ID: 1032531605

View in Genome Browser
Species Human (GRCh38)
Location 7:132625288-132625310
Sequence CTGAAGGAGCAGAATTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 223}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032531602_1032531605 -5 Left 1032531602 7:132625270-132625292 CCAGCACAGTGCTGGATCCTGAA 0: 1
1: 0
2: 2
3: 31
4: 273
Right 1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG 0: 1
1: 0
2: 1
3: 15
4: 223
1032531598_1032531605 3 Left 1032531598 7:132625262-132625284 CCTCCAGCCCAGCACAGTGCTGG 0: 1
1: 0
2: 4
3: 76
4: 826
Right 1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG 0: 1
1: 0
2: 1
3: 15
4: 223
1032531596_1032531605 5 Left 1032531596 7:132625260-132625282 CCCCTCCAGCCCAGCACAGTGCT 0: 1
1: 0
2: 7
3: 66
4: 719
Right 1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG 0: 1
1: 0
2: 1
3: 15
4: 223
1032531597_1032531605 4 Left 1032531597 7:132625261-132625283 CCCTCCAGCCCAGCACAGTGCTG 0: 1
1: 0
2: 7
3: 50
4: 495
Right 1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG 0: 1
1: 0
2: 1
3: 15
4: 223
1032531600_1032531605 0 Left 1032531600 7:132625265-132625287 CCAGCCCAGCACAGTGCTGGATC 0: 1
1: 0
2: 0
3: 20
4: 236
Right 1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG 0: 1
1: 0
2: 1
3: 15
4: 223
1032531595_1032531605 19 Left 1032531595 7:132625246-132625268 CCACATGATGAAAGCCCCTCCAG 0: 1
1: 0
2: 0
3: 13
4: 182
Right 1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG 0: 1
1: 0
2: 1
3: 15
4: 223
1032531601_1032531605 -4 Left 1032531601 7:132625269-132625291 CCCAGCACAGTGCTGGATCCTGA 0: 1
1: 0
2: 9
3: 45
4: 515
Right 1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG 0: 1
1: 0
2: 1
3: 15
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032531605 Original CRISPR CTGAAGGAGCAGAATTATGA AGG Intronic
901824497 1:11851891-11851913 CTGAGGCAGGAGAATCATGAAGG + Intergenic
902196146 1:14799858-14799880 CTCAAGGAGAGGAATTCTGATGG - Intronic
902628723 1:17692121-17692143 GTGAAGGCTCAGAACTATGATGG - Intronic
905078368 1:35294460-35294482 TTGAATTAGAAGAATTATGAAGG + Intronic
905468330 1:38172875-38172897 GTCAAGGAGCAGAATTAGGCTGG + Intergenic
909334545 1:74456303-74456325 GAAAAGGAGCAGATTTATGAGGG + Intronic
910295286 1:85637842-85637864 CTGAAGAAGCAAACCTATGAAGG + Intergenic
910959292 1:92744526-92744548 CTTAAGAAGGAGAATTATCAGGG - Intronic
913200948 1:116494953-116494975 CTGAAAGAGAACAATTAGGAAGG + Intergenic
913435606 1:118844538-118844560 ATGAAGGAGCTAAATGATGATGG - Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
914768190 1:150658477-150658499 CTATAGGAGCAGATTTATTATGG - Intronic
914773476 1:150713648-150713670 CTGAATTAGCAAAATTAAGAAGG - Intronic
917815521 1:178706124-178706146 CTGAAGGAGTGGAAGTTTGATGG + Intergenic
918508864 1:185288310-185288332 CTGAGGCAGCAGGATCATGAAGG - Intronic
921300628 1:213748336-213748358 ATGAAGGAGCAGATTTTTGAGGG + Intergenic
921557086 1:216611900-216611922 ATGAAGAAGCAGAAATATGGAGG + Intronic
923513530 1:234674356-234674378 CTGTAGGTGCTGATTTATGAGGG + Intergenic
