148425475-148425497 AGAGGCAGGAAACCAAAATCAGG + Intronic
1000163360 5:158622768-158622790 AGGGGAATGAGATAAAGATCTGG - Intergenic
1004202336 6:13560824-13560846 AAGAGCATGTGACCCAAATCTGG + Intergenic
1005010512 6:21331171-21331193 AGGGGCATGATACCAAAGCGAGG + Intergenic
1007689139 6:43687483-43687505 AGGGGCAGGAGATCAAGATAAGG + Intronic
1007904761 6:45448488-45448510 AGGGCCAGGAGACCACGATCTGG + Intronic
1009959943 6:70507023-70507045 AGGGGACTAAGACAAAAATCAGG + Intronic
1014723727 6:124950636-124950658 AGAGGAATGAGAGCAAAGTCAGG - Intergenic
1017106943 6:150896799-150896821 ATGGGCATGAGACCAAGAAGGGG + Intronic
1017600288 6:156073023-156073045 GTGGGCAGGAGACAAAAATCTGG + Intergenic
1022642843 7:32204560-32204582 AGAGGGATGCCACCAAAATCTGG + Intronic
1024070750 7:45783277-45783299 AGGGCAATGAGAACAAAATTTGG - Intergenic
1031661014 7:124424340-124424362 AGGGAGATCAGACCAAATTCTGG + Intergenic
1032345112 7:131109856-131109878 AGGGGCACGCGAACAAAATGAGG - Intergenic
1032520853 7:132543824-132543846 AGGGGCATGAGACCAAAATCAGG + Intronic
1037379218 8:18266483-18266505 AGGGGAAAGGGGCCAAAATCAGG + Intergenic
1043082305 8:75782204-75782226 AGAAGCATGAGACCAGCATCTGG + Intergenic
1046495661 8:115010420-115010442 AGTGGCCTGAGACCCATATCTGG + Intergenic
1046974449 8:120258380-120258402 AGAGGCATGTGACCCAAACCAGG - Intronic
1047294710 8:123560551-123560573 CAGGGCATGTGACCCAAATCAGG + Intergenic
1047496926 8:125415201-125415223 ATGGGCATGTGACCCACATCTGG + Intergenic
1048680518 8:136836257-136836279 AGGGGCAAGAGGCCACAAACTGG - Intergenic
1051299618 9:15634449-15634471 GGGTGCACCAGACCAAAATCAGG - Intronic
1051627053 9:19108215-19108237 ATGGGCATGTGACTAAAAGCAGG - Intergenic
1053416028 9:37947283-37947305 AGGGGAATAAGACCAAAGGCTGG - Intronic
1055038791 9:71846626-71846648 CTGGGCTTCAGACCAAAATCTGG + Intergenic
1060101502 9:120844247-120844269 TGGGGCAAAAGACAAAAATCTGG + Intergenic
1061878436 9:133556532-133556554 AGGGGCAAGAGCCTGAAATCAGG + Intronic
1188989889 X:36804866-36804888 AAGAGCAAGAAACCAAAATCTGG - Intergenic
1189008430 X:37019312-37019334 ATGGGCATGTGACCAAAACTAGG - Intergenic
1189040299 X:37535698-37535720 ATGGGCATGTGACCAAAATTAGG + Intronic
1189271835 X:39757568-39757590 AGGGGCATGAGACCTTACACAGG + Intergenic
1190561695 X:51692666-51692688 AGTAGCCTGATACCAAAATCTGG + Intergenic
1190562594 X:51700639-51700661 AGTAGCCTGATACCAAAATCTGG - Intergenic
1192211220 X:69129090-69129112 AGGGGCCTGAGGGCAAGATCTGG + Intergenic
1193263218 X:79435344-79435366 ATGAGCCTGATACCAAAATCTGG + Intergenic
1197617862 X:128714822-128714844 AGAAGCAGGAGAGCAAAATCCGG + Intergenic
1198665733 X:139020412-139020434 AGCAGCATGGGACCAAATTCTGG - Intronic