ID: 1032521166

View in Genome Browser
Species Human (GRCh38)
Location 7:132546364-132546386
Sequence AAATATGCTACCCTGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032521157_1032521166 29 Left 1032521157 7:132546312-132546334 CCCTTTCATATGGTCTTGATCTT 0: 1
1: 0
2: 0
3: 24
4: 304
Right 1032521166 7:132546364-132546386 AAATATGCTACCCTGTTGGGAGG No data
1032521160_1032521166 5 Left 1032521160 7:132546336-132546358 CCTCCTGCTTTGACAGTTTTAGT 0: 1
1: 0
2: 1
3: 10
4: 173
Right 1032521166 7:132546364-132546386 AAATATGCTACCCTGTTGGGAGG No data
1032521162_1032521166 2 Left 1032521162 7:132546339-132546361 CCTGCTTTGACAGTTTTAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1032521166 7:132546364-132546386 AAATATGCTACCCTGTTGGGAGG No data
1032521158_1032521166 28 Left 1032521158 7:132546313-132546335 CCTTTCATATGGTCTTGATCTTC 0: 1
1: 0
2: 0
3: 14
4: 174
Right 1032521166 7:132546364-132546386 AAATATGCTACCCTGTTGGGAGG No data
1032521159_1032521166 6 Left 1032521159 7:132546335-132546357 CCCTCCTGCTTTGACAGTTTTAG 0: 1
1: 0
2: 0
3: 16
4: 206
Right 1032521166 7:132546364-132546386 AAATATGCTACCCTGTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032521166 Original CRISPR AAATATGCTACCCTGTTGGG AGG Intronic
No off target data available for this crispr