ID: 1032531026

View in Genome Browser
Species Human (GRCh38)
Location 7:132620254-132620276
Sequence TAAGCGGCCTGCCTCTGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032531018_1032531026 13 Left 1032531018 7:132620218-132620240 CCCACCTACTCTTGTGATTTCTG 0: 1
1: 0
2: 2
3: 19
4: 232
Right 1032531026 7:132620254-132620276 TAAGCGGCCTGCCTCTGATTAGG 0: 1
1: 0
2: 1
3: 2
4: 50
1032531019_1032531026 12 Left 1032531019 7:132620219-132620241 CCACCTACTCTTGTGATTTCTGA 0: 1
1: 0
2: 2
3: 24
4: 216
Right 1032531026 7:132620254-132620276 TAAGCGGCCTGCCTCTGATTAGG 0: 1
1: 0
2: 1
3: 2
4: 50
1032531021_1032531026 9 Left 1032531021 7:132620222-132620244 CCTACTCTTGTGATTTCTGAGGT 0: 1
1: 0
2: 1
3: 12
4: 230
Right 1032531026 7:132620254-132620276 TAAGCGGCCTGCCTCTGATTAGG 0: 1
1: 0
2: 1
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032531026 Original CRISPR TAAGCGGCCTGCCTCTGATT AGG Intronic
901587731 1:10312150-10312172 TAAGGTGCCTGCCAGTGATTTGG - Intronic
904811990 1:33169380-33169402 TATGCGTGCTGCCTCTGGTTCGG + Intronic
920308093 1:205031689-205031711 TAATCCTCCTGCCTCTGAGTGGG + Intergenic
921395711 1:214667150-214667172 TAGGCTGTCTGCATCTGATTTGG + Intergenic
1077715393 11:4575321-4575343 TAAGCAGCTTCCCTCTGATGGGG + Intronic
1093434824 12:19124557-19124579 AAAGAGGCATGCTTCTGATTTGG - Intergenic
1097199834 12:57269043-57269065 TAAGCCGCCTGCTGCTGGTTAGG + Exonic
1113230693 13:108211819-108211841 CAAGGGCCCTGCCTATGATTAGG - Intronic
1118677370 14:68201847-68201869 TATGTTGCCTGCTTCTGATTTGG + Intronic
1120951557 14:90046385-90046407 GAAGCTGCGTGCCCCTGATTTGG + Intergenic
1125189460 15:36973411-36973433 TAAGCGCACTGACTCTTATTTGG + Intronic
1127606419 15:60592184-60592206 GGATCGGCCTGCCTCCGATTGGG - Intronic
1128329671 15:66747342-66747364 TAAGGAGCCTGGCTTTGATTTGG + Intronic
1128568098 15:68714481-68714503 TAAGAGGCCTTCCTGGGATTTGG + Intronic
1140084348 16:71780581-71780603 TAACAGGCCTGCAACTGATTGGG + Intronic
1141918604 16:87119593-87119615 TAGGCGGCCTGCCTGGGAGTGGG + Intronic
1143006437 17:3838279-3838301 GAGGCGGCTTGCCTCTGATACGG - Intronic
1151441161 17:74130135-74130157 TCAGCGTCATGCCTCTGATATGG - Intergenic
1156794436 18:41025600-41025622 TAAGAGGTCAGCCGCTGATTGGG + Intergenic
927439010 2:23096828-23096850 TAAGAGGGCTGCTTCTGACTTGG + Intergenic
943011760 2:182458695-182458717 TTATCACCCTGCCTCTGATTGGG + Intronic
1173233802 20:41225347-41225369 TCAGTGGCCAGCCTCTGAGTGGG - Intronic
1175910291 20:62402085-62402107 AAAGCTGCCTGCATCTGACTTGG + Intronic
1178246887 21:30961509-30961531 AAAGAGGCCTGCATGTGATTTGG - Intergenic
1179353585 21:40636856-40636878 TTAGCTGCCTGTCTCTGATCCGG - Intronic
1181627455 22:24131454-24131476 TAGGCAGCCTGCCTCTGCTCTGG + Intronic
1184065641 22:42118421-42118443 TAAGCTGCCTGACACTGATATGG + Intergenic
951352248 3:21620257-21620279 TAAGCATCCTTCCTCTGTTTTGG - Intronic
961092073 3:124121849-124121871 TAACAGGTCTGCCTGTGATTAGG - Intronic
963861752 3:150317904-150317926 TAAGCTACCTACCTCTGATATGG + Intergenic
968292792 3:197551908-197551930 TTAGTGGCCTGCCTTTAATTTGG - Intronic
969503615 4:7570263-7570285 TCAGCGGCCTGCCTGTGCCTGGG - Intronic
973970061 4:56204386-56204408 CAAGGGGCCTGCATCTGATGAGG + Intronic
981112133 4:140947622-140947644 TAGGCTGCCTGCTTTTGATTGGG - Intronic
993482388 5:88439706-88439728 TAAGCGGCCTGGCTTTGGTCCGG + Intergenic
993849136 5:92984040-92984062 TGAATGCCCTGCCTCTGATTGGG - Intergenic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
1000996544 5:167965050-167965072 AAAGTGGCATGCCTTTGATTAGG + Intronic
1002570808 5:180138312-180138334 GAAGAGGCCTGCCCCTGAGTGGG - Exonic
1006996358 6:38264872-38264894 GCAGAGGCCTGCCTCTGAATGGG + Intronic
1013676177 6:112465507-112465529 TAAGCTGGCCGCCTATGATTGGG + Intergenic
1015926402 6:138314130-138314152 TGAGGGGCTTGCCTCTGATGAGG + Intronic
1019857151 7:3620704-3620726 TCAGCCGCCTGCTCCTGATTGGG - Intronic
1032531026 7:132620254-132620276 TAAGCGGCCTGCCTCTGATTAGG + Intronic
1037415462 8:18644908-18644930 TAAGGGGCCTGCATCTGATGAGG + Intronic
1041528719 8:58838275-58838297 GAAGCGGCCTGCCTCTGATATGG - Exonic
1042439781 8:68811449-68811471 GAAGCTGCCTGCGTCTGAGTTGG - Intronic
1058507598 9:105682000-105682022 TAAGCAGTCTGGCTCTGATTAGG - Intergenic
1192336980 X:70229775-70229797 TAAGGGGCCTGCGTCTGGTGAGG + Intergenic
1195667751 X:107445864-107445886 TAAACTGCCTGCCTCTGCTGGGG - Intergenic
1196129929 X:112144529-112144551 TAGGCTGCCTGCCTAAGATTTGG + Intergenic
1198846084 X:140912447-140912469 TAAGTGACCTGTCTATGATTAGG - Intergenic
1201759708 Y:17523399-17523421 TAAGGGGGCTGCCTCTGAAGGGG + Intergenic
1201841846 Y:18382591-18382613 TAAGGGGGCTGCCTCTGAAGGGG - Intergenic