924480393 1:244426551-244426573 CTAAAGGTGCACAGTTATGATGG - Intronic
1062867950 10:872786-872808 GTTAATGAGCAGAATTCTGAGGG - Intronic
1065119595 10:22515630-22515652 CTTTAGGAGGAGAATTAGGAGGG + Intergenic
1068215568 10:53978208-53978230 CTGCAGGGGCAGAATTCTCATGG - Intronic
1070683237 10:78463764-78463786 GTGAAGGAGAAGCATCATGAGGG + Intergenic
1071477849 10:86040087-86040109 CTGAAAAAGCAGAGTTAAGATGG + Intronic
1071754934 10:88527090-88527112 CTGAAGGTGCAGAATCATGTAGG + Intronic
1071951074 10:90703137-90703159 CTAAAGGTGTAGAATAATGATGG - Intergenic
1073994391 10:109299144-109299166 CTGAAGGAACAGAGTGATGTTGG - Intergenic
1078622288 11:12919884-12919906 CTGAAGGAGAAGTAATATAATGG - Intronic
1078646225 11:13143248-13143270 GTGATGAAGCAGAATGATGAAGG + Intergenic
1079522500 11:21344855-21344877 CTGGAGAAGCAGAATAATTAAGG - Intronic
1079745679 11:24125830-24125852 ATGAGGGAGCAGAAAGATGAAGG + Intergenic
1080273291 11:30473717-30473739 CAGAAGGAGCAGAAAGATGCAGG - Intronic
1080889554 11:36397754-36397776 ATGAAGGAAAAGAATTAAGAAGG - Intronic
1081444736 11:43119623-43119645 CTGAAGCAGCAGCATCAAGAAGG + Intergenic
1085596091 11:77811546-77811568 CTTAAAGAGCAGACTAATGACGG + Intronic
1086980011 11:93185769-93185791 ATAAATGAGCAGAATTTTGATGG - Exonic
1088325246 11:108593930-108593952 CTTAAGAGGCAGAATTATGTAGG - Intergenic
1088723641 11:112616091-112616113 CTGAAAGACCAGGATGATGAAGG - Intergenic
1092231515 12:6778189-6778211 CGGAAGGAGGAGAAGGATGAAGG - Intronic
1093092456 12:14936989-14937011 CTGAAGGAGCAGAATAAGAGAGG - Intronic
1093177167 12:15925675-15925697 CTGAAGAAGTAGAACTTTGAAGG + Intronic
1093977842 12:25442100-25442122 ATGAAGGAGCAGGAATATGAGGG - Intronic
1094030589 12:26007479-26007501 CTGCAAGAGCAGAATGAAGAAGG + Intronic
1094740667 12:33284745-33284767 TTGAAGGAACAAAATAATGAGGG + Intergenic
1096320584 12:50609041-50609063 CTGAAGCAGGAGAATCATGGAGG + Intronic
1096456076 12:51788135-51788157 CTGAAGGAGTAGAATTGGGAAGG + Intronic
1097119577 12:56721040-56721062 CTGAAGGAGGTGAAGTAAGAAGG + Exonic
1098052340 12:66467699-66467721 CTTAAGGAACAGAAGGATGATGG - Intronic
1098543921 12:71689953-71689975 CTAAAGGAGCAGAATAGTCAAGG - Intronic
1099200992 12:79676701-79676723 CTGAGGGAGCAGAATAGTGAAGG - Intronic
1099555844 12:84107564-84107586 CAGAAGGAGCAGAAGTATACTGG + Intergenic
1099851037 12:88097898-88097920 CTGAATGGGCAGAACTCTGAAGG - Intronic
1101534179 12:105602251-105602273 CTAAAGGACCTGAATTGTGAAGG + Intergenic
1104409882 12:128549196-128549218 CTGAAGGGGCAGAGTTATTCTGG + Intronic
1107868677 13:44727873-44727895 CTGGGGGAGCAGAATTTTTAAGG - Intergenic
1110560837 13:76909364-76909386 GTGAGACAGCAGAATTATGAGGG - Intergenic
1111255469 13:85661922-85661944 CTGAAGGAGCTGAAGTTGGAAGG - Intergenic
1111534695 13:89587667-89587689 ATGAAGGAAAAGAATTATCAGGG - Intergenic
1111583584 13:90255723-90255745 CCGAAGGAGAAGAATTATCATGG - Intergenic
1111726815 13:92021437-92021459 GTGAAAGAGTAGAATGATGATGG + Intronic
1112949826 13:104979364-104979386 CTGAAGGAGCATAATTTAGTTGG + Intergenic
1116354602 14:43913162-43913184 TTGAAGGAGCAGAATAGTCATGG - Intergenic
1117838146 14:59829036-59829058 CTGAAGCAGCTGAATAATGATGG + Intronic
1118440337 14:65806196-65806218 ATGAGGGAGCAGGATGATGAGGG - Intergenic
1118585708 14:67350746-67350768 TTAAAGGAACATAATTATGATGG - Intronic
1118689771 14:68326955-68326977 TTGAAGGAGCAGAGTGATGTTGG - Intronic
1121463171 14:94097631-94097653 CTGGAGCTGCAGAAGTATGAGGG + Intronic
1121465371 14:94112093-94112115 CTAAAGGAGATGAATTCTGATGG - Intronic
1122101520 14:99414140-99414162 ATGAAGAAGCAGATTTATGGCGG - Intronic
1124516462 15:30370850-30370872 CATGAGGAGGAGAATTATGAGGG + Intronic
1124726456 15:32159881-32159903 CATGAGGAGGAGAATTATGAGGG - Intronic
1125231152 15:37457698-37457720 GAGAAGGAGCAGAATTTTCATGG - Intergenic
1126736422 15:51736459-51736481 ATGAAGGAGCATCAGTATGAAGG - Intronic
1126845927 15:52760627-52760649 CAGAGGGAGCAGCATTGTGAAGG + Intronic
1128130257 15:65222544-65222566 GTGAAGTAGCAGAAAGATGAAGG - Intergenic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1129759804 15:78122844-78122866 CTGAATGAGCAGAATGGTTAGGG + Intronic
1130702932 15:86204028-86204050 GTGAAGGATGAGACTTATGATGG + Intronic
1131690395 15:94820892-94820914 CGGAAGGAACAGAATTAAGTTGG - Intergenic
1134555960 16:15165296-15165318 CTAAAATAGCAGATTTATGAAGG + Intergenic
1134916543 16:18077031-18077053 CTAAAATAGCAGATTTATGAAGG + Intergenic
1135858003 16:26029784-26029806 CTGAAGGAGCTGACCCATGAGGG + Intronic
1137647218 16:50086381-50086403 CAGACGGAACAGAATTTTGAAGG + Intronic
1138321211 16:56113630-56113652 CTGAAGAGGCAGAATCATGAAGG - Intergenic
1139395675 16:66636992-66637014 CTGGGAGAGCAGAATTCTGATGG + Intronic
1140025480 16:71286465-71286487 CTGAAGGAGGTAAAGTATGACGG - Intronic
1141962792 16:87420765-87420787 CTGCAGTAGCAGAATTCTGCTGG - Intronic
1142675240 17:1509208-1509230 CTGGAGATGCAGAATTGTGAGGG - Exonic
1145802075 17:27694039-27694061 CAGAAGGAGCAGAAGTATACTGG + Intergenic
1146543774 17:33720266-33720288 CTCCAGAAGCAGAATTAAGAAGG + Intronic
1146564624 17:33901698-33901720 CTAAAGGTGTAGAATTCTGATGG + Intronic
1148162366 17:45458009-45458031 CTGAATGAACATGATTATGATGG + Intronic
1149033947 17:52114250-52114272 CAAAAGGAGCAGAAATCTGAGGG - Intronic
1149045846 17:52244475-52244497 CTGGAGGAGAGGAATTAGGACGG - Intergenic
1149496675 17:57122730-57122752 AAGGAGGAGCAGATTTATGAAGG + Intergenic
1149720465 17:58838960-58838982 CTGGAGGAGGAAAATTATGGTGG + Intronic
1150319712 17:64202380-64202402 GTGAAGGGGCAGAATTAGGGAGG - Intronic
1150393601 17:64804670-64804692 CTGAATGAACATGATTATGATGG + Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1152005867 17:77680741-77680763 CTCAATGAGTAGGATTATGAAGG - Intergenic
1153241382 18:3034315-3034337 CTGGAGGGGCAGAAATATGGAGG + Intergenic
1158964600 18:62611715-62611737 CTGCAGGCGCAGGATTAAGACGG + Intergenic
1164335974 19:24321636-24321658 CAGAAGGAGCAGAAGTATACTGG - Intergenic
1164336297 19:24324355-24324377 CAGAAGGAGCAGAAATATACTGG - Intergenic
1165834257 19:38744596-38744618 CTGATGGAGAAGAAACATGAAGG - Intronic
1165985216 19:39762753-39762775 CTTAAGGATCAGACTTTTGAAGG - Intergenic
1166273369 19:41732987-41733009 ATGAAGGAGCAGATGGATGAGGG - Intronic
1168633635 19:57976696-57976718 TTGAAGGAGCAGGATTCAGAAGG - Intergenic
926099248 2:10103528-10103550 CTGAAGGATCACACTTAGGATGG - Intergenic
927077089 2:19589381-19589403 CTGATGGAGCAGAACTTTGTGGG - Intergenic
927604793 2:24477127-24477149 CTGTAGGAGCAGAGTTAGAAAGG - Intergenic
927629605 2:24761195-24761217 CTGAAGGAGAGGAATAAGGATGG - Intronic
927707679 2:25306919-25306941 CTGAAGGAGCAGACATGTGTGGG - Intronic
928407200 2:31023801-31023823 CTGGAGGAGGAGAGTGATGAGGG - Intronic
929585332 2:43110356-43110378 CTGAAGATGCAGAATTTTGCTGG + Intergenic
930277410 2:49329481-49329503 CTAAAGGAGCAGACTGCTGAAGG - Intergenic
931261160 2:60620510-60620532 CTGAAGGAAGAGAACTATGTTGG - Intergenic
931392721 2:61858197-61858219 CTGAAGGAGCTGAAATTTGCAGG + Intergenic
932962072 2:76424550-76424572 TTAAAGGGGCAGAAATATGAGGG + Intergenic
933194366 2:79371785-79371807 CTAAAGGATCAGAATCATTAAGG - Intronic
936559561 2:113525089-113525111 TTGACAGAGCAAAATTATGAAGG + Intergenic
936944348 2:117917175-117917197 ATGAGGCAGCAGAAATATGAGGG + Exonic
937623454 2:124016812-124016834 CAGAAGGAGAACAACTATGAAGG - Intergenic
939967324 2:148623286-148623308 ATGAAAGAGAAGATTTATGATGG + Intergenic
939983680 2:148810526-148810548 CTGAAGGAAGAGAAATATCACGG - Intergenic
942602189 2:177652700-177652722 ATGAAGGAGAAAAATCATGATGG + Intronic
942999754 2:182311511-182311533 CTGTAGGACCAGAAGTAGGAAGG - Intronic
943676800 2:190723573-190723595 CTGAAAGAGCAAAATAATGGAGG - Intergenic
943682835 2:190786139-190786161 GATATGGAGCAGAATTATGAGGG + Intergenic
944859214 2:203798699-203798721 ATGAAAGAGCAGATTTCTGAAGG - Intergenic
947373555 2:229472919-229472941 CTGAAGGAGCGCAGCTATGAAGG + Intronic
947932943 2:233978979-233979001 CTGAAGAAGCAGAGTGATGTGGG + Intronic
1170750330 20:19139484-19139506 CTGCAGGAGCAGAACTTTCATGG - Intergenic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172273279 20:33666596-33666618 CGGGAGGAGCAGAACTTTGAGGG - Exonic
1172517941 20:35548618-35548640 ATGCAGGAGCAGAAGAATGAAGG + Exonic
1173107593 20:40152338-40152360 CAGATGAAGCAGAAATATGAGGG + Intergenic
1173186138 20:40841813-40841835 CTGAAGGAGCAGCACTAGGCAGG - Intergenic
1174354792 20:49990493-49990515 CTGAAGGAGGAGAAAGATGCCGG + Intergenic
1175459573 20:59142214-59142236 ATGAAGGAGCAGAGCCATGAAGG + Intergenic
1178116987 21:29427638-29427660 CTGAATGAGGAGAGGTATGAGGG + Intronic
1178544844 21:33484464-33484486 CTGGAGGATCAGAGTTATCATGG + Intergenic
1181428156 22:22857176-22857198 CTGAGGGAGAAGAATTCTCAAGG - Intronic
1182737130 22:32538866-32538888 CTGATGGAGGAGAATCCTGACGG + Intronic
1185051067 22:48554227-48554249 TTGAAGGTGCAGAAGTTTGACGG + Intronic
951602659 3:24393790-24393812 CTTAAGGAACAGAATAATGTAGG + Intronic
953470905 3:43165196-43165218 ATGAAGAAACAGATTTATGAAGG - Intergenic
954633956 3:52061487-52061509 CTGAGAGAGAAGAATTATGTTGG - Intergenic
954994507 3:54869355-54869377 TTAAAGAAGCAGAATTAAGAAGG + Intronic
955069858 3:55563258-55563280 CCAGAGGAGCAGAATTCTGATGG - Intronic
957477594 3:80746489-80746511 CTGAAGAGGAAAAATTATGATGG + Intergenic
960098313 3:113709759-113709781 CTGAAGGAGGAGAATTACTTGGG - Intergenic
960536609 3:118822436-118822458 GGGAGGGAGCATAATTATGAAGG + Intergenic
961547119 3:127642382-127642404 ATGAAGCAGCAGATTTATGAAGG + Intronic
961860308 3:129911948-129911970 CTGAAGTGGCATAATTAGGATGG - Intergenic
961923471 3:130451385-130451407 CAGAAGGAGCAGAAGTATACTGG + Intronic
963467155 3:145697940-145697962 CTGAAGGAGCAGAAATCTCAGGG + Intergenic
963995718 3:151706068-151706090 TTAAAGGAGCAGATTTATTATGG - Intergenic
966268696 3:178079152-178079174 CTGAATGAACAGGATTAGGATGG + Intergenic
967773622 3:193361439-193361461 CAGAATTATCAGAATTATGAGGG + Intronic
970119907 4:12741965-12741987 CTGAGGAAGTAGAATAATGAAGG - Intergenic
970463744 4:16302475-16302497 CTGAAGGAGCAGGTTTGTGGTGG - Intergenic
970749604 4:19341939-19341961 ATAAAGGAGCATAATTATTATGG - Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971831242 4:31698631-31698653 AAGAAGTATCAGAATTATGAAGG - Intergenic
971899981 4:32646794-32646816 CAGAAGGAGCAGAAGTATACTGG - Intergenic
972634002 4:40866582-40866604 CTGAAGGATCAAAATTATATCGG - Intronic
972845509 4:42984546-42984568 CTGAAGGAGCTGACTGTTGAAGG - Intronic
972978189 4:44663280-44663302 TTGAAGGAGCAGTTTTCTGAGGG + Intronic
975505684 4:75134201-75134223 GTTAAGGAGCATAATTATGAAGG - Intergenic
977427987 4:96893109-96893131 GAGAAGGAGCAGAGTTCTGATGG - Intergenic
977447342 4:97147766-97147788 CTGAAGGCAGAGAATTCTGAAGG - Intergenic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
980848548 4:138353573-138353595 CTGAAGCAGGAGAATCCTGAAGG + Intergenic
981212503 4:142124657-142124679 CTGAAGGAGCACAAATGTCAGGG + Exonic
981537751 4:145817475-145817497 CTCAAGAAGCAGAATCATGGCGG + Intronic
982289493 4:153765528-153765550 CTGAAGTATGGGAATTATGAGGG - Intergenic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
988281015 5:29147559-29147581 CTAAATGAGCAGAATTATGAGGG + Intergenic
988770433 5:34427499-34427521 CTGCAGGAGTAGAATTCTCATGG - Intergenic
989318071 5:40104897-40104919 CAGAAGGAGCAGAAGTATACTGG - Intergenic
992055381 5:72983742-72983764 CTGAAGGAGCAGAACAAAGTTGG - Intronic
992283766 5:75210566-75210588 TTGAAGGTGCAAATTTATGAAGG - Intronic
993749354 5:91648072-91648094 CTGAAGGAACTTAATTATCAAGG - Intergenic
998513422 5:142732496-142732518 CTGAAGGAGCAGGAGACTGAGGG - Intergenic
1001257020 5:170191783-170191805 CTGAGGAAGCCTAATTATGAAGG + Intergenic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1010510956 6:76718958-76718980 GTGAGAGAGCAGAGTTATGAAGG + Intergenic
1011821626 6:91259985-91260007 TTGAAGGACCAGAGTAATGATGG + Intergenic
1012945322 6:105459859-105459881 CTGAGTGACCAGAATGATGAAGG - Intergenic
1015190839 6:130470523-130470545 CAGAAGCAGCACAATTATGGGGG + Intergenic
1015237868 6:130991510-130991532 CTGTAGGATTAGATTTATGAGGG - Intronic
1015762329 6:136677612-136677634 CTGAAGGAGCAGCCTTCTCATGG + Intronic
1016832524 6:148447885-148447907 CTGAAGGAGCAGCATTTCCAAGG - Intronic
1017209401 6:151838219-151838241 CCGAAGGAGCAGAAGAAGGATGG + Intronic
1017357256 6:153524218-153524240 GTGAAGGTGCAGAATTGGGAAGG + Intergenic
1021906987 7:25344299-25344321 ATGAAGGAGCAAAATTAAAAGGG - Intergenic
1022143920 7:27517825-27517847 TTTAAGGAGAAGATTTATGATGG - Intergenic
1022325038 7:29323413-29323435 CTGTGGTAGCAGAATAATGAGGG - Intronic
1024201503 7:47113121-47113143 CTGAAAGAGAAGAATTATAAGGG - Intergenic
1025003672 7:55339161-55339183 CAGAAGGAGTAGAATGAGGAAGG + Intergenic
1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG + Intronic
1035344522 7:158189352-158189374 CCGAAGGAGGAGCATGATGATGG + Intronic
1036070170 8:5433929-5433951 CTGCAGGAGCAGCATTGAGAAGG + Intergenic
1037131741 8:15414766-15414788 CTGAAGGAGCAGAGAAATGCGGG - Intergenic
1038902954 8:31864584-31864606 GTGCAGGAGCAGAAGAATGAGGG + Intronic
1039858525 8:41436937-41436959 CTGAAGGAGCAGCTATATTATGG - Intergenic
1040858412 8:51973937-51973959 CGGAAGGAGCAGGAAAATGACGG - Intergenic
1043528090 8:81118422-81118444 CTGAATGGGCAGTATTTTGAAGG - Intergenic
1043673980 8:82925850-82925872 CTGAAGGAGCAGAAGTAAAAGGG + Intergenic
1044198279 8:89403968-89403990 CTGAAACAGCAGACTTATAAGGG - Intergenic
1044473265 8:92597181-92597203 CTGAAGCACCAGAATTGAGATGG - Intergenic
1044716429 8:95103966-95103988 CTGATGGAGCAGCCTTATAAAGG - Intronic
1045781013 8:105863792-105863814 CTCAAGGAGTCAAATTATGAAGG + Intergenic
1046494960 8:115001181-115001203 GTGAAGGCCCAGAATTATTACGG + Intergenic
1046610830 8:116423719-116423741 CTGAAGGATTACAATTATGTTGG + Intergenic
1048718123 8:137291194-137291216 CTGAAGGAGCAGATTGAAGTAGG - Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049703065 8:144023738-144023760 CTGAAGGAAGAGAGTTTTGAGGG - Intronic
1049703299 8:144024548-144024570 CTGAAGGAAGAGAGTTTTGAGGG - Intronic
1049893304 9:91134-91156 TTGACAGAGCAAAATTATGAAGG - Intergenic
1049908259 9:239499-239521 TTGAAAGAGCAGAACCATGAAGG + Intronic
1051102639 9:13539305-13539327 CTGAAAGAGAAGAACAATGAGGG - Intergenic
1051435761 9:17029752-17029774 CTGAAGTTGCAGAATTAAGAAGG + Intergenic
1053113535 9:35482308-35482330 ATGAAGGAGCAGGTTTATGCTGG - Intergenic
1053734517 9:41091192-41091214 TTGACAGAGCAAAATTATGAAGG - Intergenic
1054693865 9:68340227-68340249 TTGACAGAGCAAAATTATGAAGG + Intronic
1055381537 9:75712775-75712797 CTGTAGGAACAGAATCTTGATGG + Intergenic
1056260561 9:84843900-84843922 CTGAAAGAGCTGATTTTTGAGGG + Intronic
1058803029 9:108563280-108563302 CTGAGGCAGCTGAATTCTGATGG - Intergenic
1059610635 9:115889065-115889087 CTCAAGGACCAGAAATAGGATGG - Intergenic
1059865925 9:118513889-118513911 CTGAAGCAGGAGAATTGTTAAGG + Intergenic
1061806205 9:133139053-133139075 CTGAGGGAGCACATATATGAAGG - Intronic
1187572937 X:20523673-20523695 CTGAAAAAGCAGAACTATAAGGG + Intergenic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1197828319 X:130614463-130614485 CAGAAGGAGCAGATTTGAGAAGG - Intergenic
1198457834 X:136835008-136835030 ATGAAGGAGCATTATCATGATGG - Intergenic
1199690069 X:150302848-150302870 CTGTAGGAGCAAAATAATGGGGG - Intergenic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic